Metal Nanoparticles Released from Dental Implant Surfaces: Potential Contribution to Chronic Inflammation and Peri-Implant Bone Loss
Abstract
1. Introduction
2. Materials and Methods
2.1. Patient’s Selection
2.2. Particulate Preparation and Characterization
2.3. Cell Cultures
2.4. Methyl Hiazolyl-Tetrazolium (MTT) Assay
2.5. Reactive Oxygen Species (ROS) Measurements
2.6. Transmission Electron Microscopy (TEM)
2.7. Sample Preparation for Histological Analysis
2.8. Hematoxylin and Eosin Staining
2.9. Immunofluorescence Staining
2.10. RNA Extraction
2.11. RT2 Profiler PCR Array
2.12. Real-Time PCR
2.13. GO Analyses
2.14. Array CGH Analysis
2.15. Determination of Ti Levels by ICP-MS
2.16. Statistical Analysis
3. Results
3.1. Effects of Ti Particles Exposure on Mitochondrial Function through ROS Production Shown by Decreased MTT Activity
3.2. Evaluation of Ti in Peri-Implant Tissue
3.3. Distribution of Ti Particles in Peri-Implant Tissue
3.4. Wound Healing Process
3.5. Osteogenesis and Adipogenesis
3.6. Vascularization
3.7. Gene Ontology (GO) of Genes
3.8. Chromosomal Aberration
4. Discussion
5. Conclusions
- Metal particles may induce ROS production.
- ROS production may induce abnormal neutrophil recruitment as metal particles are not degradable.
- Neutrophils induce ECM degradation through the secretion of MMP.
- ECM resistance changes, due its degradation, inducing the mechano-transduction of MSCs differentiation more toward adipocytes than osteoblasts.
- ROS induce the activation of PKC beta, which is involved in MSC commitment to the adipocyte lineage.
- VEGF involvement in bone regeneration is down-regulated due to a genetic deletion.
- Osteolytic processes are activated, due to an imbalance of osteogenic commitment.
Author Contributions
Funding
Conflicts of Interest
References
- Albrektsson, T.; Donos, N.; Working Group 1. Implant survival and complications. The Third EAO consensus conference 2012. Clin. Oral. Implants Res. 2012, 23, 63–65. [Google Scholar] [CrossRef] [PubMed]
- Machtei, E.E. Treatment Alternatives to Negotiate Peri-Implantitis. Adv. Med. 2014, 2014, 487903. [Google Scholar] [CrossRef] [PubMed]
- Rosen, P. Peri-implant mucositis and peri-implantitis: A current understanding of their diagnoses and clinical implications. J. Periodontol. 2013, 84, 436–443. [Google Scholar] [CrossRef]
- Ata-Ali, J.; Ata-Ali, F.; Bagan, L. A Classification Proposal for Peri-Implant Mucositis and Peri-Implantitis: A Critical Update. Open. Dent. J. 2015, 9, 393–395. [Google Scholar] [CrossRef] [PubMed]
- Ata-Ali, J.; Candel-Marti, M.E.; Flichy-Fernández, A.J.; Peñarrocha-Oltra, D.; Balaguer-Martinez, J.F.; Peñarrocha Diago, M. Peri-implantitis: Associated microbiota and treatment. Med. Oral. Patol. Oral. Cir. Bucal. 2011, 16, e937-43. [Google Scholar] [CrossRef]
- Koldsland, O.C.; Scheie, A.A.; Aass, A.M. The association between selected risk indicators and severity of peri-implantitis using mixed model analyses. J. Clin. Periodontol. 2011, 38, 285–292. [Google Scholar] [CrossRef]
- De Bruyn, H.; Vandeweghe, S.; Ruyffelaert, C.; Cosyn, J.; Sennerby, L. Radiographic evaluation of modern oral implants with emphasis on crestal bone level and relevance to peri-implant health. Periodontology 2000 2013, 62, 256–270. [Google Scholar] [CrossRef]
- Noronha Oliveira, M.; Schunemann, W.V.H.; Mathew, M.T.; Henriques, B.; Magini, R.S.; Teughels, W.; Souza, J.C.M. Can degradation products released from dental implants affect peri-implant tissues? J. Periodontal. Res. 2018, 53, 1–11. [Google Scholar] [CrossRef]
