Next Article in Journal
In Vitro Investigation of Traditional Medicine Recipes Used in Bukavu (DR-Congo) to Treat Trichophyton rubrum Dermatophytosis
Previous Article in Journal
Environmental Pathogen in Healthcare Settings: Candida auris—The Emerging Threat with a Focus on the Middle East and Infection Control Strategies
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Hydroxamic Acid Isolated from Maize Roots Exhibits Potent Antimicrobial Activity Against Pathogenic Escherichia coli in Broiler Chickens

1
College of Veterinary Sciences, Faculty of Animal Husbandry and Veterinary Sciences, The University of Agriculture, Peshawar 25120, Pakistan
2
Department of Poultry Science, Faculty of Animal Husbandry and Veterinary Sciences, The University of Agriculture, Peshawar 25120, Pakistan
3
Guizhou Provincial Key Laboratory for Agricultural Pest Management of the Mountainous Region, Institute of Entomology, College of Animal Science, Guizhou University, Guiyang 550025, China
4
Department of Livestock Management, Breeding and Genetics, The University of Agriculture, Peshawar 25130, Pakistan
*
Author to whom correspondence should be addressed.
Microbiol. Res. 2025, 16(10), 222; https://doi.org/10.3390/microbiolres16100222
Submission received: 18 August 2025 / Revised: 10 September 2025 / Accepted: 12 September 2025 / Published: 9 October 2025

Abstract

Restrictions on adding antibiotics to animal diets have posed challenges in managing gut pathogens, emphasizing the significance of effective non-antibiotic growth promoters to maintain animal health and productivity. This study assessed the efficacy of hydroxamic acid (HA), derived from local maize varieties, as a non-antibiotic growth promoter in broilers. Among 10 different maize varieties, the Azam variety yielded the highest HA concentration (35 ± 7 μg/g of roots), as quantified by high-performance liquid chromatography (HPLC). In vitro antimicrobial assays demonstrated the lowest minimum inhibitory concentration (MIC) of 0.022 mg for Azam-derived HA against pathogenic E. coli. To further assess in vivo efficacy, 108 birds were allocated at random to six treatment groups. The treatments include birds fed a basal diet without an E. coli challenge (negative control); an antibiotic-treated group challenged with E. coli and treated with enrofloxacin at a dosage of 5 milligrams (mg) per kilogram (kg), administered orally once daily from day 5 post-infection (dpi) for 7 consecutive days (standard); broilers challenged with E. coli and supplemented with a basal diet with HA at concentrations of 1, 10, or 100 mg/kg of feed from 5 dpi for one week (HA 1 mg, HA 10 mg, and HA 100 mg, respectively); and broilers challenged with E. coli without enrofloxacin/HA (positive control). The results demonstrated that birds fed a diet supplemented with the HA-100 mg improved the body weight (BW) and feed conversion ratio (FCR) compared to the positive control group. There were no significant differences (p > 0.05) observed for BW and FCR observed for the broilers fed on the standard and HA 100 mg groups. The addition of HA at 100 mg improved (p < 0.05) the hemoglobin (Hb) and packed cell volume (PCV) and reduced (p < 0.05) levels of malondialdehyde (MDA) compared to positive control group. A significantly low carcass weight (p < 0.05) was shown for positive control birds compared to other groups. Our findings indicate that maize-derived HA presents a phytogenic alternative to antibiotics by controlling enteric pathogens and improving health and performance affected by E. coli infection in broilers.

Graphical Abstract

1. Introduction

The expected increase in the global human population to 9 billion by 2050 is a major concern for food security and environmental sustainability [1]. This dramatic increase necessitates a massive demand for animal- and plant-derived food products, such as poultry meat and eggs, to establish a sustainable and safe agricultural system [2]. Meat consumption has significantly increased during the last five decades, with the global market for fresh and processed meat estimated at 277.5 million tons in 2020 and projected to reach 292.92 million tons by 2027 [3]. Intensive production of broiler chickens traditionally relied on various antibiotic growth promoters for enhancing feed efficiency and disease prevention [4]. The emergence of antibiotic-resistant pathogens and regulatory restrictions regarding drug residues necessitate the exploration of alternative options for maintaining poultry health and productivity [5]. These regulatory restrictions on antibiotic growth promoters, coupled with the growing market demand for antibiotic-free products, necessitate the development of effective alternative safe and non-antibiotic feed additives [6].
Phytogenic feed additives (PFA) are potential candidates due to their richness in bioactive compounds, including antioxidants and anti-inflammatory agents, as well as their capacity to modulate gut microbiota by promoting the growth of beneficial bacteria [7,8]. These include essential oils and plant extracts with antiviral, antioxidant, and anti-inflammatory properties that boost poultry growth and productivity [9,10]. For instance, plant-derived components such as carvacrol and thymol had significantly improved weight gain, antioxidant enzyme activities, and immunity in chickens [11,12]. The resveratrol, a natural polyphenol found in various plants, has improved the growth performance, immune response, and control of E. coli infection in broiler chickens [13]. Similarly, various herb extracts and polyphenols have been reported to suppress pathogenic E. coli or Salmonella populations without harming beneficial microbiota [14]. Despite these advantages, PFAs derived have limited obtainability, regulatory issues, and a high cost of production [15]. However, challenges in using phytogenic compounds as animal growth promoters could include potential drawbacks (toxicity, unpleasant odor/taste, instability), regulatory concerns, and possible interactions with other feed ingredients [16]. These shortcomings underscore the need to identify novel phytogenic compounds that are effective and safe for long-term feeding.
Hydroxamic acids (HAs) represent a promising class of phytochemicals and are nitrogen-containing compounds that naturally occur in several cereal crops [17]. These HAs commonly exhibit strong antimicrobial properties [17]. A key feature of HAs is their strong iron-chelating ability, which bacteria normally exploit via siderophores to acquire essential iron [18]. Maize-derived HA may provide several mechanisms of action, including direct inhibition of gut pathogens, chelation of excess metals, and modulation of host antioxidant defenses [19]. Maize plays a central role in poultry feed formulation, and the abundant HAs present in its tissues serve as a novel phytogenic feed additive. However, the utilization of the HAs extracted from the roots of maize is rarely investigated. This study extracted HAs from different maize varieties to analyze their concentration and their impact on in vitro antibacterial activity against pathogenic E. coli, as well as their in vivo effects on broiler performance, carcass yield, and serum parameters. By addressing these aims, this work seeks to establish the feasibility of using maize-derived HAs in broiler diets and contribute new options for non-antibiotic growth promotion in poultry production.

