Dihydromyricetin Enhances Exercise-Induced GLP-1 Elevation through Stimulating cAMP and Inhibiting DPP-4
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Experimental Design
- To investigate the impact of different doses of short-term swimming training on GLP-1 secretion, mice were randomly divided into 4 groups (n = 10), sedentary (CON), 30 min swimming training (Ex-30), 60 min swimming training (Ex-60), and 90 min swimming training (Ex-90) groups. The mice were trained to swim for 15 min over the course of 3 days prior to exercise training. Swimming training was held from 8 a.m. to 12 a.m., once a day, and lasted for 2 weeks. All mice were in good health, and no mice died during the experiment period;
- To investigate the critical role that the gut microbiome played in the positive effects of short-term training on the release of GLP-1, we conducted antibiotic cocktail therapy and FMT experiments:
- Mice were randomly divided into three groups for the antibiotic cocktail treatment experiments (n = 8), sedentary (CON), antibiotic cocktail treatment (ABX), antibiotic cocktail treatment plus 60 min swimming exercise (ABX + EX). A mixture of the four antibiotics-0.5 g/L vancomycin, 1 g/L ampicillin, 1 g/L metronidazole, and 1 g/L neomycin sulfate-was added to drinking water. Antibiotic treatment and swimming training were carried out simultaneously for 2 weeks. Swimming training was carried out according to experiment 1;
- For FMT experiments, fecal samples were collected from CON and Ex-60 group mice of experiment 1 at the end of the intervention. Fecal (20 mg) was dissolved in 1 mL of saline, vortexed to mix for 3 min, and then centrifuged at 4 °C for 3 min to separate the microbial supernatant. After 2 weeks of antibiotic cocktail treatment, microbiota-eliminated mice were given 200 μL of the microbial supernatant by oral gavage for another 2 weeks, donor (CON) and donor (Ex-60) group (n = 8);
- To investigate the effects of combined intervention (DHM and exercise), 3 groups of mice (n = 8) were randomly assigned, sedentary (CON), 60 min swimming training (EXE), 60 min swimming training plus DHM treatment (EXE + DHM). Swimming training was carried out according to experiment 1. DHM was orally given once a day for four weeks at a dose of 100 mg/kg body weight per feeding. The EXE + DHM mice received DHM intragastric administration for 2 weeks, and CON and EXE mice received the same volume of solvent (saline). Then, EXE and EXE + DHM mice underwent swimming training for another 2 weeks, while the gavage intervention remained the same as the first 2 weeks. DHM (purity ≥ 98%) was purchased from Must Bio-Technology Co., Ltd. (Chengdu, China).
2.2. Determination of GLP-1 Concentrations
2.3. Histological Analysis
- Immunohistochemistry After being dehydrated and embedded in paraffin, fresh colon samples were fixed in 4% paraformaldehyde. Immunohistochemistry was done following the manufacturer’s protocol. Approximately 5 μm-thick slices were cut and incubated with antibodies against GLP-1 (Servicebio, 1:500) at room temperature for two hours. The secondary antibody used was enhanced goat anti-mouse IgG polymer. The DAB chromogen substrate was added next. The slices were counterstained with Haematoxylin and allowed to air dry before visualizing;
- Immunofluorescence Tissue sections of colon samples were prepared following the immunohistochemistry procedure. Approximately 5 μm-thick slices were cut and incubated with antibodies against GLP-1 (Servicebio, 1:500) overnight at 4 °C and DAPI for 30 min at room temperature. The slices were then incubated with appropriate conjugated secondary antibodies for 20 min. After the removal of unbound secondary antibodies by washing them in phosphate-buffered saline, imaging was performed.