- Matusiewicz, H. Potential release of in vivo trace metals from metallic medical implants in the human body: From ions to nanoparticles—A systematic analytical review. Acta Biomater. 2014, 10, 2379–2403. [Google Scholar] [CrossRef]
- SyApaza-Bedoya, K.; Tarce, M.; Benfatti, C.A.M.; Henriques, B.; Mathew, M.T.; Teughels, W.; Souza, J.C.M. Sinergistic interactions between corrosion and wear at titanium-based dental implant connections: A scoping review. J. Periodontal. Res. 2017, 52, 946–954. [Google Scholar] [CrossRef]
- Grande, F.; Tucci, P. Titanium Dioxide Nanoparticles: A Risk for Human Health? Mini Rev. Med. Chem. 2016, 16, 762–769. [Google Scholar] [CrossRef] [PubMed]
- Lappas, C.M. The immunomodulatory effects of titanium dioxide and silver nanoparticles. Food Chem. Toxicol. 2015, 85, 78–83. [Google Scholar] [CrossRef] [PubMed]
- Huang, C. Titanium dioxide nanoparticles prime a specific activation state of macrophages. Nanotoxicology 2017, 11, 737–750. [Google Scholar] [CrossRef] [PubMed]
- Dubey, A.; Goswami, M.; Yadav, K.; Chaudhary, D. Oxidative Stress and Nano-Toxicity Induced by TiO2 and ZnO on WAG Cell Line. PLoS ONE 2015, 10, e0127493. [Google Scholar] [CrossRef] [PubMed]
- Fretwurst, T.; Nelson, K.; Tarnow, D.P.; Wang, H.L.; Giannobile, W.V. Is Metal Particle Release Associated with Peri-implant Bone Destruction? An Emerging Concept. J. Dent. Res. 2018, 97, 259–265. [Google Scholar] [CrossRef] [PubMed]
- World Medical Association Declaration of Helsinki: Ethical principles for medical research involving human subjects. JAMA 2013, 310, 2191–2194. [CrossRef]
- Bi, Y.; Seabold, J.M.; Kaar, S.G.; Ragab, A.A.; Goldberg, V.M.; Anderson, J.M.; Greenfield, E.M. Adherent endotoxin on orthopedic wear particles stimulates cytokine production and osteoclast differentiation. J. Bone Miner. Res. 2001, 16, 2082–2091. [Google Scholar] [CrossRef]
- Bressan, E.; Ferroni, L.; Gardin, C.; Pinton, P.; Stellini, E.; Botticelli, D.; Sivolella, S.; Zavan, B. Donor age-related biological properties of human dental pulp stem cells change in nanostructured scaffolds. PLoS ONE 2012, 7, e49146. [Google Scholar] [CrossRef]
- Figallo, E.; Flaibani, M.; Zavan, B.; Abatangelo, G.; Elvassore, N. Micropatterned biopolymer 3D scaffold for static and dynamic culture of human fibroblasts. Biotechnol. Prog. 2007, 23, 210–216. [Google Scholar] [CrossRef]
- Ferroni, L.; Gardin, C.; Dolkart, O.; Salai, M.; Barak, S.; Piattelli, A.; Amir-Barak, H.; Zavan, B. Pulsed electromagnetic fields increase osteogenetic commitment of MSCs via the mTOR pathway in TNF-α mediated inflammatory conditions: An in-vitro study. Sci. Rep. 2018, 8, 5108. [Google Scholar] [CrossRef]
- Gardin, C.; Ferroni, L.; Bressan, E.; Calvo-Guirado, J.L.; Degidi, M.; Piattelli, A.; Zavan, B. Adult stem cells properties in terms of commitment, aging and biological safety of grit-blasted and Acid-etched ti dental implants surfaces. Int. J. Mol. Cell. Med. 2014, 3, 225–236. [Google Scholar] [PubMed]
- Cecchinato, F.; Karlsson, J.; Ferroni, L.; Gardin, C.; Galli, S.; Wennerberg, A.; Zavan, B.; Andersson, M.; Jimbo, R. Osteogenic potential of human adipose-derived stromal cells on 3-dimensional mesoporous TiO2 coating with magnesium impregnation. Mater. Sci. Eng. C Mater. Biol. Appl. 2015, 52, 225–234. [Google Scholar] [CrossRef] [PubMed]