2. Materials and Methods

2.1. Ethical Statement

All experiments were carried out according to the ethics approved by the ethical committee, Faculty of Animal Husbandry and Veterinary Sciences, The University of Agriculture (UoA), Peshawar, Pakistan, vide letter No. 7669/LM, B&G/UoA.

2.2. Cultivation of Maize Varieties

Local maize varieties (n = 10) were obtained from various research institutes (Table S1). In vitro, each variety was cultivated separately using a 90 mm Petri dish in triplicate. The sterile plates were properly labeled and lined with a double layer of sterile tissue paper. The plates inoculated with each variety of grains were incubated for seven days in a dark cabinet with a humid environment (Figure S1A–C).

2.3. Extraction and Quantification of Hydroxamic Acids (HAs)

The extraction of HAs from maize roots was carried out according to the procedure previously described [20]. Briefly, post-cultivation for a week, the roots of maize seedlings were cut down, weighed, and immediately frozen in liquid nitrogen and ground. The ground samples were then reconstituted in the extraction buffer. Samples were sonicated at a frequency of 40 kHz, power of 200 W, and amplitude of 3 mm using an ultrasonic cleaner for 10 min (BioBase, Jinan, China), and then centrifuged at 10,000 rpm for 10 min. The supernatant was filtered (0.45 μm) into HPLC vials for further processing. The samples were analyzed using an HPLC system (ECOM HPLC, Chrášťany-Rudná u Prahy, Czech Republic) with a betasil C18 column (250 mm × 4.6 mm; Thermo-Scientific, Waltham, MA, USA) and a UV detector set at 254 nm. The mobile phase comprised a combination of HPLC-grade water (solution A) and methanol/isopropanol/acetic acid (3800/200/1; v/v; solution B). The flow rate was 1 mL/min, beginning with isocratic conditions at 10% b for 2 min, linear gradient to 50% b from 2 to 27 min, isocratic conditions at 50% b from 27 to 29 min, linear reverse gradient to 10% b from 29 to 31 min, and isocratic conditions at 10% b from 31 to 35 min. Upon analysis of all samples through HPLC, HA content in each variety was quantified from the peak area running different concentrations of HA compared to the standard chromatograph obtained by HPLC (Figure S2). Retention times of the HA were optimized using synthetic HA standards, wholeheartedly provided by Prof. Dr. Dieter Sicker, University of Leipzig.

2.4. Isolation and Identification of the Prevalent E. coli Strain in Birds

Various samples, such as liver, cloacal, and intestinal swabs, were collected from broilers diagnosed with E. coli infection by necropsy at the Veterinary Research Institute, Peshawar, Pakistan. The collected samples were cultured in nutrient broth (for enrichment of the pathogen) and incubated at 37 °C for 24 h to facilitate the detection and isolation of E. coli. The samples showing growth were inoculated on MacConkey agar. The streaked plates were labeled and incubated overnight at 37 °C. The Petri plates were observed for typical E. coli colonies. Characteristic E. coli colonies were identified microscopically as described previously [21] 5. Moreover, the E. coli O157:H7 strain was confirmed by biochemical tests and polymerase chain reaction (PCR) using species-specific primers (Table 1). After confirmation, typical E. coli colonies were subculture for purification of the prevalent E. coli strain in broilers. The purified strain was stored in glycerol (15% v/v) at −86 °C for further experiments.

2.5. In Vitro Antimicrobial Bioassay of Hydroxamic Acid Against E. coli Isolate

To determine the MIC of HA, extracts from the selected maize varieties were tested for their antibacterial activity against local pathogenic E. coli using the broth dilution method, as previously described [22]. In brief, the test was carried out in 96-well microtiter plates. Each well was filled with 200 μL of nutrient broth, followed by the addition of 10 μL of the HA extract in triplicate, resulting in an initial concentration of 11.66 mg/well. A two-fold serial dilution was then carried out to obtain a range of concentrations: 5.83 mg, 2.91 mg, 1.45 mg, 0.72 mg, 0.36 mg, 0.18 mg, 0.091 mg, 0.045 mg, 0.022 mg, 0.011 mg, and 0.005 mg per well. This procedure was repeated in triplicate for each maize variety extract. Afterward, 10 μL of washed E. coli culture (OD600 = 0.3) was added to all wells, except for the negative control. A positive control consisting of bacterial culture in nutrient broth without HA extract was also included. The plate was covered with aluminum foil before incubation at 37 °C for 24 h. Bacterial growth was evaluated by measuring absorbance at 600 nm (OD600) with a spectrophotometer after 24 h.

2.6. Animals and Experimental Layout

One-day-old male broiler chicks were procured from a commercial poultry farm and raised under hygienic conditions using controlled light/dark cycles. Drinking water and feed were provided ad libitum. All birds were screened for E. coli O157:H7, and none tested positive.

2.7. Experimental Design

Broilers, with an average body weight (36.59 ± 0.6 g) were selected and allowed to acclimate for seven days. After acclimation, chickens were randomly assigned to 6 groups: a negative control group fed a basal diet devoid of E. coli challenge (negative control); an antibiotic-treated group challenged with E. coli (108 cfu/mL for three consecutive days) and treated with enrofloxacin at 5 mg/kg by 5 dpi for one week (standard, Std); groups challenged with E. coli and supplemented with HA at 1, 10, or 100 mg/kg by 5 dpi for one week (HA 1 mg, HA 10 mg, and HA 100 mg, respectively); and a group challenged with E. coli without any treatment (positive control). Each treatment consists of 3 replicates, with 6 birds/replicate. The formulated basal diet and its calculated composition are presented in Table 2. The temperature was progressively reduced by 2 °C/week from 33 to 23 °C and then kept constant. By day 28 of the experiment, all chickens were necropsied for further analyses.

2.8. Inoculation of Experimental Birds with an Isolated E. coli Strain

The E. coli strain (O157:H7) isolated from infected birds was used for the induction of experimental infection in birds. The bacterial strain was grown in nutrient broth and reconfirmed through species-specific PCR. The procedure for infecting the experimental birds with E. coli involved the use of a syringe to inoculate a 200 μL culture solution, comprising 108 cfu/mL of E. coli, into the gastrointestinal tract (GIT) of the broilers for three consecutive days.

