Transcriptomic Analyses of Grapevine Leafroll-Associated Virus 3 Infection in Leaves and Berries of ‘Cabernet Franc’
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Grapevine Leaf and Berry Samples
2.2. RNA Extraction and Quality Test
2.3. RNA-Seq Data Analysis
2.4. Identification of Viruses Based on RNA-Seq Data
2.5. Quantification of Expression of Select Genes of Interest by RT-qPCR
3. Results
3.1. Selection of Samples and Viral Screening
3.2. Symptom Development in GLRaV-3-Infected Cabernet Franc
3.3. Pilot Study in Identification of DEGs Based on RNA-Seq and Transcriptomic Analyses
3.4. RNA-Seq Data Analysis
3.5. DEGs Associated with Photosynthesis, Carbohydrate Metabolism, and Sugar Transport
3.6. DEGs Associated with Biosynthesis of Secondary Metabolites
3.7. DEGs Involved in Mitochondrial Activities
3.8. DEGs Associated with Defense Responses: PR Proteins, R Genes, and RNA Silencing
3.9. DEGs Associated with Stress Response, Senescence and Hormonal Signaling
3.10. RT-qPCR Validation of Selected DEGs of Interest
3.11. DEGs Involved in Photosynthesis, Energy Production, and Sugar Transport
3.12. DEGs Involved in the Biosynthesis of Major Flavonoids
3.13. DEGs Involved in Defense against Pathogens
3.14. DEGs Involved in Mitochondrial Activities
4. Discussion
4.1. GLRaV-3 Infection Alters Expression of Genes Involved in Source–Sink Relationship, Sugar Transport, and Carbohydrate Metabolism
4.2. Impairment of Sugar Export from Source Leaves
4.3. Increased Expression of Genes in Photosynthesis and Related Activities in Berries as a Compensatory Mechanism in Response to Shortage in Sugar Supply
4.4. GLRaV-3 Infection Affects Expression of Genes Involved in Polyphenolic Biosynthesis Due to Altered Source–Sink Relationship
4.5. GLRaV-3 Infection Induces the Expression of Genes Involved in Pathogen-Targeted Defense
4.6. A Working Model on GLRaV-3 and Grapevine Interaction
5. Conclusions and Future Research
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- OIV. State of the World Vitivinicultural Sector in 2020; OIV: Paris, France, 2021. [Google Scholar]
- OIV. 2019 Statistical Report on World Vitiviniculture; OIV: Paris, France, 2019. [Google Scholar]
- Martelli, G.P. An Overview on Grapevine Viruses, Viroids, and the Diseases They Cause. In Grapevine Viruses: Molecular Biology, Diagnostics and Management; Meng, B., Martelli, G.P., Golino, D.A., Fuchs, M., Eds.; Springer International Publishing AG: Cham, Switzerland, 2017; pp. 31–46. [Google Scholar]
- Fuchs, M. Grapevine viruses: A multitude of diverse species with simple but overall poorly adopted management solutions in the vineyard. J. Plant Pathol. 2020, 102, 643–653. [Google Scholar] [CrossRef]
- Almeida, R.P.P.; Daane, K.M.; Bell, V.A.; Blaisdell, G.K.; Cooper, M.L.; Herrbach, E.; Pietersen, G. Ecology and management of grapevine leafroll disease. Front. Microbiol. 2013, 4, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Naidu, R.; Rowhani, A.; Fuchs, M.; Golino, D.; Martelli, G.P. Grapevine leafroll: A complex viral disease affecting a high-value fruit crop. Plant Dis. 2014, 98, 1172–1185. [Google Scholar] [CrossRef] [PubMed]
- Atallah, S.S.; Gomez, M.I.; Fuchs, M.F.; Martinson, T.E. Economic impact of grapevine leafroll disease on Vitis vinifera cv. Cabernet franc in finger lakes vineyards of New York. Am. J. Enol. Vitic. 2012, 63, 73–79. [Google Scholar] [CrossRef]
- Naidu, R.; O’Neal, S.; Walsh, D. Grapevine Leafroll Disease; WSU Press: Pullman, WA, USA, 2008. [Google Scholar]
- Martelli, G.P. Directory of virus and virus-like diseases of the grapevine and their agents. J. Plant Pathol. 2014, 96, 1–136. [Google Scholar] [CrossRef]