- Bressan, E.; Ferroni, L.; Gardin, C.; Rigo, C.; Stocchero, M.; Vindigni, V.; Cairns, W.; Zavan, B. Silver nanoparticles and mitochondrial interaction. Int. J. Dent. 2013, 2013, 312747. [Google Scholar] [CrossRef] [PubMed]
- Silva-Correia, J.; Zavan, B.; Vindigni, V.; Silva, T.H.; Oliveira, J.M.; Abatangelo, G.; Reis, R.L. Biocompatibility evaluation of ionic- and photo-crosslinked methacrylated gellan gum hydrogels: In vitro and in vivo study. Adv. Healthc. Mater. 2013, 2, 568–575. [Google Scholar] [CrossRef] [PubMed]
- Gardin, C.; Bressan, E.; Ferroni, L.; Nalesso, E.; Vindigni, V.; Stellini, E.; Pinton, P.; Sivonella, S.; Zavan, B. In Vitro concurrent endothelial and osteogenic commitment of adipose-derived stem cells and their genomical analyses through comparative genomic hybridization array: Novel strategies to increase the successful engraftment of tissue-engineered bone grafts. Stem. Cells Dev. 2012, 21, 767–777. [Google Scholar] [CrossRef] [PubMed]
- Hallab, N.J.; Jacobs, J.J. Chemokines Associated with Pathologic Responses to Orthopedic Implant Debris. Front. Endocrinol. 2017, 8, 5. [Google Scholar] [CrossRef]
- Hu, X.; Ping, Z.; Gan, M.; Tao, Y.; Wang, L.; Shi, J.; Wu, X.; Zhang, W.; Yang, H.; Xu, Y.; et al. Theaflavin-3,3′-digallate represses osteoclastogenesis and prevents wear debris-induced osteolysis via suppression of ERK pathway. Acta Biomater. 2017, 48, 479–488. [Google Scholar] [CrossRef]
- Yang, H.; Xu, Y.; Zhu, M.; Gu, Y.; Zhang, W.; Shao, H.; Wang, Y.; Ping, Z.; Hu, X.; Wang, L.; et al. Inhibition of titanium-particle-induced inflammatory osteolysis after local administration of dopamine and suppression of osteoclastogenesis via D2-like receptor signaling pathway. Biomaterials 2016, 80, 1–10. [Google Scholar] [CrossRef]
- Landgraeber, S.; Jäger, M.; Jacobs, J.J.; Hallab, N.J. The pathology of orthopedic implant failure is mediated by innate immune system cytokines. Mediators Inflamm. 2014, 2014, 185150. [Google Scholar] [CrossRef]
- Ren, W.; Zhang, R.; Hawkins, M.; Shi, T.; Markel, D.C. Efficacy of periprosthetic erythromycin delivery for wear debris-induced inflammation and osteolysis. Inflamm. Res. 2010, 59, 1091–1097. [Google Scholar] [CrossRef]
- Zhu, F.B.; Cai, X.Z.; Yan, S.G.; Zhu, H.X.; Li, R. The effects of local and systemic alendronate delivery on wear debris-induced osteolysis in vivo. J. Orthop. Res. 2010, 28, 893–899. [Google Scholar] [CrossRef] [PubMed]
- Geng, D.; Xu, Y.; Yang, H.; Wang, J.; Zhu, X.; Zhu, G.; Wang, X. Protection against titanium particle induced osteolysis by cannabinoid receptor 2 selective antagonist. Biomaterials 2010, 31, 1996–2000. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, Y.; Nishiyama, T.; Hasuda, K.; Fujishiro, T.; Niikura, T.; Hayashi, S.; Hashimoto, S.; Kurosaka, M. Effect of etidronate on COX-2 expression and PGE(2) production in macrophage-like RAW 264.7 cells stimulated by titanium particles. J. Orthop. Sci. 2007, 12, 568–577. [Google Scholar] [CrossRef] [PubMed]
- Yang, S.Y.; Yu, H.; Gong, W.; Wu, B.; Mayton, L.; Costello, R.; Wooley, P.H. Murine model of prosthesis failure for the long-term study of aseptic loosening. J. Orthop. Res. 2007, 25, 603–611. [Google Scholar] [CrossRef] [PubMed]
- Hallab, N.J.; Cunningham, B.W.; Jacobs, J.J. Spinal implant debris-induced osteolysis. Spine 2003, 28, S125–S138. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Morham, S.G.; Langenbach, R.; Young, D.A.; Xing, L.; Boyce, B.F.; Puzas, E.J.; Rosier, R.N.; O’Keefe, R.J.; Schwarz, E.M. Evidence for a direct role of cyclo-oxygenase 2 in implant wear debris-induced osteolysis. J. Bone Miner. Res. 2001, 16, 660–670. [Google Scholar] [CrossRef] [PubMed]
