Genetic Evaluation of Juniperus sabina L. (Cupressaceae) in Arid and Semi-Arid Regions of China Based on SSR Markers
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. DNA Extraction
2.3. Primer Source and PCR Amplification
2.4. Statistical Analyses
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Li, Y.Z.; Wen, G.S.; Li, C.H. Studies on variable types of Sabina vulgaris in Mao Us desert. J. Inn. Mong. For. Coll. 1998, 20, 10–15. [Google Scholar]
- Adams, R.P.; Schwarzbach, A.E.; Tashev, A.N. Chloroplast capture in Juniperus sabina var. balkanensis R. P. Adams and A. N. Tashev, from the Balkan peninsula: A new va-riety with a history of hybridization with J. thurifera. Phytologia 2016, 98, 100–111. [Google Scholar]
- Xu, R.X.; Fan, Z.Y.; Sayef, M. Chemical constituents of the seeds of Sabina vulgaris Antoine. Acta Bot. Sin. 1991, 33, 589–592. [Google Scholar]
- Sadeghi-Aliabadi, H.; Emami, A.; Saidi, M.; Sadeghi, B.; Jafarian, A. Evaluation of in vitro cytotoxic effects of Juniperus foetidissima and Juniperus sabina extracts against a panel of cancer cells. Iran. J. Pharm. Res. 2009, 8, 281–286. [Google Scholar]
- Ramírez-Valiente, J.A.; Etterson, J.R.; Deacon, N.J.; Cavender-Bares, J. Evolutionary potential varies across populations and traits in the neotropical oak Quercus oleoides. Tree Physiol. 2019, 39, 427–439. [Google Scholar] [CrossRef] [Scilit]
- Teixeira, H.; Rodríguez-Echeverría, S.; Nabais, C.; Labra, M. Genetic Diversity and Differentiation of Juniperus thurifera in Spain and Morocco as Determined by SSR. PLoS ONE 2014, 9, e88996. [Google Scholar]
- Man, K.H.; Hong, W.H. Genetic Diversity and Population Structure of Juniperus rigida (Cupressaceae) and Juniperus coreana. Evol. Ecol. 2000, 14, 87–98. [Google Scholar]
- Allphin, L.; Hunt, A.F.; Anderson, V.J. Genetic diversity and low reproductive success in isolated populations of Utah juniper (Juniperus osteosperma, Cupressaceae). West. N. Am. Nat. 2013, 67, 323–337. [Google Scholar] [CrossRef] [Scilit]
- Qian, Z.; Yang, Y.Z.; Wu, G.L.; Zhang, D.Y.; Liu, J.Q. Isolation and characterization of microsatellite DNA primers in Juniperus przewalskii Kom (Cupressaceae). Conserv. Genet. 2008, 9, 767–769. [Google Scholar]
- Reim, S.; Lochschmidt, F.; Proft, A.; Tröber, U.; Wolf, H. Genetic structure and diversity in Juniperus communis populations in Saxony, Germany. Biodivers. Res. Conserv. 2016, 42, 9–18. [Google Scholar] [CrossRef] [Scilit]
- Wen, J.; Stefanie, M.; Ickert-Bond. Evolution of the Madrean-Tethyan disjunctions and the North and South American amphitropical disjunctions in plants. J. Syst. Evol. 2009, 47, 331–348. [Google Scholar] [CrossRef] [Scilit]
- Rumeu, B.; Vargas, P.; Jaén-Molina, R.; Nogales, M.; Caujapé-Castells, J. Phylogeography and genetic structure of the threatened Canarian Juniperus cedrus (Cupressaceae). Bot. J. Linn. Soc. 2014, 175, 376–394. [Google Scholar] [CrossRef] [Scilit]