2.9. Growth Performance of Experimental Birds

Experimental chickens were weighed weekly, and feed consumption for each replicate was measured weekly until the end of the experiment. Feed intake, BW gain, FCR, and carcass yield were calculated for each group of birds. By day 28 of age, one bird close to the average weight was selected from each replicate.

2.10. Serum Parameters of Experimental Birds

Blood samples were collected (6 samples/treatment, 2/replicate) by 28 dpi. Serum was separated from whole blood by centrifugation for 5 min at 10,000 rpm for MDA [23]). Serum samples were used for the estimation of MDA by adopting a spectrometric procedure as reported elsewhere [23]). A serum sample and a solution containing 20 μL of sodium dodecyl sulfate (SDS, 8.1%), 1500 μL of thiobarbituric acid (0.8%), and 1.5 mL of citric acid (20%) with a 3.5 pH were used. A glass bath was used for heating the mixture at 95 °C for 1 h. When the mixture temperature dropped to room temperature, an additional mixture comprising 1 mL of distilled water, n-butanol (1:15, v/v), and 500 μL of pyridine was added and vortexed. The mixture was centrifuged at 3000 rpm for 10 min, resulting in the formation of an organic layer. The absorbance of the organic phase was measured at 352 nm using a spectrophotometer. Lipid peroxide levels were expressed as nanomoles (nM) of MDA.

2.11. Hematological Parameters of Experimental Birds

Blood samples were collected in sterile tubes from three birds per replicate in each group. Whole blood was used for the estimation of the hematological profile of birds, i.e., total leukocyte count (TLC), Hb estimation, and PCV.

2.12. Statistical Analysis

Data were compiled using Microsoft Excel and analyzed with SPSS (V-20.0; IBM Corp., Armonk, NY, USA). One-way ANOVA was conducted to assess the variances among treatment groups. When ANOVA indicated significant differences (p < 0.05), Tukey’s test was used for post hoc comparisons to identify specific group differences. Results were presented as means ± standard error of the mean (SEM) from all replicates per treatment. Statistical significance was determined at p < 0.05, with different lowercase letters indicating significant differences among means.

3. Results

3.1. Quantification and Chromatographic Analysis of HA in Maize Varieties

The HA content of local maize cultivars was determined using HPLC, as illustrated in Figure S2. Among the tested varieties, the ‘Azam’ variety demonstrated the highest HA concentration, measuring 35 ± 7 µg/g in roots, as confirmed by a prominent peak closely matching the standard chromatogram (Figure S2). There were moderate levels observed for ‘Kaptan’ (23 ± 4 µg/g), ‘Pak of Goi’ (20 ± 5 µg/g), and ‘Jalal’ (15 ± 5 µg/g), with corresponding visible peaks in their chromatograms. The lower concentrations were recorded in ‘Malhan’ (14 ± 4 µg/g), ‘Sweet Corn’ (12 ± 5 µg/g), ‘Pahari’ (11 ± 5 µg/g), and ‘Saad’ (10 ± 7 µg/g), while the varieties ‘Iqbal’ and ‘Edhi’ exhibited the lowest HA levels of 8 ± 5 µg/g and 5 ± 2 µg/g, respectively (Table 3).

3.2. Isolation, Biochemical Identification, and Molecular Confirmation of E. coli

Field samples collected from broilers exhibiting signs of colibacillosis were allowed to grow in nutrient broth at 37 °C for 24 h. When streaked onto MacConkey agar, the enriched samples produced small, circular, rose-pink colonies with raised margins, typical of lactose-fermenting E. coli (Figure 1A,B). Subsequent Gram staining confirmed the isolates as Gram-negative, short rod-shaped bacilli under light microscopy (Figure 1C).
The presence of E. coli was further confirmed using biochemical tests. On triple sugar iron (TSI) agar, the isolates produced a yellow discoloration, indicating acid production from lactose fermentation (Figure 2A). A positive indole test was evidenced by the formation of a pink-red ring at the top of the medium (Figure 2B), while a positive methyl red test confirmed mixed acid fermentation (Figure 2C). Samples were also positive for E. coli by the methyl red test. The isolates tested negative for the Voges–Proskauer, urease, and Simmons citrate tests, as shown by the absence of color change (Figure 2D).
PCR confirmed the identity of the isolated strain as E. coli O157:H7 by amplifying specific fragments of 259 bp and 625 bp using targeted primers (Figure 3A,B).

3.3. In Vitro Antibacterial Bioassay Determined the MIC of Hydroxamic Acid for E. coli

The MIC of HA extracted from different maize varieties was evaluated against a local isolate of E. coli using the broth microdilution method. HA extracts were twofold serially diluted in 96-well microtiter plates before the addition of the bacterial suspension. Among all tested varieties, the HA extract from Azam exhibited the most potent antibacterial activity, showing the lowest MIC at 0.022 mg, while the extract from Edhi demonstrated the least activity with the highest MIC at 5.83 mg. These results reflect the variation in antimicrobial potential among different maize varieties. The complete MIC profile is presented in Figure 4 (Table S2).

3.4. Hydroxamic Acid Extract Improved the Growth Performance of E. coli-Infected Birds

The HA supplementation significantly affects the BW gain across all growth phases among the dietary treatments, which are presented in Figure 5. The addition of HA to the feed significantly improved the BW gain across the treatments. A significantly low BW was shown in the positive group during the growth phase as compared to the remaining groups. There were no significant differences among the negative control group, HA 100 mg, and the standard group. Similarly, the HA 100 mg and the negative control group showed the highest feed intake compared to the other groups. The positive control groups showed a significantly reduced feed intake as compared to the other groups. The supplementation of HA into the diet of broilers significantly improved the feed intake during the experimental period. The incorporation of HA into the broiler’s diet significantly improved the FCR as compared to the positive control group. The carcass yield was significantly increased with the incorporation of the HA into the broiler’s diet. These results indicated that dietary HA supplementation improved the growth performance of E. coli-infected chickens.