2.4. Fecal Specimen DNA Extraction
2.5. Microbiome 16S rRNA Sequencing
2.6. Measurement of SCFAs by GC-MS
2.7. Cell Culture
2.8. Assessment of Cell Viability by Cell Counting Kit-8 (CCK8)
2.9. Measurement of DPP-4 Content and Activity
2.10. Measurement of Second Messengers (Ca2+, cAMP, IP3)
2.11. Real-Time PCR
2.12. Data Processing
3. Results
3.1. Effects of Swimming Training on GLP-1 Secretion
3.2. Effects of Swimming Training on Gut Microbiota
3.3. Effects of Swimming Training on Short-Chain Fatty Acid Profiles in Fecal
3.4. Gut Microbiota Is Essential for Exercise-Induced GLP-1 Secretion
3.5. Dihydromyricetin Changes the Composition of Gut Microbiota in Exercised Mice
3.6. Dihydromyricetin Interacts Synergistically with Exercise Intervention to Enhance GLP-1 Levels
3.7. Dihydromyricetin Stimulates GLP-1 Release and Reduces GLP-1 Degradation In Vivo and In Vitro
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kraus, W.E.; Bittner, V.; Appel, L.; Blair, S.N.; Church, T.; Després, J.P.; Franklin, B.A.; Miller, T.D.; Pate, R.R.; Taylor-Piliae, R.E.; et al. The National Physical Activity Plan: A call to action from the American Heart Association: A science advisory from the American Heart Association. Circulation 2015, 131, 1932–1940. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baggio, L.L.; Drucker, D.J. Biology of incretins: GLP-1 and GIP. Gastroenterology 2007, 132, 2131–2157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sandoval, D.A.; D’Alessio, D.A. Physiology of proglucagon peptides: Role of glucagon and GLP-1 in health and disease. Physiol. Rev. 2015, 95, 513–548. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martins, C.; Morgan, L.; Truby, H. A review of the effects of exercise on appetite regulation: An obesity perspective. Int. J. Obes. 2008, 32, 1337–1347. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Unick, J.L.; Otto, A.D.; Goodpaster, B.H.; Helsel, D.L.; Pellegrini, C.A.; Jakicic, J.M. Acute effect of walking on energy intake in overweight/obese women. Appetite 2010, 55, 413–419. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schubert, M.M.; Desbrow, B.; Sabapathy, S.; Leveritt, M. Acute exercise and subsequent energy intake. A meta-analysis. Appetite 2013, 63, 92–104. [Google Scholar] [CrossRef] [Scilit]
- Holliday, A.; Blannin, A. Appetite, food intake and gut hormone responses to intense aerobic exercise of different duration. J. Endocrinol. 2017, 235, 193–205. [Google Scholar] [CrossRef] [Scilit]
- Broom, D.R.; Stensel, D.J.; Bishop, N.C.; Burns, S.F.; Miyashita, M. Exercise-induced suppression of acylated ghrelin in humans. J. Appl. Physiol. 2007, 102, 2165–2171. [Google Scholar] [CrossRef] [Scilit]
- Ellingsgaard, H.; Hauselmann, I.; Schuler, B.; Habib, A.M.; Baggio, L.L.; Meier, D.T.; Eppler, E.; Bouzakri, K.; Wueest, S.; Muller, Y.D.; et al. Interleukin-6 enhances insulin secretion by increasing glucagon-like peptide-1 secretion from L cells and alpha cells. Nat. Med. 2011, 17, 1481–1489. [Google Scholar] [CrossRef] [Scilit]
- Wueest, S.; Laesser, C.I.; Böni-Schnetzler, M.; Item, F.; Lucchini, F.C.; Borsigova, M.; Donath, M.Y.; Konrad, D. IL-6-Type Cytokine Signaling in Adipocytes Induces Intestinal GLP-1 Secretion. Diabetes 2018, 67, 36–45. [Google Scholar] [CrossRef] [Scilit]