- Haleem-Smith, H.; Argintar, E.; Bush, C.; Hampton, D.; Postma, W.F.; Chen, F.H.; Rimington, T.; Lamb, J.; Tuan, R.S. Biological responses of human mesenchymal stem cells to titanium wear debris particles. J. Orthop. Res. 2012, 30, 853–863. [Google Scholar] [CrossRef] [PubMed]
- Medzhitov, R. Origin and physiological roles of inflammation. Nature 2008, 454, 428–435. [Google Scholar] [CrossRef]
- Miller, L.S.; O’Connell, R.M.; Gutierrez, M.A.; Pietras, E.M.; Shahangian, A.; Gross, C.E.; Thirumala, A.; Cheung, A.L.; Cheng, G.; Modlin, R.L. MyD88 mediates neutrophil recruitment initiated by IL-1R but not TLR2 activation in immunity against Staphylococcus aureus. Immunity 2006, 24, 79–91. [Google Scholar] [CrossRef]
- Miller, L.S.; Pietras, E.M.; Uricchio, L.H.; Hirano, K.; Rao, S.; Lin, H.; O’Connell, R.M.; Iwakura, Y.; Cheung, A.L.; Cheng, G.; et al. Inflammasome-mediated production of IL-1beta is required for neutrophil recruitment against Staphylococcus aureus in vivo. J. Immunol. 2007, 179, 6933–6942. [Google Scholar] [CrossRef]
- Park, H.; Li, Z.; Yang, X.O.; Chang, S.H.; Nurieva, R.; Wang, Y.H.; Wang, Y.; Hood, L.; Zhu, Z.; Tian, Q.; et al. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat. Immunol. 2005, 6, 1133–1141. [Google Scholar] [CrossRef] [PubMed]
- Chen, K.W.; Groß, C.J.; Sotomayor, F.V.; Stacey, K.J.; Tschopp, J.; Sweet, M.J.; Schroder, K. The neutrophil NLRC4 inflammasome selectively promotes IL-1β maturation without pyroptosis during acute Salmonella challenge. Cell Rep. 2014, 8, 570–582. [Google Scholar] [CrossRef] [PubMed]
- Cho, J.S.; Guo, Y.; Ramos, R.I.; Hebroni, F.; Plaisier, S.B.; Xuan, C.; Granick, J.L.; Matsushima, H.; Takashima, A.; Iwakura, Y.; et al. Neutrophil-derived IL-1β is sufficient for abscess formation in immunity against Staphylococcus aureus in mice. PLoS Pathog. 2012, 8, e1003047. [Google Scholar] [CrossRef] [PubMed]
- Karmakar, M.; Katsnelson, M.; Malak, H.A.; Greene, N.G.; Howell, S.J.; Hise, A.G.; Camilli, A.; Kadioglu, A.; Dubyak, G.R.; Pearlman, E. Neutrophil IL-1β processing induced by pneumolysin is mediated by the NLRP3/ASC inflammasome and caspase-1 activation and is dependent on K+ efflux. J. Immunol. 2015, 194, 1763–1775. [Google Scholar] [CrossRef] [PubMed]
- Devalon, M.L.; Elliott, G.R.; Regelmann, W.E. Oxidative response of human neutrophils, monocytes, and alveolar macrophages induced by unopsonized surface-adherent Staphylococcus aureus. Infect. Immun. 1987, 55, 2398–2403. [Google Scholar] [PubMed]
- Nathan, C.; Shiloh, M.U. Reactive oxygen and nitrogen intermediates in the relationship between mammalian hosts and microbial pathogens. Proc. Natl. Acad. Sci. USA 2000, 97, 8841–8848. [Google Scholar] [CrossRef] [PubMed]
- Silva, M.T. When two is better than one: Macrophages and neutrophils work in concert in innate immunity as complementary and cooperative partners of a myeloid phagocyte system. J. Leukoc. Biol. 2010, 87, 93–106. [Google Scholar] [CrossRef] [PubMed]
- Murphy, M.P.; Holmgren, A.; Larsson, N.G.; Halliwell, B.; Chang, C.J.; Kalyanaraman, B.; Rhee, S.G.; Thornalley, P.J.; Partridge, L.; Gems, D.; et al. Unraveling the biological roles of reactive oxygen species. Cell Metab. 2011, 13, 361–366. [Google Scholar] [CrossRef] [PubMed]