3.5. Hydroaxamic Acid Enhanced the Blood Parameters Linked with Oxidative Stress and Inflammatory Responses in E. coli-Infected Birds

The supplementation of HA into the broilers exhibited a significantly reduced MDA content in serum compared to the positive group (Figure 6). The hemoglobin and PCV significantly improved in birds fed on HA 100 mg when compared with the positive control group (Figure 6). Additionally, compared to the positive group, leukocyte counts were also found to be significantly improved in the HA 100 mg group. These results indicated that dietary HA supplementation alleviated the oxidative stress and pro-inflammatory response caused by E. coli.

4. Discussion

The increasing global restriction on antibiotics as growth promoters in poultry production, aimed at reducing antimicrobial-resistant pathogens, poses significant challenges for the poultry industry [24]. This necessitates the development of alternative non-antibiotic feed additives with consistent efficacy. Although compounds such as organic acids and probiotics have been investigated, their inconsistent performance limits their application [25]. In this study, HA was extracted from local maize varieties (roots of seedlings) as a non-antibiotic alternative growth promoter with antimicrobial properties against pathogenic E. coli O157:H7 in broilers. After one week of cultivation, the roots of maize seedlings were harvested, and their HA concentration was determined. Previous studies have shown maximal HA accumulation during early germination [26], followed by a decline as the plant matures.
The current study showed that local maize varieties differ significantly in terms of the HA content and associated bioactivity. Using HPLC, HA at differing concentrations across the ten maize genotypes was identified, with the Azam variety resulting in the highest HA content. This variation, specific to cultivars, corresponds with previous findings regarding intraspecific differences in maize benzoxazinoids [17,27]. For example, Davis et al. (2000) quantified DIMBOA in young maize roots ranging from ~92 to 246 µg/g among four lines [27]. It is widely established that cereals such as maize use HAs as defensive chemicals against pests and pathogens [17]. Consistent with this, we observed that varieties exhibiting elevated HA levels generally demonstrated enhanced antibacterial activity. The pronounced bioactivity of Azam-derived HA indicates that genetic factors govern the accumulation of benzoxazinoids in maize, suggesting that the selection of HA-rich genotypes may improve the effectiveness of maize-based feed additives.
In vitro assays confirmed that HA extracts from the maize can inhibit E. coli. The Azam extract exhibited the lowest MIC (0.022 mg) against the poultry-derived E. coli strain, while the Edhi variant, characterized by the lowest HA, demonstrated a significantly larger MIC (5.83 mg). This variation in MIC emphasizes the significance of HA content in antibiotic efficacy. Our findings align with previous research indicating that maize benzoxazinoids, particularly DIMBOA, exhibit broad-spectrum antibacterial properties [28]. For instance, Gleńsk et al. (2016) reported that purified DIMBOA inhibited E. coli growth on agar and exhibited “potent free-radical scavenging activity” [28]. Furthermore, benzoxazinoid hydroxamic acids are known for their ability to produce health-protecting effects, including antimicrobial and anti-inflammatory activities [17]. Thus, the superior in vitro efficacy of Azam HA likely reflects both its higher DIMBOA/DIBOA content and the inherent bioactivity of these compounds. The results of the current study, based on the previous studies, which primarily concentrated on plant pathogens or model microbes, demonstrate that maize HAs can directly inhibit an avian E. coli isolate. This supports their potential application as natural antimicrobials in poultry production.
Crucially, dietary supplementation with Azam-derived HA enhanced growth performance and health in E. coli-challenged broilers. Birds receiving HA showed significantly higher BW gain, FI, improved FCR, and carcass yield compared to infected controls. These growth-promoting effects are consistent with numerous studies of PFAs. Essential oils and botanical extracts—which share many functional phytochemicals with maize HA—have frequently been reported to boost poultry performance [29]. For example, eugenol [30], thymol and limonene [31], and carvacrol alone [32] have been shown to promote growth performance of broiler chickens. Similarly, curcuminoids and turmeric extracts (rich in anti-inflammatory compounds) improved growth in both slow- and fast-growing broilers [33,34]. Similar positive effects on production performance were obtained by supplementing laying hens’ diets with thymol and cinnamaldehyde [30] and star anise oil [35] and peppermint oil [36]. The improvement of FCR and weight gain likely reflects enhanced nutrient utilization and gut health; in agreement, previous reports note that PFAs often increase FI, stimulate digestion, and improve feed efficiency [37]. Notably, in a recent study, an encapsulated blend of essential oils and organic acids improved FCR and BW in broilers infected with avian pathogenic E. coli [38]. Importantly, HA-fed birds in our trial performed as well as or better than antibiotic-treated controls, suggesting that HAs can mitigate the growth-retarding effects of colibacillosis. Similarly, we observed that HA supplementation significantly improved production indices under bacterial challenge, underscoring the capacity of phytogenic compounds to sustain performance under health stress.
The HA incorporation into the animal feed had favorable effects on oxidative status and immune parameters. Infected control birds exhibited elevated lipid peroxidation (high MDA) and likely mounting inflammation, whereas HA-treated birds showed markedly lower MDA levels and reduced clinical signs of colibacillosis. The antioxidant effect appears credible, considering that benzoxazinoid hydroxamic acids, such as DIMBOA, serve as potent radical scavengers. Previous research showed that DIMBOA “exhibits a potent free-radical scavenging activity” in vitro and diminishes oxidative stress [17,28]. By neutralizing free radicals, HA has the potential to protect tissues from damage caused by infections, thereby promoting improved growth and overall health. Numerous studies indicate that phytogenic supplements in poultry can reduce MDA levels and enhance endogenous antioxidant defenses during challenging conditions [39].
Collectively, our results demonstrated the promise of maize-derived HA as a phytogenic antibiotic alternative in poultry diets. By enhancing the performance and immune resilience in E. coli-infected broilers, HA mimics many desired attributes of conventional antibiotics without the residue or resistance concerns. This fits into the larger trend of replacing in-feed antibiotics with natural additives. Recent reviews indicate that phytogenics can enhance FI, stimulate digestion, improve feed efficiency, promote growth performance, and decrease disease incidence through the modulation of gut microbiota and immune responses [37].