- Wesche, K.; Ronnenberg, K. Phytosociological affinities and habitat preferences of Juniperus sabina L. and Artemisia santolinifolia Turcz. ex Bess. in mountain sites of the south-eastern Gobi Altay, Mongolia. Feddes Repert. 2011, 115, 585–600. [Google Scholar] [CrossRef] [Scilit]
- Wen, G.S.; Wang, L.H.; Yoshikawa, K. Physiological and ecological characteristics of Sabina vulgaris in semi-arid region of China. J. Jpn. Soc. Reveg. Technol. 2001, 27, 526–533. [Google Scholar] [CrossRef] [Scilit]
- Arzac, A.; Garcia-Cervigon, A.I.; Vicente-Serrano, S.M.; Loidi, J.; Olano, J.M. Phenological shifts in climatic response of secondary growth allow Juniperus sabina L. to cope with altitudinal and temporal climate variability. Agric. For. Meteorol. 2016, 217, 148. [Google Scholar] [CrossRef] [Scilit]
- García-Cervigón, A.I.; Linares, J.C.; García-Hidalgo, M.; Camarero, J.J.; Olano, J.M. Growth delay by winter precipitation could hinder Juniperus sabina persistence under increasing summer drought. Dendrochronologia 2018, 51, 22–31. [Google Scholar] [CrossRef] [Scilit]
- He, W.M.; Zhang, X.S. Responses of an evergreen shrub Sabina vulgaris to soil water and nutrient shortages in the semi-arid Mu Us Sandland in China. J. Arid Environ. 2003, 53, 307–316. [Google Scholar] [CrossRef] [Scilit]
- Wesche, K.; Ronnenberg, K.; Hensen, I. Lack of sexual reproduction within mountain steppe populations of the clonal shrub Juniperus sabina L. in semi-arid southern Mongolia. J. Arid Environ. 2005, 63, 390–405. [Google Scholar] [CrossRef] [Scilit]
- Tanaka-Oda, A.; Kenzo, T.; Fukuda, K. Optimal germination condition by sulfuric acid pretreatment to improve seed germination of Sabina vulgaris Ant. J. For. Res. 2009, 14, 251–256. [Google Scholar] [CrossRef] [Scilit]
- Guo, Y.P.; Zhang, R.; Chen, C.Y.; Zhou, D.W.; Liu, J.Q. Allopatric divergence and regional range expansion of Juniperus sabina in China. J. Syst. Evol. 2010, 48, 153–160. [Google Scholar] [CrossRef] [Scilit]
- Lu, D.Y.; Zhang, G.S.; Li, Y.X.; Guo, W.Y.; Zhang, Y.K. Genetic diversity and evolutionary history analysis of natural populations of Juniperus sabina L. Plant Sci. J. 2020, 38, 151–161. [Google Scholar]
- Hong, Y.; Wang, L.H.; Zhang, G.S.; Enhe, B.T.E.; Liang, X.R. Genetic diversity of Sabina vulgaris populations at different succession stages. Chin. J. Appl. Ecol. 2006, 17, 2006–2010. [Google Scholar]
- Geng, Q.F.; Qing, H.; Ling, Z.R.; Jeelani, N.; Yang, J.; Yoshikawa, K.; Miki, N.H.; Wang, Z.S.; Lian, C.L. Characterization of polymorphic microsatellite markers for a coniferous shrub Juniperus sabina (Cupressaceae). Plant Species Biol. 2017, 32, 252–255. [Google Scholar] [CrossRef] [Scilit]
- Ellegren, H. Hans Microsatellites: Simple sequences with complex evolution. Nat. Rev. Genet. 2004, 5, 435–445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, D.Y. The Chloroplast Genome, Population Genetic Diversity and Phylogeography of Juniperus sabina (Cupressaceae); University of Inner Mongolia Agriculture: Hohhot, China, 2020. [Google Scholar]