- Bagaitkar, J.; Pech, N.K.; Ivanov, S.; Austin, A.; Zeng, M.Y.; Pallat, S.; Huang, G.; Randolph, G.J.; Dinauer, M.C. NADPH oxidase controls neutrophilic response to sterile inflammation in mice by regulating the IL-1α/G-CSF axis. Blood 2015, 126, 2724–2733. [Google Scholar] [CrossRef] [PubMed]
- Han, L.; Tang, M.X.; Ti, Y.; Wang, Z.H.; Wang, J.; Ding, W.Y.; Wang, H.; Zhang, Y.; Zhang, W.; Zhong, M. Overexpressing STAMP2 improves insulin resistance in diabetic ApoE⁻/⁻/LDLR⁻/⁻ mice via macrophage polarization shift in adipose tissues. PLoS ONE 2013, 8, e78903. [Google Scholar] [CrossRef]
- Harbort, C.J.; Soeiro-Pereira, P.V.; von Bernuth, H.; Kaindl, A.M.; Costa-Carvalho, B.T.; Condino-Neto, A.; Reichenbach, J.; Roesler, J.; Zychlinsky, A.; Amulic, B. Neutrophil oxidative burst activates ATM to regulate cytokine production and apoptosis. Blood 2015, 126, 2842–2851. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.; Beiting, D.P.; Gebreselassie, N.G.; Gagliardo, L.F.; Ruyechan, M.C.; Lee, N.A.; Lee, J.J.; Appleton, J.A. Eosinophils and IL-4 Support Nematode Growth Coincident with an Innate Response to Tissue Injury. PLoS Pathog. 2015, 11, e1005347. [Google Scholar] [CrossRef] [PubMed]
- Meissner, F.; Molawi, K.; Zychlinsky, A. Superoxide dismutase 1 regulates caspase-1 and endotoxic shock. Nat. Immunol. 2008, 9, 866–872. [Google Scholar] [CrossRef] [PubMed]
- Meissner, M.; Hrgovic, I.; Doll, M.; Kaufmann, R. PPARδ agonists suppress angiogenesis in a VEGFR2-dependent manner. Arch. Dermatol. Res. 2011, 303, 41–47. [Google Scholar] [CrossRef] [PubMed]
- Morgenstern, H. Defining and explaining race effects. Epidemiology 1997, 8, 609–611. [Google Scholar] [CrossRef] [PubMed]
- Rieber, N.; Hector, A.; Kuijpers, T.; Roos, D.; Hartl, D. Current concepts of hyperinflammation in chronic granulomatous disease. Clin. Dev. Immunol. 2012, 2012, 252460. [Google Scholar] [CrossRef] [PubMed]
- Warnatsch, A.; Tsourouktsoglou, T.D.; Branzk, N.; Wang, Q.; Reincke, S.; Herbst, S.; Gutierrez, M.; Papayannopoulos, V. Reactive Oxygen Species Localization Programs Inflammation to Clear Microbes of Different Size. Immunity 2017, 46, 421–432. [Google Scholar] [CrossRef] [PubMed]
- De Araújo Júnior, R.F.; Souza, T.O.; de Medeiros, C.A.; de Souza, L.B.; de Lourdes Freitas, M.; De Lucena, H.F.; do Socorro Costa Feitosa Alves, M.; de Araújo, A.A. Carvedilol decrease IL-1β and TNF-α, inhibits MMP-2, MMP-9, COX-2, and RANKL expression, and up-regulates OPG in a rat model of periodontitis. PLoS ONE 2013, 8, e66391. [Google Scholar] [CrossRef]
- Kon, T.; Cho, T.J.; Aizawa, T.; Yamazaki, M.; Nooh, N.; Graves, D.; Gerstenfeld, L.C.; Einhorn, T.A. Expression of osteoprotegerin, receptor activator of NF-kappaB ligand (osteoprotegerin ligand) and related proinflammatory cytokines during fracture healing. J. Bone Miner. Res. 2001, 16, 1004–1014. [Google Scholar] [CrossRef]
- Yoshinaga, Y.; Ukai, T.; Abe, Y.; Hara, Y. Expression of receptor activator of nuclear factor kappa B ligand relates to inflammatory bone resorption, with or without occlusal trauma, in rats. J. Periodontal. Res. 2007, 42, 402–409. [Google Scholar] [CrossRef]
- Hengartner, N.E.; Fiedler, J.; Ignatius, A.; Brenner, R.E. IL-1β inhibits human osteoblast migration. Mol. Med. 2013, 19, 36–42. [Google Scholar] [CrossRef] [PubMed]
- O’Brien, C.A.; Lin, S.C.; Bellido, T.; Manolagas, S.C. Expression levels of gp130 in bone marrow stromal cells determine the magnitude of osteoclastogenic signals generated by IL-6-type cytokines. J. Cell. Biochem. 2000, 79, 532–541. [Google Scholar] [CrossRef]