5. Conclusions

This study confirms the viability of extracting HA, a phytogenic growth promoter, from local maize varieties. HPLC quantification revealed significant varietal differences, with the Azam variety containing the highest HA concentration (35 μg/g roots). In broilers, dietary HA supplementation (100 mg/kg) effectively reduced pathogenic E. coli load and improved gut health, leading to enhanced feed utilization and superior growth performance. Notably, HA outperformed the standard antibiotic enrofloxacin in promoting growth. Therefore, adding HA-rich maize extracts to feed could thus serve as a promising and cost-effective, residue-free, non-antibiotic growth promoter. Its use in poultry production can improve animal performance while combating antimicrobial resistance (AMR) and enhancing food safety. Further work should optimize HA dosage and formulation and clarify the molecular pathways involved.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/microbiolres16100222/s1: Figure S1: (A) Maize varieties cultivated in 90 mm Petri dishes. (B) Maize varieties germinate by day 7 post-inoculation. (C) Preparation of seedlings’ roots for the extraction of HA. Figure S2: HPLC analysis and quantification of Hydroxamic acid in local maize varieties. (A) Chromatographs of reference/standard HA. (B) Azam variety having 35 ± 7 (μg/g roots) HA. (C) Kaptan variety having 23 ± 4 (μg/g roots) HA. (D) Pak of goi variety having 20 ± 5 (μg/g roots) HA. (E) Jalal variety having 15 ± 5 (μg/g roots) HA. (F) Malhan variety having 14 ± 4 (μg/g roots) HA. (G) Sweet Corn variety having 12 ± 5 (μg/g roots) HA. (H) Pahari variety having 11 ± 5 (μg/g roots) HA. (I) Saad variety having 10 ± 7 (μg/g roots) HA. (J) Iqbal variety having 8 ± 5 (μg/g roots) HA. (K) Edhi variety having 5 ± 2 (μg/g roots) HA. Table S1: Local maize varieties cultivated for the extraction of Hydroxamic Acid. Table S2: MIC of Hydroxamic Acid extracted from different Maize varieties against E. coli.

Author Contributions

Conceptualization, Q.U. and F.A.K.; methodology, Q.U., S.A. and F.A.K.; software, Q.U., S.A. and I.A.; validation, S.A., I.A., S.K. (Sarzamin Khan) and F.A.K.; formal analysis, S.K. (Sarzamin Khan), R.K. and F.A.K.; investigation, Q.U.; resources, S.A., R.K. and F.A.K.; data curation, Q.U. and S.A.; writing—original draft preparation, Q.U., S.K. (Samiullah Khan) and F.A.K.; writing—review and editing, S.K. (Samiullah Khan), R.K. and F.A.K.; visualization, S.A. and F.A.K.; supervision, F.A.K.; project administration, S.A. and F.A.K.; funding acquisition, S.A., R.K. and F.A.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Higher Education Commission (HEC) of Pakistan-National Research Program for Universities (NRPU)-grant number I/9049 and Pakistan Science Foundation (PSF)-grant numbers PSF-887/PSF-891.

Institutional Review Board Statement

The animal study protocol was approved by the Ethics Committee of the Faculty of Animal Husbandry and Veterinary Sciences, The University of Agriculture, Peshawar, Pakistan (No. 7669/LM, B&G/UoA, dated 26 January 2023).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author.

Acknowledgments

We are very much grateful to the Pathology Lab and Pharmacology Lab, College of Veterinary Sciences, The University of Agriculture, Peshawar, for moral and technical support. We are also grateful to the Department of Poultry Sciences, The University of Agriculture, Peshawar, for providing support in experimentation. Directorate of Farms, The University of Agriculture, Peshawar, for providing maize varieties.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
HAHydroxamic acid
AMRAntimicrobial resistance
bpBase pair
BWBody weight
CfuColony-forming unit
dpiDay post-infection
E. coliEscherichia coli
FCRFeed conversion ratio
FIFeed intake
GITGastrointestinal tract
HPLCHigh-performance liquid chromatography
HbHemoglobin
MDAMalondialdehyde
MICMinimum inhibitory concentration
nMNanomole
PCVPacked cell volume
PFAPhytogenic feed additive
PCRPolymerase chain reaction
StdStandard
SDSSodium dodecyl sulfate
SEMStandard error of the mean
TLCTotal leukocyte count
TSITriple sugar iron
UoAThe University of Agriculture