- Ricketts, K.D.; Gomez, M.I.; Atallah, S.S.; Fuchs, M.F.; Martinson, T.E.; Battany, M.C.; Bettiga, L.J.; Cooper, M.L.; Verdegaal, P.S.; Smith, R.J. Reducing the economic impact of grapevine leafroll disease in california: Identifying optimal disease management strategies. Am. J. Enol. Vitic. 2015, 66, 138–149. [Google Scholar] [CrossRef]
- Burger, J.T.; Maree, H.J.; Gouveia, P.; Naidu, R.A. Grapevine leafroll-associated virus 3. In Grapevine Viruses: Molecular Biology, Diagnostics and Management; Springer International Publishing: Cham, Switzerland, 2017; pp. 167–195. [Google Scholar]
- Maree, H.J.; Almeida, R.P.P.; Bester, R.; Chooi, K.M.; Cohen, D.; Dolja, V.V.; Fuchs, M.F.; Golino, D.A.; Jooste, A.E.C.; Martelli, G.P.; et al. Grapevine leafroll-associated virus 3. Front. Microbiol. 2013, 4, 82. [Google Scholar] [CrossRef]
- Song, Y.; Hanner, R.H.; Meng, B. Probing into the effects of grapevine leafroll-associated viruses on the physiology, fruit quality and gene expression of grapes. Viruses 2021, 13, 593. [Google Scholar] [CrossRef]
- Guidoni, S.; Mannini, F.; Ferrandino, A.; Argamante, N.; Di Stefano, R. Efffect of Virus Status on Leaf and Berry Phenolic Compounds in Two Wine Grapevine Vitis vinifera Cultivars. Acta Hortic. 2000, 526, 445–452. [Google Scholar] [CrossRef]
- Kovacs, L.G.; Hanami, H.; Fortenberry, M.; Kaps, M.L. Latent Infection by Leafroll Agent GLRaV-3 Is Linked to Lower Fruit Quality in French-American Hybrid Grapevines Vidal blanc and St. Vincent. Am. J. Enol. Vitic. 2001, 52, 254–259. [Google Scholar] [CrossRef]
- Endeshaw, S.T.; Sabbatini, P.; Romanazzi, G.; Schilder, A.C.; Neri, D. Effects of grapevine leafroll associated virus 3 infection on growth, leaf gas exchange, yield and basic fruit chemistry of Vitis vinifera L. cv. Cabernet Franc. Sci. Hortic. 2014, 170, 228–236. [Google Scholar] [CrossRef]
- Singh Brar, H.; Singh, Z.; Swinny, E.; Cameron, I. Girdling and grapevine leafroll associated viruses affect berry weight, colour development and accumulation of anthocyanins in ‘Crimson Seedless’ grapes during maturation and ripening. Plant Sci. 2008, 175, 885–897. [Google Scholar] [CrossRef]
- Lee, J.; Martin, R.R. Influence of grapevine leafroll associated viruses (GLRaV-2 and -3) on the fruit composition of Oregon Vitis vinifera L. cv. Pinot noir: Phenolics. Food Chem. 2009, 112, 889–896. [Google Scholar] [CrossRef]
- Cabaleiro, C.; Segura, A.; Garcia-Berrios, J.J. Effects of grapevine leafroll-associated virus 3 on the physiology and must of Vitis vinifera L. cv. Albariño following contamination in the field. Am. J. Enol. Vitic. 1999, 50, 40–44. [Google Scholar]
- Mannini, F.; Mollo, A.; Credi, R. Field Performance and Wine Quality Modification in a Clone of Vitis vinifera cv. Dolcetto after GLRaV-3 Elimination. Am. J. Enol. Vitic. 2012, 63, 144–147. [Google Scholar] [CrossRef]
- Alabi, O.J.; Casassa, L.F.; Gutha, L.R.; Larsen, R.C.; Henick-Kling, T.; Harbertson, J.F.; Naidu, R.A. Impacts of grapevine leafroll disease on fruit yield and grape and wine chemistry in a wine grape (Vitis vinifera L.) cultivar. PLoS ONE 2016, 11, e0149666. [Google Scholar] [CrossRef]
- Gutha, L.R.; Casassa, L.F.; Harbertson, J.F.; Naidu, R.A. Modulation of flavonoid biosynthetic pathway genes and anthocyanins due to virus infection in grapevine (Vitis vinifera L.) leaves. BMC Plant Biol. 2010, 10, 187. [Google Scholar] [CrossRef] [PubMed]
- Landi, M.; Tattini, M.; Gould, K.S. Multiple functional roles of anthocyanins in plant-environment interactions. Environ. Exp. Bot. 2015, 119, 4–17. [Google Scholar] [CrossRef]