- Meguid, M.H.A.; Hamad, Y.H.; Swilam, R.S.; Barakat, M.S. Relation of interleukin-6 in rheumatoid arthritis patients to systemic bone loss and structural bone damage. Rheumatol. Int. 2013, 33, 697–703. [Google Scholar] [CrossRef] [PubMed]
- Rakic, M.; Struillou, X.; Petkovic-Curcin, A.; Matic, S.; Canullo, L.; Sanz, M.; Vojvodic, D. Estimation of bone loss biomarkers as a diagnostic tool for peri-implantitis. J. Periodontol 2014, 85, 1566–1574. [Google Scholar] [CrossRef] [PubMed]
- Alrabeah, G.O.; Brett, P.; Knowles, J.C.; Petridis, H. The effect of metal ions released from different dental implant-abutment couples on osteoblast function and secretion of bone resorbing mediators. J. Dent. 2017, 66, 91–101. [Google Scholar] [CrossRef] [PubMed]
- Callander, N.S.; Roodman, G.D. Myeloma bone disease. Semin. Hematol. 2001, 38, 276–285. [Google Scholar] [CrossRef]
- Rahman, M.M.; Matsuoka, K.; Takeshita, S.; Ikeda, K. Secretion of PDGF isoforms during osteoclastogenesis and its modulation by anti-osteoclast drugs. Biochem. Biophys. Res. Commun. 2015, 462, 159–164. [Google Scholar] [CrossRef] [PubMed]
- Gill, S.E.; Parks, W.C. Metalloproteinases and their inhibitors: Regulators of wound healing. Int. J. Biochem. Cell Biol. 2008, 40, 1334–1347. [Google Scholar] [CrossRef] [PubMed]
- McBeath, R.; Pirone, D.M.; Nelson, C.M.; Bhadriraju, K.; Chen, C.S. Cell shape, cytoskeletal tension, and RhoA regulate stem cell lineage commitment. Dev. Cell 2004, 6, 483–495. [Google Scholar] [CrossRef]
- Nobusue, H.; Onishi, N.; Shimizu, T.; Sugihara, E.; Oki, Y.; Sumikawa, Y.; Chiyoda, T.; Akashi, K.; Saya, H.; Kano, K. Regulation of MKL1 via actin cytoskeleton dynamics drives adipocyte differentiation. Nat. Commun. 2014, 5, 3368. [Google Scholar] [CrossRef]
- Aguiari, P.; Leo, S.; Zavan, B.; Vindigni, V.; Rimessi, A.; Bianchi, K.; Franzin, C.; Cortivo, R.; Rossato, M.; Vettor, R.; et al. High glucose induces adipogenic differentiation of muscle-derived stem cells. Proc. Natl. Acad. Sci. USA 2008, 105, 1226–1231. [Google Scholar] [CrossRef]
- Quach, J.M.; Walker, E.C.; Allan, E.; Solano, M.; Yokoyama, A.; Kato, S.; Sims, N.A.; Gillespie, M.T.; Martin, T.J. Zinc finger protein 467 is a novel regulator of osteoblast and adipocyte commitment. J. Biol. Chem. 2011, 286, 4186–4198. [Google Scholar] [CrossRef]
- Okamoto, M.; Udagawa, N.; Uehara, S.; Maeda, K.; Yamashita, T.; Nakamichi, Y.; Kato, H.; Saito, N.; Minami, Y.; Takahashi, N.; et al. Noncanonical Wnt5a enhances Wnt/β-catenin signaling during osteoblastogenesis. Sci. Rep. 2014, 4, 4493. [Google Scholar] [CrossRef]
- Walker, C.G.; Bryson, J.M.; Bell-Anderson, K.S.; Hancock, D.P.; Denyer, G.S.; Caterson, I.D. Insulin determines leptin responses during a glucose challenge in fed and fasted rats. Int. J. Obes. 2005, 29, 398–405. [Google Scholar] [CrossRef]
- Kawai, M.; Devlin, M.J.; Rosen, C.J. Fat targets for skeletal health. Nat. Rev. Rheumatol. 2009, 5, 365–372. [Google Scholar] [CrossRef]
- Lee, N.K.; Sowa, H.; Hinoi, E.; Ferron, M.; Ahn, J.D.; Confavreux, C.; Dacquin, R.; Mee, P.J.; McKee, M.D.; Jung, D.Y.; et al. Endocrine regulation of energy metabolism by the skeleton. Cell 2007, 130, 456–469. [Google Scholar] [CrossRef]
- Schminke, B.; Vom Orde, F.; Gruber, R.; Schliephake, H.; Bürgers, R.; Miosge, N. The pathology of bone tissue during peri-implantitis. J. Dent. Res. 2015, 94, 354–361. [Google Scholar] [CrossRef]