References

  1. McKenzie, F.C.; Williams, J. Sustainable food production: Constraints, challenges and choices by 2050. Food Secur. 2015, 7, 221–233. [Google Scholar] [CrossRef] [Scilit]
  2. Webb, R.; Buratini, J. Global challenges for the 21st century: The role and strategy of the agri-food sector. Anim. Reprod. (AR) 2018, 13, 133–142. [Google Scholar] [CrossRef] [Scilit]
  3. Sani, M.A.; Zhang, W.; Abedini, A.; Khezerlou, A.; Shariatifar, N.; Assadpour, E.; Zhang, F.; Jafari, S.M. Intelligent packaging systems for the quality and safety monitoring of meat products: From lab scale to industrialization. Food Control 2024, 160, 110359. [Google Scholar] [CrossRef] [Scilit]
  4. Gadde, U.; Kim, W.; Oh, S.; Lillehoj, H.S. Alternatives to antibiotics for maximizing growth performance and feed efficiency in poultry: A review. Anim. Health Res. Rev. 2017, 18, 26–45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Wickramasuriya, S.S.; Ault, J.; Ritchie, S.; Gay, C.G.; Lillehoj, H.S. Alternatives to antibiotic growth promoters for poultry: A bibliometric analysis of the research journals. Poult. Sci. 2024, 103, 103987. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Apostolakos, I.; Laconi, A.; Mughini-Gras, L.; Yapicier, Ö.Ş.; Piccirillo, A. Occurrence of colibacillosis in broilers and its relationship with avian pathogenic Escherichia coli (APEC) population structure and molecular characteristics. Front. Vet. Sci. 2021, 8, 737720. [Google Scholar] [CrossRef] [Scilit]
  7. Davani-Davari, D.; Negahdaripour, M.; Karimzadeh, I.; Seifan, M.; Mohkam, M.; Masoumi, S.J.; Berenjian, A.; Ghasemi, Y. Prebiotics: Definition, types, sources, mechanisms, and clinical applications. Foods 2019, 8, 92. [Google Scholar] [CrossRef] [Scilit]
  8. Cross, D.; McDevitt, R.; Hillman, K.; Acamovic, T. The effect of herbs and their associated essential oils on performance, dietary digestibility and gut microflora in chickens from 7 to 28 days of age. Br. Poult. Sci. 2007, 48, 496–506. [Google Scholar] [CrossRef] [Scilit]
  9. Biswas, S.; Kim, I. A thorough review of phytogenic feed additives in non-ruminant nutrition: Production, gut health, and environmental concerns. J. Anim. Sci. Technol. 2025, 67, 497–519. [Google Scholar] [CrossRef] [Scilit]
  10. Brenes, A.; Roura, E. Essential oils in poultry nutrition: Main effects and modes of action. Anim. Feed Sci. Technol. 2010, 158, 1–14. [Google Scholar] [CrossRef] [Scilit]
  11. Navarro, M.; Stanley, R.; Cusack, A.; Sultanbawa, Y. Combinations of plant-derived compounds against campylobacter in vitro. J. Appl. Poult. Res. 2015, 24, 352–363. [Google Scholar] [CrossRef] [Scilit]
  12. Hashemipour, H.; Kermanshahi, H.; Golian, A.; Veldkamp, T. Effect of thymol and carvacrol feed supplementation on performance, antioxidant enzyme activities, fatty acid composition, digestive enzyme activities, and immune response in broiler chickens. Poult. Sci. 2013, 92, 2059–2069. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Mohebodini, H.; Jazi, V.; Bakhshalinejad, R.; Shabani, A.; Ashayerizadeh, A. Effect of dietary resveratrol supplementation on growth performance, immune response, serum biochemical indices, cecal microflora, and intestinal morphology of broiler chickens challenged with Escherichia coli. Livest. Sci. 2019, 229, 13–21. [Google Scholar] [CrossRef] [Scilit]
  14. Rahman, M.R.T.; Fliss, I.; Biron, E. Insights in the development and uses of alternatives to antibiotic growth promoters in poultry and swine production. Antibiotics 2022, 11, 766. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Gonçalves, D.A.; González, A.; Roupar, D.; Teixeira, J.A.; Nobre, C. How prebiotics have been produced from agro-industrial waste: An overview of the enzymatic technologies applied and the models used to validate their health claims. Trends Food Sci. Technol. 2023, 135, 74–92. [Google Scholar] [CrossRef] [Scilit]
  16. Yang, C.; Chowdhury, M.K.; Hou, Y.; Gong, J. Phytogenic compounds as alternatives to in-feed antibiotics: Potentials and challenges in application. Pathogens 2015, 4, 137–156. [Google Scholar] [CrossRef] [Scilit]
  17. Guo, B.; Zhang, Y.; Li, S.; Lai, T.; Yang, L.; Chen, J.; Ding, W. Extract from maize (Zea mays L.): Antibacterial activity of dimboa and its derivatives against ralstonia solanacearum. Molecules 2016, 21, 1397. [Google Scholar] [CrossRef] [Scilit]
  18. Al Shaer, D.; Al Musaimi, O.; de la Torre, B.G.; Albericio, F. Hydroxamate siderophores: Natural occurrence, chemical synthesis, iron binding affinity and use as trojan horses against pathogens. Eur. J. Med. Chem. 2020, 208, 112791. [Google Scholar] [CrossRef] [Scilit]
  19. Syed, Z.; Sonu, K.; Dongre, A.; Sharma, G.; Sogani, M. A review on hydroxamic acids: Widespectrum chemotherapeutic agents. Int. J. Biol. Biomed. Eng. 2020, 14, 75–88. [Google Scholar] [CrossRef] [Scilit]
  20. Ahmad, S.; Veyrat, N.; Gordon-Weeks, R.; Zhang, Y.; Martin, J.; Smart, L.; Glauser, G.; Erb, M.; Flors, V.; Frey, M. Benzoxazinoid metabolites regulate innate immunity against aphids and fungi in maize. Plant Physiol. 2011, 157, 317–327. [Google Scholar] [CrossRef] [Scilit]
  21. Fesseha, H.; Mathewos, M.; Aliye, S.; Mekonnen, E. Isolation and antibiogram of Escherichia coli O157: H7 from diarrhoeic calves in urban and peri-urban dairy farms of Hawassa town. Vet. Med. Sci. 2022, 8, 864–876. [Google Scholar] [CrossRef] [Scilit]
  22. Neal, A.L.; Ahmad, S.; Gordon-Weeks, R.; Ton, J. Benzoxazinoids in root exudates of maize attract pseudomonas putida to the rhizosphere. PLoS ONE 2012, 7, e35498. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Zeb, A.; Ullah, F. A Simple Spectrophotometric Method for the Determination of Thiobarbituric Acid Reactive Substances in Fried Fast Foods. J. Anal. Methods Chem. 2016, 2016, 9412767. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Hartady, T.; Syamsunarno, M.R.A.; Priosoeryanto, B.P.; Jasni, S.; Balia, R.L. Review of herbal medicine works in the avian species. Vet. World 2021, 14, 2889. [Google Scholar] [CrossRef] [Scilit]
  25. Xie, A.; Gao, M.; Du, H.; Pan, X. Next-generation probiotics delivery: Innovations and applications of single-cell encapsulation. Curr. Opin. Food Sci. 2025, 61, 101234. [Google Scholar] [CrossRef] [Scilit]
  26. Morse, S.; Wratten, S.; Edwards, P.; Niemeyer, H. Changes in the hydroxamic acid content of maize leaves with time and after artificial damage; implications for insect attack. Ann. Appl. Biol. 1991, 119, 239–249. [Google Scholar] [CrossRef] [Scilit]
  27. Davis, C.S.; Ni, X.; Quisenberry, S.S.; Foster, J.E. Identification and quantification of hydroxamic acids in maize seedling root tissue and impact on western corn rootworm (coleoptera: Chrysomelidae) larval development. J. Econ. Entomol. 2000, 93, 989–992. [Google Scholar] [CrossRef] [Scilit]
  28. Gleńsk, M.; Gajda, B.; Franiczek, R.; Krzyżanowska, B.; Biskup, I.; Włodarczyk, M. In Vitro evaluation of the antioxidant and antimicrobial activity of dimboa [2,4-dihydroxy-7-methoxy-2 h-1,4-benzoxazin-3 (4 h)-one]. Nat. Prod. Res. 2016, 30, 1305–1308. [Google Scholar] [CrossRef] [Scilit]
  29. Abdelli, N.; Solà-Oriol, D.; Pérez, J.F. Phytogenic feed additives in poultry: Achievements, prospective and challenges. Animals 2021, 11, 3471. [Google Scholar] [CrossRef] [Scilit]
  30. Paraskeuas, V.; Fegeros, K.; Palamidi, I.; Hunger, C.; Mountzouris, K.C. Growth performance, nutrient digestibility, antioxidant capacity, blood biochemical biomarkers and cytokines expression in broiler chickens fed different phytogenic levels. Anim. Nutr. 2017, 3, 114–120. [Google Scholar] [CrossRef] [Scilit]
  31. Hafeez, A.; Männer, K.; Schieder, C.; Zentek, J. Effect of supplementation of phytogenic feed additives (powdered vs. Encapsulated) on performance and nutrient digestibility in broiler chickens. Poult. Sci. 2016, 95, 622–629. [Google Scholar] [CrossRef] [Scilit]
  32. Liu, S.; Song, M.; Yun, W.; Lee, J.; Lee, C.; Kwak, W.; Han, N.; Kim, H.; Cho, J. Effects of oral administration of different dosages of carvacrol essential oils on intestinal barrier function in broilers. J. Anim. Physiol. Anim. Nutr. 2018, 102, 1257–1265. [Google Scholar] [CrossRef] [Scilit]
  33. Hang, T.; Molee, W.; Khempaka, S.; Paraksa, N. Supplementation with curcuminoids and tuna oil influenced skin yellowness, carcass composition, oxidation status, and meat fatty acids of slow-growing chickens. Poult. Sci. 2018, 97, 901–909. [Google Scholar] [CrossRef] [Scilit]
  34. Nm, J.; Joseph, A.; Maliakel, B.; Im, K. Dietary addition of a standardized extract of turmeric (turmafeed tm) improves growth performance and carcass quality of broilers. J. Anim. Sci. Technol. 2018, 60, 1–9. [Google Scholar] [CrossRef] [Scilit]