- Schuelke, M. An economic method for the fluorescent labeling of PCR fragments. Nat. Biotechnol. 2000, 18, 233–234. [Google Scholar] [CrossRef] [Scilit]
- Peakall, R.; Smouse, P.E. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef] [Scilit]
- Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program cervus accommodates genotyping error increases success in paternity assignment. Mol. Ecol. 2007, 16, 1099–1106. [Google Scholar] [CrossRef] [Scilit]
- Bradbury, P.J.; Zhang, Z.; Kroon, D.E.; Casstevens, T.M.; Ramdoss, Y.; Buckler, E.S. TASSEL: Software for association mapping of complex traits in diverse samples. Bioinformatics 2007, 23, 2633–2635. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.Q.; Kwon, S.-W.; Park, Y.J. Evaluation of genetic diversity and linkage disequilibrium in Korean-bred rice varieties using SSR markers. Electron. J. Biotechnol. 2013, 16, 1–20. [Google Scholar]
- Nagy, S.; Poczai, P.; Cernák, I.; Gorji, A.M.; Hegedűs, G.; Taller, J. PICcalc: An online program to calculate polymorphic information content for molecular genetic studies. Biochem. Genet. 2012, 50, 670–672. [Google Scholar] [CrossRef] [Scilit]
- Nei, M.; Tajima, F.; Tateno, Y. Accuracy of estimated phylogenetic trees from molecular data. J. Mol. Evol. 1983, 19, 153–170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Excoffier, L.; Laval, G.; Schneider, S. Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evol. Bioinform. 2005, 1, 47–50. [Google Scholar] [CrossRef] [Scilit]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef] [Scilit]
- Earl, D.A. Structure Harvester: A website and program for visualizing Structure output and implementing the Evanno method. Conserv. Genet. Resour. 2012, 4, 359–361. [Google Scholar] [CrossRef] [Scilit]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software structure: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [Scilit]
- Manni, F.; Guérard, E.; Heyer, E. Geographic patterns of (genetic, morphologic, linguistic) variation: How barriers can be detected by using Monmonier’s algorithm. Hum. Biol. 2004, 76, 173–190. [Google Scholar] [CrossRef] [Scilit]
- Manel, S.; Schwartz, M.K.; Luikart, G.; Taberlet, P. Landscape genetics: Combining landscape ecology and population genetics. Trends Ecol. Evol. 2003, 18, 189–197. [Google Scholar] [CrossRef] [Scilit]
- Rosenberg, M.S.; Anderson, C.D. PASSaGE: Pattern analysis, spatial statistics and geographic exegesis. Version 2. Methods Ecol. Evol. 2011, 2, 229–232. [Google Scholar] [CrossRef] [Scilit]
- Rumeu, B.; Sosa, P.; Nogales, M.; González-Pérez, M. Development and characterization of 13 SSR markers for an endangered insular juniper (Juniperus cedrus Webb & Berth.). Conserv. Genet. Resour. 2013, 5, 457–459. [Google Scholar]
- Bettencourt, S.X.; Mendonça, D.; Lopes, M.S.; Rocha, S.; Monjardino, P.; Monteiro, L.; Da Câmara Machado, A. Genetic diversity and population structure of the endemic Azorean juniper, Juniperus brevifolia (Seub.) Antoine, inferred from SSRs and ISSR markers. Biochem. Syst. Ecol. 2015, 59, 314–324. [Google Scholar] [CrossRef] [Scilit]