- Bernabeu, C.; Conley, B.A.; Vary, C.P. Novel biochemical pathways of endoglin in vascular cell physiology. J. Cell. Biochem. 2007, 102, 1375–1388. [Google Scholar] [CrossRef]
- Newman, P.J.; Newman, D.K. Signal transduction pathways mediated by PECAM-1: New roles for an old molecule in platelet and vascular cell biology. Arterioscler. Thromb. Vasc. Biol. 2003, 23, 953–964. [Google Scholar] [CrossRef]
- Bazzoni, G.; Dejana, E. Endothelial cell-to-cell junctions: Molecular organization and role in vascular homeostasis. Physiol. Rev. 2004, 84, 869–901. [Google Scholar] [CrossRef]
- Houck, K.A.; Ferrara, N.; Winer, J.; Cachianes, G.; Li, B.; Leung, D.W. The vascular endothelial growth factor family: Identification of a fourth molecular species and characterization of alternative splicing of RNA. Mol. Endocrinol. 1991, 5, 1806–1814. [Google Scholar] [CrossRef]
- Thomas, K.A. Vascular endothelial growth factor, a potent and selective angiogenic agent. J. Biol. Chem. 1996, 271, 603–606. [Google Scholar] [CrossRef]
- Pradeep, A.R.; Prapulla, D.V.; Sharma, A.; Sujatha, P.B. Gingival crevicular fluid and serum vascular endothelial growth factor: Their relationship in periodontal health, disease and after treatment. Cytokine 2011, 54, 200–204. [Google Scholar] [CrossRef]
- Booth, V.; Young, S.; Cruchley, A.; Taichman, N.S.; Paleolog, E. Vascular endothelial growth factor in human periodontal disease. J. Periodontal. Res. 1998, 33, 491–499. [Google Scholar] [CrossRef]
- Mkonyi, L.E.; Bakken, V.; Søvik, J.B.; Mauland, E.K.; Fristad, I.; Barczyk, M.M.; Bletsa, A.; Berggreen, E. Lymphangiogenesis is induced during development of periodontal disease. J. Dent. Res. 2012, 91, 71–77. [Google Scholar] [CrossRef]
- Matarese, G.; Isola, G.; Anastasi, G.P.; Favaloro, A.; Milardi, D.; Vermiglio, G.; Vita, G.; Cordasco, G.; Cutroneo, G. Immunohistochemical analysis of TGF-β1 and VEGF in gingival and periodontal tissues: A role of these biomarkers in the pathogenesis of scleroderma and periodontal disease. Int. J. Mol. Med. 2012, 30, 502–508. [Google Scholar] [CrossRef]
- Cornelini, R.; Artese, L.; Rubini, C.; Fioroni, M.; Ferrero, G.; Santinelli, A.; Piattelli, A. Vascular endothelial growth factor and microvessel density around healthy and failing dental implants. Int. J. Oral. Maxillofac. Implants 2001, 16, 389–393. [Google Scholar]
- Mierzwinska-Nastalska, E.; Lomzynski, L.; Jaworska-Zaremba, M.; Kostrzewa-Janicka, J. Vascular endothelial growth factor in gingival crevicular fluid around dental implants. Eur. J. Med. Res. 2010, 15 (Suppl. 2), 88–91. [Google Scholar]
- Di Alberti, L.; Rossetto, A.; Albanese, M.; D’Agostino, A.; De Santis, D.; Bertossi, D.; Nocini, P.F. Expression of Vascular Endothelial Growth Factor (VEGF) mRNA in healthy bone tissue around implants and in peri-implantitis. Minerva Stomatol. 2013, 62 (Suppl. 1), 1–7. [Google Scholar] [CrossRef]
- Street, J.; Bao, M.; deGuzman, L.; Bunting, S.; Peale, F.V.J.; Ferrara, N.; Steinmetz, H.; Hoeffel, J.; Cleland, J.L.; Daugherty, A.; et al. Vascular endothelial growth factor stimulates bone repair by promoting angiogenesis and bone turnover. Proc. Natl. Acad. Sci. USA 2002, 99, 9656–9661. [Google Scholar] [CrossRef]
- Hu, K.; Olsen, B.R. Osteoblast-derived VEGF regulates osteoblast differentiation and bone formation during bone repair. J. Clin. Investig. 2016, 126, 509–526. [Google Scholar] [CrossRef]