- Espinoza, C.; Vega, A.; Medina, C.; Schlauch, K.; Cramer, G.; Arce-Johnson, P. Gene expression associated with compatible viral diseases in grapevine cultivars. Funct. Integr. Genom. 2007, 7, 95–110. [Google Scholar] [CrossRef] [PubMed]
- Espinoza, C.; Medina, C.; Somerville, S.; Arce-Johnson, P. Senescence-associated genes induced during compatible viral interactions with grapevine and Arabidopsis. J. Exp. Bot. 2007, 58, 3197–3212. [Google Scholar] [CrossRef]
- Vega, A.; Gutiérrez, R.A.; Peña-Neira, A.; Cramer, G.R.; Arce-Johnson, P. Compatible GLRaV-3 viral infections affect berry ripening decreasing sugar accumulation and anthocyanin biosynthesis in Vitis vinifera. Plant Mol. Biol. 2011, 77, 261–274. [Google Scholar] [CrossRef] [PubMed]
- Blanco-Ulate, B.; Hopfer, H.; Figueroa-Balderas, R.; Ye, Z.; Rivero, R.M.; Albacete, A.; Pérez-Alfocea, F.; Koyama, R.; Anderson, M.M.; Smith, R.J.; et al. Red blotch disease alters grape berry development and metabolism by interfering with the transcriptional and hormonal regulation of ripening. J. Exp. Bot. 2017, 68, 1225–1238. [Google Scholar] [CrossRef] [PubMed]
- Ghaffari, S.; Reynard, J.S.; Rienth, M. Single berry reconstitution prior to RNA-sequencing reveals novel insights into transcriptomic remodeling by leafroll virus infections in grapevines. Sci. Rep. 2020, 10, 12905. [Google Scholar] [CrossRef] [PubMed]
- Prator, C.A.; Chooi, K.M.; Jones, D.; Davy, M.W.; MacDiarmid, R.M.; Almeida, R.P.P. Comparison of two different host plant genera responding to grapevine leafroll-associated virus 3 infection. Sci. Rep. 2020, 10, 8505. [Google Scholar] [CrossRef]
- Carmona, M.J.; Chaib, J.; Martinez-Zapater, J.M.; Thomas, M.R. A molecular genetic perspective of reproductive development in grapevine. J. Exp. Bot. 2008, 59, 2579–2596. [Google Scholar] [CrossRef] [PubMed]
- Xiao, H.; Shabanian, M.; Moore, C.; Li, C.; Meng, B. Survey for major viruses in commercial Vitis vinifera wine grapes in Ontario. Virol. J. 2018, 15, 127. [Google Scholar] [CrossRef] [PubMed]
- Coombe, B.G. Adoption of a system for identifying grapevine growth stages. Aust. J. Grape Wine Res. 1995, 1, 100–110. [Google Scholar] [CrossRef]
- Dry, P.; Coombe, B.G. Viticulture Volume 1-Resources, 2nd ed.; Dry, P., Ed.; Winetitles: Unley, Australia, 2004; ISBN 9781875130009. [Google Scholar]
- Bertamini, M.; Nedunchezhian, N. Leaf age effects on chlorophyll, Rubisco, photosynthetic electron transport activities and thylakoid membrane protein in field grown grapevine leaves. J. Plant Physiol. 2002, 159, 799–803. [Google Scholar] [CrossRef]
- Song, Y.; Hanner, R.H.; Meng, B. Genome-wide screening of novel RT-qPCR reference genes for study of GLRaV-3 infection in wine grapes and refinement of an RNA isolation protocol for grape berries. Plant Methods 2021, 17, 110. [Google Scholar] [CrossRef]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene Ontology: Tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef]
- Carbon, S.; Douglass, E.; Good, B.M.; Unni, D.R.; Harris, N.L.; Mungall, C.J.; Basu, S.; Chisholm, R.L.; Dodson, R.J.; Hartline, E.; et al. The Gene Ontology resource: Enriching a GOld mine. Nucleic Acids Res. 2021, 49, D325–D334. [Google Scholar] [CrossRef]
- Howe, K.L.; Achuthan, P.; Allen, J.; Allen, J.; Alvarez-Jarreta, J.; Amode, M.R.; Armean, I.M.; Azov, A.G.; Bennett, R.; Bhai, J.; et al. Ensembl 2021. Nucleic Acids Res. 2021, 49, D884–D891. [Google Scholar] [CrossRef]
- Boyes, I.; Rott, M. Virtool 2018. Available online: https://www.virtool.ca/ (accessed on 27 July 2021).