- Thursby, E.; Juge, N. Introduction to the human gut microbiota. Biochem. J. 2017, 474, 1823–1836. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- David, L.A.; Maurice, C.F.; Carmody, R.N.; Gootenberg, D.B.; Button, J.E.; Wolfe, B.E.; Ling, A.V.; Devlin, A.S.; Varma, Y.; Fischbach, M.A.; et al. Diet rapidly and reproducibly alters the human gut microbiome. Nature 2014, 505, 559–563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dominguez-Bello, M.G.; Costello, E.K.; Contreras, M.; Magris, M.; Hidalgo, G.; Fierer, N.; Knight, R. Delivery mode shapes the acquisition and structure of the initial microbiota across multiple body habitats in newborns. Proc. Natl. Acad. Sci. USA 2010, 107, 11971–11975. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Das, B.; Nair, G.B. Homeostasis and dysbiosis of the gut microbiome in health and disease. J. Biosci. 2019, 44, 117. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Scheiman, J.; Luber, J.M.; Chavkin, T.A.; MacDonald, T.; Tung, A.; Pham, L.D.; Wibowo, M.C.; Wurth, R.C.; Punthambaker, S.; Tierney, B.T.; et al. Meta-omics analysis of elite athletes identifies a performance-enhancing microbe that functions via lactate metabolism. Nat. Med. 2019, 25, 1104–1109. [Google Scholar] [CrossRef] [Scilit]
- Petersen, L.M.; Bautista, E.J.; Nguyen, H.; Hanson, B.M.; Chen, L.; Lek, S.H.; Sodergren, E.; Weinstock, G.M. Community characteristics of the gut microbiomes of competitive cyclists. Microbiome 2017, 5, 98. [Google Scholar] [CrossRef] [Scilit]
- Yoon, H.S.; Cho, C.H.; Yun, M.S.; Jang, S.J.; You, H.J.; Kim, J.H.; Han, D.; Cha, K.H.; Moon, S.H.; Lee, K.; et al. Akkermansia muciniphila secretes a glucagon-like peptide-1-inducing protein that improves glucose homeostasis and ameliorates metabolic disease in mice. Nat. Microbiol. 2021, 6, 563–573. [Google Scholar] [CrossRef] [Scilit]
- Allen, J.M.; Mailing, L.J.; Niemiro, G.M.; Moore, R.; Cook, M.D.; White, B.A.; Holscher, H.D.; Woods, J.A. Exercise Alters Gut Microbiota Composition and Function in Lean and Obese Humans. Med. Sci. Sports Exerc. 2018, 50, 747–757. [Google Scholar] [CrossRef] [Scilit]
- Psichas, A.; Sleeth, M.L.; Murphy, K.G.; Brooks, L.; Bewick, G.A.; Hanyaloglu, A.C.; Ghatei, M.A.; Bloom, S.R.; Frost, G. The short chain fatty acid propionate stimulates GLP-1 and PYY secretion via free fatty acid receptor 2 in rodents. Int. J. Obes. 2015, 39, 424–429. [Google Scholar] [CrossRef] [Scilit]
- Lalitha, N.; Sadashivaiah, B.; Ramaprasad, T.R.; Singh, S.A. Anti-hyperglycemic activity of myricetin, through inhibition of DPP-4 and enhanced GLP-1 levels, is attenuated by co-ingestion with lectin-rich protein. PLoS ONE 2020, 15, e0231543. [Google Scholar]
- Yao, Y.; Chen, S.; Li, H. An Improved System to Evaluate Superoxide-Scavenging Effects of Bioflavonoids. ChemistryOpen 2021, 10, 503–514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hira, T.; Trakooncharoenvit, A.; Taguchi, H.; Hara, H. Improvement of Glucose Tolerance by Food Factors Having Glucagon-Like Peptide-1 Releasing Activity. Int. J. Mol. Sci. 2021, 22, 6623. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, Q.; Gu, Y.; Lang, H.; Wang, X.; Chen, K.; Gong, X.; Zhou, M.; Ran, L.; Zhu, J.; Mi, M. Dihydromyricetin prevents obesity-induced slow-twitch-fiber reduction partially via FLCN/FNIP1/AMPK pathway. Biochim. Biophys. Acta Mol. Basis Dis. 2017, 1863, 1282–1291. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Drucker, D.J. Dipeptidyl peptidase-4 inhibition and the treatment of type 2 diabetes: Preclinical biology and mechanisms of action. Diabetes Care 2007, 30, 1335–1343. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martins, C.; Kulseng, B.; King, N.A.; Holst, J.J.; Blundell, J.E. The effects of exercise-induced weight loss on appetite-related peptides and motivation to eat. J. Clin. Endocrinol. Metab. 2010, 95, 1609–1616. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ueda, S.Y.; Yoshikawa, T.; Katsura, Y.; Usui, T.; Nakao, H.; Fujimoto, S. Changes in gut hormone levels and negative energy balance during aerobic exercise in obese young males. J. Endocrinol. 2009, 201, 151–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adam, T.C.; Westerterp-Plantenga, M.S. Activity-induced GLP-1 release in lean and obese subjects. Physiol. Behav. 2004, 83, 459–466. [Google Scholar] [CrossRef] [Scilit]