- Liao, S.X.; Mi, X.J.; Liu, A.Z.; Li, K.; Yang, Z.Y.; Tian, B. Isolation and characterization of polymorphic microsatellite markers in Calocedrus macrolepis Kurz (Cupressaceae). HortScience 2010, 45, 169–171. [Google Scholar] [CrossRef] [Scilit]
- Volis, S.; Ormanbekova, D.; Yermekbayev, K.; Song, M.; Shulgina, I. The conservation value of peripheral populations and a relationship between quantitative trait and molecular variation. Evol. Biol. 2016, 43, 26–36. [Google Scholar] [CrossRef] [Scilit]
- Wissler, L.; Godmann, L.; Bornberg-Bauer, E. Evolutionary dynamics of simple sequence repeats across long evolutionary time scale in genus Drosophila. Trends Evol. Biol. 2012, 4, e7. [Google Scholar] [CrossRef] [Scilit]
- Zhang, G.; Zhang, X.; Wang, L.; Liang, X.; Wen, G.; Hong, Y. RAPD analysis on genetic differentiation of Sabina vulgaris populations in Inner Mongolia area. J. Arid Land Resour. Environ. 2005, 19, 193–198. [Google Scholar]
- Wang, Z.; Zhang, G.; Wang, L.-H.; Hao, Y.W.M.; Wang, M. Microhabitat characteristics of natural regeneration of Savina vulgaris community in Mu Us Sandland. J. Arid Land Resour. Environ. 2007, 4, 156–163. [Google Scholar]
- Zhang, Q.; Chiang, T.; George, M.; Liu, J.; Abbott, R. Phylogeography of the Qinghai-Tibetan Plateau endemic Juniperus przewalskii (Cupressaceae) inferred from chloroplast DNA sequence variation. Mol. Ecol. 2010, 14, 3513–3524. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Zhang, X.; Fang, Y. Landscape features and climatic forces shape the genetic structure and evolutionary history of an oak species (Quercus chenii) in East China. Front. Plant Sci. 2019, 10, 1060. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.H.; Wang, I.J.; Comes, H.P.; Peng, H.; Qiu, Y.X. Contributions of historical and contemporary geographic and environmental factors to phylogeographic structure in a Tertiary relict species, Emmenopterys henryi (Rubiaceae). Sci. Rep. 2016, 6, 24041. [Google Scholar] [CrossRef] [Scilit]
- Wright, S. Evolution and the Genetics of Populations, Volume 4: Variability within and among Natural Populations; University of Chicago Press: Chicago, IL, USA, 1978. [Google Scholar]
- Mariot, A.; Montagna, T.; Dos Reis, M.S. Genetic diversity and structure of Drimys brasiliensis in southern Brazil: Insights for conservation. J. For. Res. 2019, 31, 1325–1332. [Google Scholar] [CrossRef] [Scilit]





| Pop Code | Geographic Location | Longitude | Latitude | Altitude (m) | Number of Individuals | Habitat |
|---|---|---|---|---|---|---|
| NMKQ | Baiyinaobao, Keshiketeng, Chifeng, Inner Mongolia | 117°10′50″ | 43°34′16″ | 1410 | 27 | Hunshandak Sandland |
| NMXM | Gaogesitai, Abaga, Xilinguole, Inner Mongolia | 115°33′39″ | 43°11′13″ | 1254 | 30 | Hunshandak Sandland |
| NMDM | Ming’an, Damao, Baotou, Inner Mongolia | 109°29′34″ | 41°45′27″ | 1376 | 30 | Yin mountain |