- Jaillon, O.; Aury, J.M.; Noel, B.; Policriti, A.; Clepet, C.; Casagrande, A.; Choisne, N.; Aubourg, S.; Vitulo, N.; Jubin, C.; et al. The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla. Nature 2007, 449, 463–467. [Google Scholar] [CrossRef] [PubMed]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Zee, F.; Gonsalves, D.; Goheen, A.; Kim, K.S.; Pool, R.; Lee, R.F. Cytopathology of leafroll-diseased grapevines and the purification and serology of associated closteroviruslike particles. Phytopathology 1987, 77, 1427–1434. [Google Scholar] [CrossRef]
- Kim, K.S.; Gonsalves, D.; Teliz, D.; Lee, K.W. Ultrastructure and mitochondrial vesiculation associated with closteroviruslike particles in leafroll-diseased grapevines. Phytopathology 1989, 79, 357–360. [Google Scholar] [CrossRef]
- Faoro, F. Cytopathology of closteroviruses and trichoviruses infecting grapevines. In Filamentous Viruses of Woody Plants; Research Signpost: Trivandrum, India, 1997; pp. 29–47. ISBN 8186481133. [Google Scholar]
- McHale, L.; Tan, X.; Koehl, P.; Michelmore, R.W. Plant NBS-LRR proteins: Adaptable guards. Genome Biol. 2006, 7, 212. [Google Scholar] [CrossRef]
- Maimbo, M.; Ohnishi, K.; Hikichi, Y.; Yoshioka, H.; Kiba, A. Induction of a Small Heat Shock Protein and Its Functional Roles in Nicotiana Plants in the Defense Response against Ralstonia solanacearum. Plant Physiol. 2007, 145, 1588–1599. [Google Scholar] [CrossRef]
- Haq, S.U.; Khan, A.; Ali, M.; Khattak, A.M.; Gai, W.-X.; Zhang, H.-X.; Wei, A.-M.; Gong, Z.-H. Heat Shock Proteins: Dynamic Biomolecules to Counter Plant Biotic and Abiotic Stresses. Int. J. Mol. Sci. 2019, 20, 5321. [Google Scholar] [CrossRef]
- Thirugnanasambantham, K.; Durairaj, S.; Saravanan, S.; Karikalan, K.; Muralidaran, S.; Islam, V.I.H. Role of ethylene response transcription factor (ERF) and its regulation in response to stress encountered by plants. Plant Mol. Biol. Report. 2015, 33, 347–357. [Google Scholar] [CrossRef]
- Jiang, J.; Ma, S.; Ye, N.; Jiang, M.; Cao, J.; Zhang, J. WRKY transcription factors in plant responses to stresses. J. Integr. Plant Biol. 2017, 59, 86–101. [Google Scholar] [CrossRef]
- Everaert, C.; Luypaert, M.; Maag, J.L.V.; Cheng, Q.X.; Dinger, M.E.; Hellemans, J.; Mestdagh, P. Benchmarking of RNA-sequencing analysis workflows using whole-transcriptome RT-qPCR expression data. Sci. Rep. 2017, 7, 1559. [Google Scholar] [CrossRef] [PubMed]
- Minagawa, J.; Takahashi, Y. Structure, function and assembly of Photosystem II and its light-harvesting proteins. Photosynth. Res. 2004, 82, 241–263. [Google Scholar] [CrossRef] [PubMed]
- Mattivi, F.; Guzzon, R.; Vrhovsek, U.; Stefanini, M.; Velasco, R. Metabolite profiling of grape: Flavonols and anthocyanins. J. Agric. Food Chem. 2006, 54, 7692–7702. [Google Scholar] [CrossRef] [PubMed]
- Czemmel, S.; Heppel, S.C.; Bogs, J. R2R3 MYB transcription factors: Key regulators of the flavonoid biosynthetic pathway in grapevine. Protoplasma 2012, 249, 109–118. [Google Scholar] [CrossRef] [PubMed]