- Martins, C.; Morgan, L.M.; Bloom, S.R.; Robertson, M.D. Effects of exercise on gut peptides, energy intake and appetite. J. Endocrinol. 2007, 193, 251–258. [Google Scholar] [CrossRef] [Scilit]
- Chanoine, J.P.; Mackelvie, K.J.; Barr, S.I.; Wong, A.C.; Meneilly, G.S.; Elahi, D.H. GLP-1 and appetite responses to a meal in lean and overweight adolescents following exercise. Obesity 2008, 16, 202–204. [Google Scholar] [CrossRef] [Scilit]
- Steensberg, A.; van Hall, G.; Osada, T.; Sacchetti, M.; Saltin, B.; Klarlund Pedersen, B. Production of interleukin-6 in contracting human skeletal muscles can account for the exercise-induced increase in plasma interleukin-6. J. Physiol. 2000, 529 Pt 1, 237–242. [Google Scholar] [CrossRef] [Scilit]
- Allen, J.M.; Mailing, L.J.; Cohrs, J.; Salmonson, C.; Fryer, J.D.; Nehra, V.; Hale, V.L.; Kashyap, P.; White, B.A.; Woods, J.A. Exercise training-induced modification of the gut microbiota persists after microbiota colonization and attenuates the response to chemically-induced colitis in gnotobiotic mice. Gut Microbes 2018, 9, 115–130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hermes, G.D.; Zoetendal, E.G.; Smidt, H. Molecular ecological tools to decipher the role of our microbial mass in obesity. Benef. Microbes 2015, 6, 61–81. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cosme, F.; Inês, A.; Vilela, A. Consumer’s acceptability and health consciousness of probiotic and prebiotic of non-dairy products. Food Res. Int. 2022, 151, 110842. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- den Besten, G.; van Eunen, K.; Groen, A.K.; Venema, K.; Reijngoud, D.J.; Bakker, B.M. The role of short-chain fatty acids in the interplay between diet, gut microbiota, and host energy metabolism. J. Lipid Res. 2013, 54, 2325–2340. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Polansky, O.; Sekelova, Z.; Faldynova, M.; Sebkova, A.; Sisak, F.; Rychlik, I. Important Metabolic Pathways and Biological Processes Expressed by Chicken Cecal Microbiota. Appl. Environ. Microbiol. 2015, 82, 1569–1576. [Google Scholar] [CrossRef] [Scilit]
- Ghislain, J.; Poitout, V. Targeting lipid GPCRs to treat type 2 diabetes mellitus-progress and challenges. Nat. Rev. Endocrinol. 2021, 17, 162–175. [Google Scholar] [CrossRef] [Scilit]
- Tolhurst, G.; Heffron, H.; Lam, Y.S.; Parker, H.E.; Habib, A.M.; Diakogiannaki, E.; Cameron, J.; Grosse, J.; Reimann, F.; Gribble, F.M. Short-chain fatty acids stimulate glucagon-like peptide-1 secretion via the G-protein-coupled receptor FFAR2. Diabetes 2012, 61, 364–371. [Google Scholar] [CrossRef] [Scilit]
- Petersen, N.; Reimann, F.; Bartfeld, S.; Farin, H.F.; Ringnalda, F.C.; Vries, R.G.; van den Brink, S.; Clevers, H.; Gribble, F.M.; de Koning, E.J. Generation of L cells in mouse and human small intestine organoids. Diabetes 2014, 63, 410–420. [Google Scholar] [CrossRef] [Scilit]
- Gribble, F.M.; Reimann, F. Enteroendocrine Cells: Chemosensors in the Intestinal Epithelium. Annu. Rev. Physiol. 2016, 78, 277–299. [Google Scholar] [CrossRef] [Scilit]
- Brubaker, P.L.; Schloos, J.; Drucker, D.J. Regulation of glucagon-like peptide-1 synthesis and secretion in the GLUTag enteroendocrine cell line. Endocrinology 1998, 139, 4108–4114. [Google Scholar] [CrossRef]
- Kieffer, T.J.; McIntosh, C.H.; Pederson, R.A. Degradation of glucose-dependent insulinotropic polypeptide and truncated glucagon-like peptide 1 in vitro and in vivo by dipeptidyl peptidase IV. Endocrinology 1995, 136, 3585–3596. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, L.; Yin, X.; Wang, X.; Li, X. Determination of dihydromyricetin in rat plasma by LC-MS/MS and its application to a pharmacokinetic study. Pharm. Biol. 2017, 55, 657–662. [Google Scholar] [CrossRef] [Scilit]