| NMTK | Tuke, Wushen, Erdos, Inner Mongolia | 109°18′05″ | 38°58′00″ | 1362 | 35 | Mu Us Sandland |
| NMTL | Taoli, Wushen, Erdos, Inner Mongolia | 108°43′34″ | 38°25′12″ | 1325 | 35 | Mu Us Sandland |
| NMNL | Nalingaole, Wushen, Erdos, Inner Mongolia | 108°46′10″ | 38°04′55″ | 1222 | 35 | Mu Us Sandland |
| NMAZ | Luanchaigou, Zuo, Alashan, Inner Mongolia | 106°01′51″ | 39°01′00″ | 2249 | 30 | Helan Mountain |
| NMYQ | Taohuashan, You, Alashan, Inner Mongolia | 100°59′15″ | 39°05′56″ | 2812 | 16 | Longshou Mountain |
| SXHS | Leilongwan, Hengshan, Yulin, Shaanxi | 109°02′51″ | 38°03′28″ | 1130 | 35 | Mu Us Sandland |
| GS | Shimen, Tianzhu, Wuwei, Gausu | 103°03′30″ | 36°59′46″ | 2731 | 30 | Qilian Mountain |
| QH | Qinghaihudong, Haiyan, Haibeizangzu, Qinghai | 100°47′27″ | 36°45′29″ | 3328 | 30 | Qilian Mountain |
| Locus | Primer Sequences | Repeat Motif | Allele Size (bp) | Annealing Temperature (°C) | Number of Alleles (N) | PIC | GenBank Code | HW | FNA |
|---|---|---|---|---|---|---|---|---|---|
| JS4 | F:AGAAATGACAACTGCCTATGAGA | (AC)7 | 322–340 | 58 | 7 | 0.370 | MN061871 | NS | 0.09 |
| R:GAATGAAGGAACCCTTGATGA | |||||||||
| JS5 | F:TTATGGGAGGAACTTGGCTG | (TGA)6 | 309–315 | 60 | 7 | 0.179 | MN061872 | NS | 0.12 |
| R:TCTCCGCTCTGCTTCATTCT | |||||||||
| JS6 | F:ATCTTGTGAGGGGTCTTCCC | (TC)8 | 344–354 | 59 | 5 | 0.544 | MN061873 | NS | 0.11 |
| R:TGCAAACTCAAAGGTGAATTG | |||||||||
| JS15 | F:TCCCTGCAAGATATGACAAGTG | (TC)7 | 268–282 | 60 | 8 | 0.600 | MN061874 | NS | −0.21 |
| R:TAGGGGTTTTCCCACATCAA | |||||||||
| JS17 | F:CAAGGCCTTTGGGTTATGAG | (GAA)5 | 282–306 | 59 | 14 | 0.729 | MN061875 | * | 0.18 |
| R:GCCTTTTGTTAGTGCAAGAGGT | |||||||||
| JS20 | F:CAAGTGCCGAGCATTAAAAA | (GA)6 | 330–338 | 59 | 5 | 0.710 | MN061876 | * | 0.24 |
| R:CACTCAGTCATTCCTTCCTTCA | |||||||||
| JS30 | F:GCAGCTTTCTGGCTCCATAC | (TA)6 | 302–332 | 59 | 11 | 0.187 | MN061877 | NS | 0.16 |
| R:CACCGAATGAAAGAATGAATG | |||||||||
| JS31 | F:TTGGCTAATGATGTGCTTGC | (ATG)5 | 330–354 | 59 | 6 | 0.537 | MN061878 | NS | 0.04 |
| R:ACCCAAGCTATGTGCAGGAT | |||||||||
| JS33 | F:AAAATCAAAACGGCCAAATG | (TTG)5 | 259–286 | 60 | 9 | 0.751 | MN061879 | NS | 0.03 |
| R:AGCAGATGGACAACTTTCGC | |||||||||
| JS35 | F:GAAACGGTTTGGGTCTTCAC | (AAG)5 | 258–267 | 59 | 4 | 0.512 | MN061880 | * | 0.17 |
| R:CGAAGGCTCATCGTCATCTA | |||||||||
| JS54 | F:CTTGTGGTTAGTGGTTGGCA | (CAT)7 | 255–279 | 60 | 10 | 0.549 | MN061881 | NS | −0.08 |
| R:CACTCTCCCAGTGGTGGTTT | |||||||||
| JS57 | F:TTTAGCTCTCATTTGGCTAGCAT | (GAAA)4 | 296–300 | 59 | 3 | 0.228 | MN061882 | NS | −0.08 |
| R:TGGAACTATGTGTTTTAGAAATCAGTG | |||||||||
| JS58 | F:TTGATTCTTCACCATCCCCT | (TCA)5 | 134–161 | 59 | 8 | 0.199 | MN061883 | NS | 0.03 |
| R:GGAACAAAACAAAAACTTGGAA | |||||||||
| JS61 | F:CACGAGAGAGGCAAATGGAT | (GA)6 | 267–283 | 59 | 7 | 0.369 | MN061884 | * | 0.16 |
| R:GAGAACAAACTTCCGTATTGTCA | |||||||||
| JS66 | F:GGTGCTATGATATTGTGTTGTTGA | (TC)7 | 284–286 | 59 | 2 | 0.337 | MN061885 | NS | 0.18 |