- Ashihara, H.; Deng, W.-W.; Mullen, W.; Crozier, A. Distribution and biosynthesis of flavan-3-ols in Camellia sinensis seedlings and expression of genes encoding biosynthetic enzymes. Phytochemistry 2010, 71, 559–566. [Google Scholar] [CrossRef] [PubMed]
- Martelli, G.P.; Ghanem-sabanadzovic, N.A.; Agranovsky, A.A.; Al Rwahnih, M.; Dolja, V.V.; Dovas, C.I. Taxonomic revision of the family Closteroviridae with special reference to the Grapevine leafroll-associated members of the Genus Ampelovirus and the putative species unassigned to the family. J. Plant Pathol. 2012, 94, 7–19. [Google Scholar] [CrossRef]
- Mannini, F.; Digiaro, M. The Effect of Viruses and Viral Diseases on Grapes and Wine. In Grapevine Viruses: Molecular Biology, Diagnostics and Management; Meng, B., Martelli, G.P., Golino, D., Fuchs, M., Eds.; Springer International Publishing AG: Cham, Switzerland, 2017; pp. 453–482. [Google Scholar]
- Montero, R.; Mundy, D.; Albright, A.; Grose, C.; Trought, M.C.T.; Cohen, D.; Chooi, K.M.; MacDiarmid, R.; Flexas, J.; Bota, J. Effects of Grapevine Leafroll associated Virus 3 (GLRaV-3) and duration of infection on fruit composition and wine chemical profile of Vitis vinifera L. cv. Sauvignon blanc. Food Chem. 2016, 197, 1177–1183. [Google Scholar] [CrossRef]
- Christov, I.; Stefanov, D.; Velinov, T.; Goltsev, V.; Georgieva, K.; Abracheva, P.; Genova, Y.; Christov, N. The symptomless leaf infection with grapevine leafroll associated virus 3 in grown in vitro plants as a simple model system for investigation of viral effects on photosynthesis. J. Plant Physiol. 2007, 164, 1124–1133. [Google Scholar] [CrossRef] [PubMed]
- Bertamini, M.; Muthuchelian, K.; Nedunchezhian, N. Effect of grapevine leafroll on the photosynthesis of field grown grapevine plants (Vitis vinifera L. cv. Lagrein). J. Phytopathol. 2004, 152, 145–152. [Google Scholar] [CrossRef]
- Moutinho-Pereira, J.; Correia, C.M.; Gonçalves, B.; Bacelar, E.A.; Coutinho, J.F.; Ferreira, H.F.; Lousada, J.L.; Cortez, M.I. Impacts of leafroll-associated viruses (GLRaV-1 and -3) on the physiology of the Portuguese grapevine cultivar ‘Touriga Nacional’ growing under field conditions. Ann. Appl. Biol. 2012, 160, 237–249. [Google Scholar] [CrossRef]
- El Aou-ouad, H.; Montero, R.; Medrano, H.; Bota, J. Interactive effects of grapevine leafroll-associated virus 3 (GLRaV-3) and water stress on the physiology of Vitis vinifera L. cv. Malvasia de Banyalbufar and Giro-Ros. J. Plant Physiol. 2016, 196–197, 106–115. [Google Scholar] [CrossRef] [PubMed]
- Montero, R.; El aou ouad, H.; Pacifico, D.; Marzachì, C.; Castillo, N.; García, E.; Del Saz, N.F.; Florez-Sarasa, I.; Flexas, J.; Bota, J. Effects of grapevine leafroll-associated virus 3 on the physiology in asymptomatic plants of Vitis vinifera. Ann. Appl. Biol. 2017, 171, 155–171. [Google Scholar] [CrossRef]