  35. Yu, C.; Wei, J.; Yang, C.; Yang, Z.; Yang, W.; Jiang, S. Effects of star anise (Illicium verum hook.F.) essential oil on laying performance and antioxidant status of laying hens. Poult. Sci. 2018, 97, 3957–3966. [Google Scholar] [CrossRef] [Scilit]
  36. Abdel-Wareth, A.; Lohakare, J. Productive performance, egg quality, nutrients digestibility, and physiological response of bovans brown hens fed various dietary inclusion levels of peppermint oil. Anim. Feed Sci. Technol. 2020, 267, 114554. [Google Scholar] [CrossRef] [Scilit]
  37. Ayalew, H.; Zhang, H.; Wang, J.; Wu, S.; Qiu, K.; Qi, G.; Tekeste, A.; Wassie, T.; Chanie, D. Potential feed additives as antibiotic alternatives in broiler production. Front. Vet. Sci. 2022, 9, 916473. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Pham, V.H.; Abbas, W.; Huang, J.; Guo, F.; Zhang, K.; Kong, L.; Zhen, W.; Guo, Y.; Wang, Z. Dietary coated essential oil and organic acid mixture supplementation improves health of broilers infected with avian pathogenic Escherichia coli. Anim. Nutr. 2023, 12, 245–262. [Google Scholar] [CrossRef] [Scilit]
  39. Obianwuna, U.E.; Chang, X.; Oleforuh-Okoleh, V.U.; Onu, P.N.; Zhang, H.; Qiu, K.; Wu, S. Phytobiotics in poultry: Revolutionizing broiler chicken nutrition with plant-derived gut health enhancers. J. Anim. Sci. Biotechnol. 2024, 15, 169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Isolation and identification of E. coli by conventional approaches. (A) Turbidity of nutrient broth showing expected growth of E. coli. (B) Rose pink-colored colonies on MacConkey agar, indicating growth of E. coli. (C) Gram-negative, pink color, short rods under the microscope reveal the presence of E. coli.
Figure 1. Isolation and identification of E. coli by conventional approaches. (A) Turbidity of nutrient broth showing expected growth of E. coli. (B) Rose pink-colored colonies on MacConkey agar, indicating growth of E. coli. (C) Gram-negative, pink color, short rods under the microscope reveal the presence of E. coli.
Microbiolres 16 00222 g001
Figure 2. Identification of E. coli by biochemical approaches. (A) Absence of citrate utilization and appearance of yellowish color indicate E. coli growth. (B) Positive indole test for E. coli, indicated by pink-ring. (C) Positive methyl red test for E. coli. (D) No growth of E. coli in Voges–Proskauer medium.
Figure 2. Identification of E. coli by biochemical approaches. (A) Absence of citrate utilization and appearance of yellowish color indicate E. coli growth. (B) Positive indole test for E. coli, indicated by pink-ring. (C) Positive methyl red test for E. coli. (D) No growth of E. coli in Voges–Proskauer medium.
Microbiolres 16 00222 g002
Figure 3. Confirmation of E. coli O157:H7 strain by PCR; (A) An amplicon of 259 bp is generated by targeting the O157 gene of E. coli. Lane M: 100 bp Marker and Lane 1–4 represent positive samples while Lane 5 represents a negative sample. (B) Amplicon of 625 bp is generated by targeting the flicH7 gene of E. coli; Lane M: 100 bp Marker; Lane 1–3 +ve samples, while Lane 4 represents a negative sample.
Figure 3. Confirmation of E. coli O157:H7 strain by PCR; (A) An amplicon of 259 bp is generated by targeting the O157 gene of E. coli. Lane M: 100 bp Marker and Lane 1–4 represent positive samples while Lane 5 represents a negative sample. (B) Amplicon of 625 bp is generated by targeting the flicH7 gene of E. coli; Lane M: 100 bp Marker; Lane 1–3 +ve samples, while Lane 4 represents a negative sample.
Microbiolres 16 00222 g003
Figure 4. MIC of hydroxamic acid extracted from local maize varieties against locally isolated E. coli.
Figure 4. MIC of hydroxamic acid extracted from local maize varieties against locally isolated E. coli.
Microbiolres 16 00222 g004
Figure 5. Effects of hydroxamic acid (HA) supplementation on BW, feed intake (FI), and FCR of broiler chickens experimentally challenged with E. coli O157:H7 over a 28-day trial. Treatments included negative control (basal diet without infection), positive control (challenged with E. coli but without treatment), Std (challenged and treated with enrofloxacin at 5 mg/kg), and birds challenged with E. coli and fed basal diets supplemented with HA at 1, 10, or 100 mg/kg feed. Panels show BW gain at days 7–14, 15–21, 22–28, and 7–28; FI at days 7–14, 15–21, 22–28, and 7–28; and FCR at days 7–14, 15–21, 22–28, and 7–28. Data are presented as boxplots. Different superscript letters (a–e) indicate significant differences among treatments (p < 0.05).
Figure 5. Effects of hydroxamic acid (HA) supplementation on BW, feed intake (FI), and FCR of broiler chickens experimentally challenged with E. coli O157:H7 over a 28-day trial. Treatments included negative control (basal diet without infection), positive control (challenged with E. coli but without treatment), Std (challenged and treated with enrofloxacin at 5 mg/kg), and birds challenged with E. coli and fed basal diets supplemented with HA at 1, 10, or 100 mg/kg feed. Panels show BW gain at days 7–14, 15–21, 22–28, and 7–28; FI at days 7–14, 15–21, 22–28, and 7–28; and FCR at days 7–14, 15–21, 22–28, and 7–28. Data are presented as boxplots. Different superscript letters (a–e) indicate significant differences among treatments (p < 0.05).
Microbiolres 16 00222 g005
Figure 6. Effect of HA on the carcass yield, oxidative stress, and hematological parameters. (A) Carcass yield (%) across treatments: negative control (basal diet without infection), standard antibiotic control (infected and treated with enrofloxacin at 5 mg/kg), birds challenged with E. coli and fed basal diets supplemented with HA at 1, 10, or 100 mg/kg feed, and positive control (infected without treatment). (B) Hematological and oxidative stress parameters measured by day 28: Hb concentration, PCV, MDA, heterophil, lymphocyte, monocyte, eosinophil, and basophil percentages. Data is presented as boxplots. Different superscript letters above boxes indicate significant differences among treatments (p < 0.05).
Figure 6. Effect of HA on the carcass yield, oxidative stress, and hematological parameters. (A) Carcass yield (%) across treatments: negative control (basal diet without infection), standard antibiotic control (infected and treated with enrofloxacin at 5 mg/kg), birds challenged with E. coli and fed basal diets supplemented with HA at 1, 10, or 100 mg/kg feed, and positive control (infected without treatment). (B) Hematological and oxidative stress parameters measured by day 28: Hb concentration, PCV, MDA, heterophil, lymphocyte, monocyte, eosinophil, and basophil percentages. Data is presented as boxplots. Different superscript letters above boxes indicate significant differences among treatments (p < 0.05).
Microbiolres 16 00222 g006
Table 1. Specific primers used for the confirmation of E. coli O157:H7 strain.
Table 1. Specific primers used for the confirmation of E. coli O157:H7 strain.
GenePrimers Sequence (5′-3′) Amplicon Size (bp)
O157F: CGGACATCCATGTGATATGG259
R: TTGCCTATGTACAGCTAATCC
H7F: GCGCTGTCGAGTTCTATCGAGC625
R: CAACGGTGACTTTATCGCCATTCC
Table 2. Chemical composition of the feed.
Table 2. Chemical composition of the feed.
Ingredients Composition (%)Starter (0–14 day)Grower (15–28 day)
Corn54.9058.89
Soybean meal (44%)37.4032.90
DL-methionine0.450.45
Dicalcium phosphate1.791.79
Limestone1.271.27
L-lysine0.400.21
Salt0.340.34
Threonine0.150.15
Vegetable oil2.303.0
Vitamin–premix0.500.50
mineral premix0.500.50
Total100100
Calculated analysis
Dry Matter88.5389.30
Metabolizable energy Kcal/kg29783076
Crude protein21.4120.10
Crude fat11.6311.75
Crude fiber2.942.94
Calcium0.950.92
Phosphorus available0.450.43
Methionine0.650.60
Cysteine0.300.29
Lysine1.261.19
Leucine1.701.63
Table 3. Hydroxamic acid concentration was determined in seedling roots (μg/g roots) of local varieties of maize.
Table 3. Hydroxamic acid concentration was determined in seedling roots (μg/g roots) of local varieties of maize.
S. No.Maize VarietyHA Concentration (µg/g Roots)
01Azam35 ± 7
02Pak of goi20 ± 5
03Sweet corn12 ± 5
04Kaptan23 ± 4
05Jalal15 ± 5
06Iqbal8 ± 5
07Malhan14 ± 4
08Edhi5 ± 2
09Saad10 ± 7
10Pahari11 ± 5
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ullah, Q.; Ahmad, S.; Khan, S.; Ahmad, I.; Khan, S.; Khan, R.; Khan, F.A. Hydroxamic Acid Isolated from Maize Roots Exhibits Potent Antimicrobial Activity Against Pathogenic Escherichia coli in Broiler Chickens. Microbiol. Res. 2025, 16, 222. https://doi.org/10.3390/microbiolres16100222