- Song, Y.; Sun, L.; Ma, P.; Xu, L.; Xiao, P. Dihydromyricetin prevents obesity via regulating bile acid metabolism associated with the farnesoid X receptor in ob/ob mice. Food Funct. 2022, 13, 2491–2503. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, S.; Zhu, M.; Wang, K.; Zhao, X.; Hu, L.; Jing, W.; Lu, H.; Wang, S. Dihydromyricetin improves DSS-induced colitis in mice via modulation of fecal-bacteria-related bile acid metabolism. Pharmacol. Res. 2021, 171, 105767. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, L.; Zhao, X.; Tong, Q.; Zhou, X.; Chen, J.; Xiong, W.; Fang, J.; Wang, W.; Shi, C. Interactions of Dihydromyricetin, a Flavonoid from Vine Tea (Ampelopsis grossedentata) with Gut Microbiota. J. Food Sci. 2018, 83, 1444–1453. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murakami, T.; Miyakoshi, M.; Araho, D.; Mizutani, K.; Kambara, T.; Ikeda, T.; Chou, W.H.; Inukai, M.; Takenaka, A.; Igarashi, K. Hepatoprotective activity of tocha, the stems and leaves of Ampelopsis grossedentata, and ampelopsin. Biofactors 2004, 21, 175–178. [Google Scholar] [CrossRef] [Scilit]
- Shen, Y.; Lindemeyer, A.K.; Gonzalez, C.; Shao, X.M.; Spigelman, I.; Olsen, R.W.; Liang, J. Dihydromyricetin as a novel anti-alcohol intoxication medication. J. Neurosci. 2012, 32, 390–401. [Google Scholar] [CrossRef] [Scilit]
- Blad, C.C.; Tang, C.; Offermanns, S. G protein-coupled receptors for energy metabolites as new therapeutic targets. Nat. Rev. Drug. Discov. 2012, 11, 603–619. [Google Scholar] [CrossRef] [Scilit]
- Wu, C.; Jeong, M.Y.; Kim, J.Y.; Lee, G.; Kim, J.S.; Cheong, Y.E.; Kang, H.; Cho, C.H.; Kim, J.; Park, M.K.; et al. Activation of ectopic olfactory receptor 544 induces GLP-1 secretion and regulates gut inflammation. Gut Microbes 2021, 13, 1987782. [Google Scholar] [CrossRef] [Scilit]








| Gene | Primer Sequence | |
|---|---|---|
| Gcg | Forward: TTACTTTGTGGCTGGATTGCTT | Reverse: AGTGGCGTTTGTCTTCATTCA |
| DPP-4 | Forward: CCAATTCCAGAAGACAACCTTG | Reverse: CATCTGCCGTTCCATGAATAAG |
| ND1 | Forward: GACGGGGTCCCAAAAAGAAAA | Reverse: GCCAAGCGCAGTGTCTCTATT |
| Arx | Forward: GGCCGGAGTGCAAGAGTAAAT | Reverse: TGCATGGCTTTTTCCTGGTCA |
| Foxa1 | Forward: ACATTCAAGCGCAGCTACCC | Reverse: TGCTGGTTCTGGCGGTAATAG |
| Foxa2 | Forward: CATGGGACCTCACCTGAGTC | Reverse: CATCGAGTTCATGTTGGCGTA |
| Ngn3 | Forward: GCATGCACAACCTCAACTC | Reverse: TTTGTAAGTTTGGCGTCATC |
| Actb | Forward: GGCTGTATTCCCCTCCATCG | Reverse: CCAGTTGGTAACAATGCCATGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, L.; Zhou, M.; Xie, Y.; Lang, H.; Li, T.; Yi, L.; Zhang, Q.; Mi, M. Dihydromyricetin Enhances Exercise-Induced GLP-1 Elevation through Stimulating cAMP and Inhibiting DPP-4. Nutrients 2022, 14, 4583. https://doi.org/10.3390/nu14214583
Wu L, Zhou M, Xie Y, Lang H, Li T, Yi L, Zhang Q, Mi M. Dihydromyricetin Enhances Exercise-Induced GLP-1 Elevation through Stimulating cAMP and Inhibiting DPP-4. Nutrients. 2022; 14(21):4583. https://doi.org/10.3390/nu14214583
Chicago/Turabian StyleWu, Luting, Min Zhou, Yingquan Xie, Hedong Lang, Tianyou Li, Long Yi, Qianyong Zhang, and Mantian Mi. 2022. "Dihydromyricetin Enhances Exercise-Induced GLP-1 Elevation through Stimulating cAMP and Inhibiting DPP-4" Nutrients 14, no. 21: 4583. https://doi.org/10.3390/nu14214583
APA StyleWu, L., Zhou, M., Xie, Y., Lang, H., Li, T., Yi, L., Zhang, Q., & Mi, M. (2022). Dihydromyricetin Enhances Exercise-Induced GLP-1 Elevation through Stimulating cAMP and Inhibiting DPP-4. Nutrients, 14(21), 4583. https://doi.org/10.3390/nu14214583