- Halldorson, M.M.; Keller, M. Grapevine leafroll disease alters leaf physiology but has little effect on plant cold hardiness. Planta 2018, 248, 1201–1211. [Google Scholar] [CrossRef] [PubMed]
- Kozieł, E.; Otulak-Kozieł, K.; Bujarski, J.J. Plant cell wall as a key player during resistant and susceptible plant-virus interactions. Front. Microbiol. 2021, 12, 656809. [Google Scholar] [CrossRef]
- Senthil-Kumar, M.; Mysore, K.S. Nonhost resistance against bacterial pathogens: Retrospectives and prospects. Annu. Rev. Phytopathol. 2013, 51, 407–427. [Google Scholar] [CrossRef]
- Bellincampi, D.; Cervone, F.; Lionetti, V. Plant cell wall dynamics and wall-related susceptibility in plant-pathogen interactions. Front. Plant Sci. 2014, 5, 228. [Google Scholar] [CrossRef]
- Tenhaken, R. Cell wall remodeling under abiotic stress. Front. Plant Sci. 2015, 5, 771. [Google Scholar] [CrossRef]
- Hackel, A.; Schauer, N.; Carrari, F.; Fernie, A.R.; Grimm, B.; Kühn, C. Sucrose transporter LeSUT1 and LeSUT2 inhibition affects tomato fruit development in different ways. Plant J. 2006, 45, 180–192. [Google Scholar] [CrossRef]
- Afoufa-Bastien, D.; Medici, A.; Jeauffre, J.; Coutos-Thévenot, P.; Lemoine, R.; Atanassova, R.; Laloi, M. The Vitis vinifera sugar transporter gene family: Phylogenetic overview and macroarray expression profiling. BMC Plant Biol. 2010, 10, 245. [Google Scholar] [CrossRef]
- Stadler, R.; Sauer, N. The Arabidopsis thaliana AtSUC2 gene is specifically expressed in companion cells. Bot. Acta 1996, 109, 299–306. [Google Scholar] [CrossRef]
- Truernit, E.; Sauer, N. The promoter of the Arabidopsis thaliana SUC2 sucrose-H+ symporter gene directs expression of β-glucuronidase to the phloem: Evidence for phloem loading and unloading by SUC2. Planta 1995, 196, 564–570. [Google Scholar] [CrossRef]
- Hayes, M.A.; Feechan, A.; Dry, I.B. Involvement of abscisic acid in the coordinated regulation of a stress-Inducible hexose transporter (VvHT5) and a cell wall invertase in grapevine in response to biotrophic fungal infection. Plant Physiol. 2010, 153, 211–221. [Google Scholar] [CrossRef]
- Hayes, M.A.; Davies, C.; Dry, I.B. Isolation, functional characterization, and expression analysis of grapevine (Vitis vinifera L.) hexose transporters: Differential roles in sink and source tissues*. J. Exp. Bot. 2007, 58, 1985–1997. [Google Scholar] [CrossRef] [PubMed]
- Büttner, M. The Arabidopsis sugar transporter (AtSTP) family: An update. Plant Biol. 2010, 12, 35–41. [Google Scholar] [CrossRef]
- Zhang, X.-Y.; Wang, X.-L.; Wang, X.-F.; Xia, G.-H.; Pan, Q.-H.; Fan, R.-C.; Wu, F.-Q.; Yu, X.-C.; Zhang, D.-P. A shift of phloem unloading from symplasmic to apoplasmic pathway Is involved in developmental onset of ripening in grape berry. Plant Physiol. 2006, 142, 220–232. [Google Scholar] [CrossRef]
- Das, P.K.; Shin, D.H.; Choi, S.-B.; Park, Y.-I. Sugar-hormone cross-talk in anthocyanin biosynthesis. Mol. Cells 2012, 34, 501–507. [Google Scholar] [CrossRef] [PubMed]