- Yang, Y.Q.; Tan, Y.Y.; Wong, R.; Wenden, A.; Zhang, L.K.; Rabie, A.B. The role of vascular endothelial growth factor in ossification. Int. J. Oral. Sci. 2012, 4, 64–68. [Google Scholar] [CrossRef]
- Keramaris, N.C.; Calori, G.M.; Nikolaou, V.S.; Schemitsch, E.H.; Giannoudis, P.V. Fracture vascularity and bone healing: A systematic review of the role of VEGF. Injury 2008, 39 (Suppl. 2), S45–S57. [Google Scholar] [CrossRef]
Gene | FORWARD (5′ → 3′) | REVERSE (5′ → 3′) | Product Length |
---|---|---|---|
ENG | TGTCTCACTTCATGCCTCCAG | GCTCTTTCTTTAGTACCAGGGTCA | 161 bp |
INS | AGGCTTCTTCTACACACCCAAG | CGTCTAGTTGCAGTAGTTCTCCA | 199 bp |
OC | GCAGCGAGGTAGTGAAGAGAC | AGCAGAGCGACACCCTA | 193 bp |
OPG | AAACGCAGAGAGTGTAGAGAGG | TCGAAGGTGAGGTTAGCATGTC | 183 bp |
OPG | TGGAAAGCGAGGAGTTGAATGG | GCTCATTGCTCTCATCATTGGC | 192 bp |
PPARG | CAGGAGATCACAGAGTATGCCAA | TCCCTTGTCATGAAGCCTTGG | 173 bp |
RANK | GATCGGTACAGTCGAGGAAGA | TGCTGCGAGTTTGAGGAGTG | 169 bp |
RANKL | TCAGCATCGAGGTCTCCAAC | CCATGCCTCTTAGTAGTCTCACA | 194 bp |
RHOA | TGGACTCGGATTCGTTGCC | ACCTGCTTTCCATCCACCTC | 183 bp |
VEGF | GGACAGAAAGACAGATCACAGGTAC | GCAGGTGAGAGTAAGCGAAGG | 182 bp |
VWF | GCTTCACTTACGTTCTGCATGA | CCTTCACTCGGACACACTCATTG | 174 bp |
ZFP467 | CGCTGAGCTGAAGTTCTTGGA | ACCACTCTTTCCTGCCCTG | 102 bp |
GAPDH | TCAACAGCGACACCCAC | GGGTCTCTCTCTTCCTCTTGTG | 203 bp |
Collagen type 1 | TGAGCCAGCAGATCGAGA | ACCAGTCTCCATGTTGCAGA | 128 bp |
RUNX 2 | CGTGGATCCATGGCT | CCTCGATCGAAGGACT | 102 bp |
wnt | CAGGAGATCACAGAGTATGCCAA | TCCCTTGTCATGAAGCCTTGG | 132 bp |
FOXO1 | GACAAGTACAAGCTGAGCAAGAAG | CCACAAGCACCACATACTCCTG | 163 bp |
ALP | TCAGAGGGAAGGAGATAGAGAGTC | AGCCAGAAACCATATGTCAAGAGA | 112 bp |
BMP7 | AGATGCGGTGGCTAAAGGTC | TCTTAGGCAGCTCTTTGGGA | 145 bp |
ADIPOQ | GATGAGAGTCCTGGGTGTGAG | CTGGGTAGATATGGGATTCAAGAGA | 151 bp |
LPL | CAGCAAGAGCAAGGAGAAGAAAC | GTGGTAGGTGATGTTCTGGGA | 184 bp |
GLUT 4 | CCTGATCATTGCGGTCGTG | CCGAGACCAAGGTGAAGACTG | 122 bp |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bressan, E.; Ferroni, L.; Gardin, C.; Bellin, G.; Sbricoli, L.; Sivolella, S.; Brunello, G.; Schwartz-Arad, D.; Mijiritsky, E.; Penarrocha, M.; et al. Metal Nanoparticles Released from Dental Implant Surfaces: Potential Contribution to Chronic Inflammation and Peri-Implant Bone Loss. Materials 2019, 12, 2036. https://doi.org/10.3390/ma12122036
Bressan E, Ferroni L, Gardin C, Bellin G, Sbricoli L, Sivolella S, Brunello G, Schwartz-Arad D, Mijiritsky E, Penarrocha M, et al. Metal Nanoparticles Released from Dental Implant Surfaces: Potential Contribution to Chronic Inflammation and Peri-Implant Bone Loss. Materials. 2019; 12(12):2036. https://doi.org/10.3390/ma12122036
Chicago/Turabian StyleBressan, Eriberto, Letizia Ferroni, Chiara Gardin, Gloria Bellin, Luca Sbricoli, Stefano Sivolella, Giulia Brunello, Devorah Schwartz-Arad, Eitan Mijiritsky, Miguel Penarrocha, and et al. 2019. "Metal Nanoparticles Released from Dental Implant Surfaces: Potential Contribution to Chronic Inflammation and Peri-Implant Bone Loss" Materials 12, no. 12: 2036. https://doi.org/10.3390/ma12122036
APA StyleBressan, E., Ferroni, L., Gardin, C., Bellin, G., Sbricoli, L., Sivolella, S., Brunello, G., Schwartz-Arad, D., Mijiritsky, E., Penarrocha, M., Penarrocha, D., Taccioli, C., Tatullo, M., Piattelli, A., & Zavan, B. (2019). Metal Nanoparticles Released from Dental Implant Surfaces: Potential Contribution to Chronic Inflammation and Peri-Implant Bone Loss. Materials, 12(12), 2036. https://doi.org/10.3390/ma12122036