| R:TTGTTTGGTGTGACCGAGAA | |||||||||
| JS74 | F:TTGGGCGTAGCTTGAGTTTC | (TGT)5 | 252–270 | 60 | 4 | 0.280 | MN061886 | NS | −0.11 |
| R:GAACAATGCCCCTCCTTACA | |||||||||
| JS80 | F:CCTTTTTAACCGAACATTGCC | (TA)6 | 292–302 | 60 | 6 | 0.403 | MN061887 | NS | 0.09 |
| R:GCATCTAGCATTGGAGGGAA | |||||||||
| Sabv5 ※ | F:GTGGTCATTGTTGACCTTCACTTA | (AC)6(TC)6 | 159–163 | 56 | 6 | 0.409 | KY021992 | NS | 0.11 |
| R: ACACACACACACACTCTCTC | |||||||||
| Sabv6 ※ | F:GGGGTTTTTAGGTGTCTATGTAGG | (AC)6(TC)10 | 112–124 | 58 | 7 | 0.725 | KY021993 | NS | 0.11 |
| R: ACACACACACACACTCTCTC | |||||||||
| Sabv8 ※ | F:GCTTTGATTAGACTGATTTTGATC | (AC)6(TC)6(AC)6 | 154–166 | 53 | 5 | 0.381 | KY021994 | NS | 0.08 |
| R: ACACACACACACACTCTCTC | |||||||||
| Average | 6.70 | 0.450 |
| Pop | Na | Ne | SI | Ho | He | F | PPL (%) | Fis |
|---|---|---|---|---|---|---|---|---|
| NMKQ | 3.350 | 2.145 | 0.806 | 0.418 | 0.464 | 0.134 | 100 | 0.010 |
| NMXM | 3.750 | 2.237 | 0.853 | 0.425 | 0.474 | 0.092 | 100 | 0.118 |
| NMDM | 3.805 | 2.273 | 0.887 | 0.430 | 0.484 | 0.115 | 100 | 0.207 |
| NMTK | 4.300 | 2.437 | 0.951 | 0.416 | 0.515 | 0.177 | 100 | 0.205 |
| SXHS | 3.900 | 2.288 | 0.891 | 0.396 | 0.489 | 0.173 | 100 | 0.282 |
| NMNL | 3.650 | 2.163 | 0.836 | 0.336 | 0.459 | 0.244 | 100 | 0.230 |
| NMTL | 4.000 | 2.122 | 0.834 | 0.356 | 0.454 | 0.193 | 100 | 0.048 |
| NMYQ | 2.800 | 2.040 | 0.72 | 0.413 | 0.419 | –0.004 | 90 | 0.024 |
| GS | 2.900 | 1.960 | 0.659 | 0.391 | 0.376 | –0.040 | 70 | 0.128 |
| QH | 3.550 | 2.088 | 0.777 | 0.429 | 0.426 | 0.003 | 95 | 0.118 |
| NMAZ | 4.000 | 2.200 | 0.858 | 0.413 | 0.456 | 0.133 | 100 | 0.110 |
| Average | 3.641 | 2.178 | 0.825 | 0.402 | 0.456 | 0.117 | 95.91 | 0.135 |
| Source of Variation | df | SS | MS | % | P | FST | Nm |
|---|---|---|---|---|---|---|---|
| Among populations | 10 | 536.810 | 53.681 | 12% | <0.001 | ||
| Within populations | 322 | 3486.799 | 10.829 | 88% | <0.001 | ||
| Total | 332 | 4023.610 | 100% | 0.090 * | 2.534 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lu, D.; Huang, H.; Wang, A.; Zhang, G. Genetic Evaluation of Juniperus sabina L. (Cupressaceae) in Arid and Semi-Arid Regions of China Based on SSR Markers. Forests 2022, 13, 231. https://doi.org/10.3390/f13020231
Lu D, Huang H, Wang A, Zhang G. Genetic Evaluation of Juniperus sabina L. (Cupressaceae) in Arid and Semi-Arid Regions of China Based on SSR Markers. Forests. 2022; 13(2):231. https://doi.org/10.3390/f13020231
Chicago/Turabian StyleLu, Dongye, Haiguang Huang, Aijun Wang, and Guosheng Zhang. 2022. "Genetic Evaluation of Juniperus sabina L. (Cupressaceae) in Arid and Semi-Arid Regions of China Based on SSR Markers" Forests 13, no. 2: 231. https://doi.org/10.3390/f13020231
APA StyleLu, D., Huang, H., Wang, A., & Zhang, G. (2022). Genetic Evaluation of Juniperus sabina L. (Cupressaceae) in Arid and Semi-Arid Regions of China Based on SSR Markers. Forests, 13(2), 231. https://doi.org/10.3390/f13020231