- Durán-Soria, S.; Pott, D.M.; Osorio, S.; Vallarino, J.G. Sugar signaling during fruit ripening. Front. Plant Sci. 2020, 11, 564917. [Google Scholar] [CrossRef] [PubMed]
- Dixon, R.A.; Xie, D.; Sharma, S.B. Proanthocyanidins–a final frontier in flavonoid research? New Phytol. 2005, 165, 9–28. [Google Scholar] [CrossRef]
- Smith, G.J.; Markham, K.R. Tautomerism of flavonol glucosides: Relevance to plant UV protection and flower colour. J. Photochem. Photobiol. A Chem. 1998, 118, 99–105. [Google Scholar] [CrossRef]
- Martin, G.B.; Bogdanove, A.J.; Sessa, G. Understanding the functions of plant disease resistance proteins. Annu. Rev. Plant Biol. 2003, 54, 23–61. [Google Scholar] [CrossRef]
- Chiang, Y.-H.; Coaker, G. Effector triggered immunity: NLR immune perception and downstream defense responses. Arab. B. 2015, 13, e0183. [Google Scholar] [CrossRef][Green Version]
- Jones, J.D.G.; Dangl, J.L. The plant immune system. Nature 2006, 444, 323–329. [Google Scholar] [CrossRef]
- Cui, H.; Tsuda, K.; Parker, J.E. Effector-triggered immunity:fFrom pathogen perception to robust defense. Annu. Rev. Plant Biol. 2015, 66, 487–511. [Google Scholar] [CrossRef]
- Brosseau, C.; El Oirdi, M.; Adurogbangba, A.; Ma, X.; Moffett, P. Antiviral defense involves AGO4 in an Arabidopsis –Potexvirus interaction. Mol. Plant-Microbe Interact. 2016, 29, 878–888. [Google Scholar] [CrossRef] [PubMed]
- Chisholm, S.T.; Coaker, G.; Day, B.; Staskawicz, B.J. Host-Microbe Interactions: Shaping the Evolution of the Plant Immune Response. Cell 2006, 124, 803–814. [Google Scholar] [CrossRef]
- Toruño, T.Y.; Stergiopoulos, I.; Coaker, G. Plant-pathogen effectors: Cellular probes interfering with plant defenses in spatial and temporal manners. Annu. Rev. Phytopathol. 2016, 54, 419–441. [Google Scholar] [CrossRef] [PubMed]
- Ding, S.-W. RNA-based antiviral immunity. Nat. Rev. Immunol. 2010, 10, 632–644. [Google Scholar] [CrossRef] [PubMed]
- Gouveia, P.; Nolasco, G. The p19.7 RNA silencing suppressor from Grapevine leafroll-associated virus 3 shows different levels of activity across phylogenetic groups. Virus Genes 2012, 45, 333–339. [Google Scholar] [CrossRef]
- Krapp, A.; Quick, W.P.; Stitt, M. Ribulose-1,5-bisphosphate carboxylase-oxygenase, other Calvin-cycle enzymes, and chlorophyll decrease when glucose is supplied to mature spinach leaves via the transpiration stream. Planta 1991, 186, 58–69. [Google Scholar] [CrossRef] [PubMed]
Genes | EnsemblPlant Gene ID | NCBI Accession No. | NCBI Gene Description | Primer Sequence (5′-3′) | Amplicon Size (bp) | Amplification Efficiency (E%) |
---|---|---|---|---|---|---|
VvCYSP | VIT_03s0038g00280 | NM_001281060.1 | Cysteine protease | F:AAAATCAGGGTTCGTGTGGGTC | 190 | 96.791 |
R:GCAGTGTTCATCAGCCCACC | ||||||
VvUFGT | VIT_12s0034g00130 | XM_010659535.2 | Anthocyanidin 3-O-glucosyltransferase 2 | F:TCTTCCCTTCTGTGGTGCTTG | 187 | 99.108 |