AMA Style

Ullah Q, Ahmad S, Khan S, Ahmad I, Khan S, Khan R, Khan FA. Hydroxamic Acid Isolated from Maize Roots Exhibits Potent Antimicrobial Activity Against Pathogenic Escherichia coli in Broiler Chickens. Microbiology Research. 2025; 16(10):222. https://doi.org/10.3390/microbiolres16100222

Chicago/Turabian Style

Ullah, Qudrat, Shakoor Ahmad, Sarzamin Khan, Ijaz Ahmad, Samiullah Khan, Rajwali Khan, and Farhan Anwar Khan. 2025. "Hydroxamic Acid Isolated from Maize Roots Exhibits Potent Antimicrobial Activity Against Pathogenic Escherichia coli in Broiler Chickens" Microbiology Research 16, no. 10: 222. https://doi.org/10.3390/microbiolres16100222

APA Style

Ullah, Q., Ahmad, S., Khan, S., Ahmad, I., Khan, S., Khan, R., & Khan, F. A. (2025). Hydroxamic Acid Isolated from Maize Roots Exhibits Potent Antimicrobial Activity Against Pathogenic Escherichia coli in Broiler Chickens. Microbiology Research, 16(10), 222. https://doi.org/10.3390/microbiolres16100222

Article Metrics

Back to TopTop