R:TTATTGAGCAGGGGTCCAACAG | ||||||
VvLAR1 | VIT_01s0011g02960 | NM_001280958.1 | Leucoanthocyanidin reductase 1 | F:AACAGTGGACGATGTCCGAAC | 178 | 86.137 |
R:CTGTGGGATGATGTTTTCTCCG | ||||||
VvFLS | VIT_18s0001g03430 | XM_002285805.3 | Flavonol synthase/flavanone 3-hydroxylase | F:ATGCCCTCTTTGTCCATGTC | 190 | 95.203 |
R:TACTTGGCAGGGTTTGGTTC | ||||||
VvSUT2 | VIT_18s0076g00220 | XM_002266086.3 | Putative sucrose transporter | F:TGACTGGATGGGGAAAGAAG | 190 | 97.956 |
R:GTTCCCAATACCCCATACCCG | ||||||
VvHT5 | VIT_05s0020g03140 | NM_001281278.1 | Hexose transporter | F:AGCATGAGGAGCTGGAGAGC | 198 | 95.96 |
R:CTTGGGCAGCGGTATTAAGC | ||||||
VvGBSS1 | VIT_02s0025g02790 | XM_010661955.2 | Granule-bound starch synthase 1, chloroplastic/amyloplastic | F:CCTGGTTCCTTGAGAAGGTATGG | 132 | 93.008 |
R:GAATCCGTGGTGCCTCCAGAA | ||||||
VvSUS | VIT_11s0016g00470 | XM_002275119.3 | Sucrose synthase | F:AACTCACCTCTTCTCTAGGTTGTC | 200 | 92.651 |
R:GCTAGAAGCTGATGGGGCTG | ||||||
VvPSBP1 | VIT_12s0028g01080 | XM_002283012.4 | Probable oxygen-evolving enhancer protein 2 | F:CCAACAGCAATGTCTCCGTC | 147 | 93.812 |
R:CGTCGAAACCACCCTCATTG | ||||||
VvPR10.7 | VIT_05s0077g01670 | XM_002273754.4 | Pathogenesis-related protein 10.7 | F:ACCCGGTGTGGAGATCAAAG | 180 | 92.665 |
R:AGGCAGCAAGCAACAAGTGA | ||||||
VvPR10.3 | VIT_05s0077g01550 | NM_001281027.1 | Pathogenesis-related protein 10.3 | F:TGGAGATGTTTTGACGAGCGG | 162 | 94.264 |
R:AGAGACTCCTCTTTGCCGCC | ||||||
VvETFB | VIT_05s0049g00470 | XM_002284716.3 | Electron transfer flavoprotein subunit beta, mitochondrial | F:GTCTGGCGTCGGAGGTTATC | 165 | 84.097 |
R:CCACATCGACGAGAGCTTTG | ||||||
VvTIM13 | VIT_02s0025g02990 | XM_002277879.3 | Mitochondrial import inner membrane translocase subunit Tim13 | F:CAAGACTCAGCTTGCCCAGG | 201 | 92.015 |
R:GCTCAGTTTCAGCGTGGTGC | ||||||
VvNDUFA1 | VIT_11s0103g00270 | XM_002269070.4 | NADH dehydrogenase (ubiquinone) 1 alpha subcomplex subunit 1 | F:GCCCGAAGCACGTAGGTAAC | 144 | 91.227 |
R:CTTCACACCCAGAAGCACCAAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Song, Y.; Hanner, R.H.; Meng, B. Transcriptomic Analyses of Grapevine Leafroll-Associated Virus 3 Infection in Leaves and Berries of ‘Cabernet Franc’. Viruses 2022, 14, 1831. https://doi.org/10.3390/v14081831
Song Y, Hanner RH, Meng B. Transcriptomic Analyses of Grapevine Leafroll-Associated Virus 3 Infection in Leaves and Berries of ‘Cabernet Franc’. Viruses. 2022; 14(8):1831. https://doi.org/10.3390/v14081831
Chicago/Turabian StyleSong, Yashu, Robert H. Hanner, and Baozhong Meng. 2022. "Transcriptomic Analyses of Grapevine Leafroll-Associated Virus 3 Infection in Leaves and Berries of ‘Cabernet Franc’" Viruses 14, no. 8: 1831. https://doi.org/10.3390/v14081831
APA StyleSong, Y., Hanner, R. H., & Meng, B. (2022). Transcriptomic Analyses of Grapevine Leafroll-Associated Virus 3 Infection in Leaves and Berries of ‘Cabernet Franc’. Viruses, 14(8), 1831. https://doi.org/10.3390/v14081831