Radiation-Induced Dual Oxidase Upregulation in Rat Heart Tissues: Protective Effect of Melatonin
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design
2.2. Real-Time PCR
2.3. ELISA
2.4. Pathological Study
2.5. Statistical Analysis
2.6. Ethical Approval
3. Results
3.1. Real-Time PCR
3.2. ELISA
3.3. Histopathological Evaluation
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Eldabaje, R.; Le, D.L.; Huang, W.; Yang, L.X. Radiation-associated Cardiac Injury. Anticancer Res. 2015, 35, 2487–2492. [Google Scholar] [PubMed]
- Kamiya, K.; Ozasa, K.; Akiba, S.; Niwa, O.; Kodama, K.; Takamura, N.; Zaharieva, E.K.; Kimura, Y.; Wakeford, R. Long-term effects of radiation exposure on health. Lancet 2015, 386, 469–478. [Google Scholar] [CrossRef]
- Douple, E.B.; Mabuchi, K.; Cullings, H.M.; Preston, D.L.; Kodama, K.; Shimizu, Y.; Fujiwara, S.; Shore, R.E. Long-term radiation-related health effects in a unique human population: Lessons learned from the atomic bomb survivors of Hiroshima and Nagasaki. Disaster Med. Public Health Prep. 2011, 5 (Suppl. 1), S122–S133. [Google Scholar] [CrossRef] [PubMed]
- Sardaro, A.; Petruzzelli, M.F.; D’Errico, M.P.; Grimaldi, L.; Pili, G.; Portaluri, M. Radiation-induced cardiac damage in early left breast cancer patients: Risk factors, biological mechanisms, radiobiology, and dosimetric constraints. Radiother. Oncol. 2012, 103, 133–142. [Google Scholar] [CrossRef] [PubMed]
- Ghobadi, G.; van der Veen, S.; Bartelds, B.; de Boer, R.A.; Dickinson, M.G.; de Jong, J.R.; Faber, H.; Niemantsverdriet, M.; Brandenburg, S.; Berger, R.M.; et al. Physiological interaction of heart and lung in thoracic irradiation. Int. J. Radiat. Oncol. Biol. Phys. 2012, 84, e639–e646. [Google Scholar] [CrossRef] [PubMed]
- Spetz, J.; Moslehi, J.; Sarosiek, K. Radiation-induced cardiovascular toxicity: mechanisms, prevention, and treatment. Curr. Treat. Options Cardiovasc. Med. 2018, 20, 31. [Google Scholar] [CrossRef] [PubMed]
- Boerma, M.; Wang, J.; Wondergem, J.; Joseph, J.; Qiu, X.; Kennedy, R.H.; Hauer-Jensen, M. Influence of mast cells on structural and functional manifestations of radiation-induced heart disease. Cancer Res. 2005, 65, 3100–3107. [Google Scholar] [CrossRef] [PubMed]
- Robbins, M.E.; Zhao, W. Chronic oxidative stress and radiation-induced late normal tissue injury: A review. Int. J. Radiat. Biol. 2004, 80, 251–259. [Google Scholar] [CrossRef] [PubMed]
- Seddon, M.; Looi, Y.H.; Shah, A.M. Oxidative stress and redox signalling in cardiac hypertrophy and heart failure. Heart 2007, 93, 903–907. [Google Scholar] [CrossRef]
- Ameziane-El-Hassani, R.; Talbot, M.; Dos Santos, M.C.D.S.; Al Ghuzlan, A.; Hartl, D.; Bidart, J.M.; De Deken, X.; Miot, F.; Diallo, I.; de Vathaire, F.; et al. NADPH oxidase DUOX1 promotes long-term persistence of oxidative stress after an exposure to irradiation. Proc. Natl. Acad. Sci. USA 2015, 112, 5051–5056. [Google Scholar] [CrossRef]
- Di Maggio, F.M.; Minafra, L.; Forte, G.I.; Cammarata, F.P.; Lio, D.; Messa, C.; Gilardi, M.C.; Bravatà, V. Portrait of inflammatory response to ionizing radiation treatment. J. Inflamm. 2015, 12, 14. [Google Scholar] [CrossRef] [PubMed]
- Carvalho, D.P.; Dupuy, C. Role of the NADPH oxidases DUOX and NOX4 in thyroid oxidative stress. Eur. Thyr. J. 2013, 2, 160–167. [Google Scholar] [CrossRef] [PubMed]
- Amini, P.; Kolivand, S.; Saffar, H.; Rezapoor, S.; Motevaseli, E.; Najafi, M.; Nouruzi, F.; Shabeeb, D.; Musa, A.E. Protective effect of Selenium-L-methionine on radiation-induced acute pneumonitis and lung fibrosis in rat. Curr. Clin. Pharmacol. 2018. (Epub ahead of print). [Google Scholar] [CrossRef] [PubMed]
- Monceau, V.; Pasinetti, N.; Schupp, C.; Pouzoulet, F.; Opolon, P.; Vozenin, M.-C. Modulation of the Rho/ROCK pathway in heart and lung after thorax irradiation reveals targets to improve normal tissue toxicity. Curr. Drug Targets 2010, 11, 1395–1404. [Google Scholar] [CrossRef] [PubMed]
- Musa, A.E.; Shabeeb, D. Radiation-induced heart diseases: protective effects of natural products. Medicina 2019, 55, 126. [Google Scholar] [CrossRef] [PubMed]
- Mihandoost, E.; Shirazi, A.; Mahdavi, S.R.; Aliasgharzadeh, A. Can melatonin help us in radiation oncology treatments? BioMed Res. Int. 2014, 2014, 12. [Google Scholar] [CrossRef]
- Ataee, R.; Shokrzadeh, M.; Jafari-Sabet, M.; Nasrabadi Nasri, N.; Ataie, A.; Haghi Aminjan, H. The role of melatonin and melatonin receptors in pharmacology and pharmacotherapy of cancer. Austin Oncol. 2017, 2, 1015. [Google Scholar]
- Najafi, M.; Shirazi, A.; Motevaseli, E.; Geraily, G.; Norouzi, F.; Heidari, M.; Rezapoor, S. The melatonin immunomodulatory actions in radiotherapy. Biophys. Rev. 2017, 9, 139–148. [Google Scholar] [CrossRef]
- Farhood, B.; Goradel, N.H.; Mortezaee, K.; Khanlarkhani, N.; Salehi, E.; Nashtaei, M.S.; Mirtavoos-Mahyari, H.; Motevaseli, E.; Shabeeb, D.; Musa, A.E.; et al. Melatonin as an adjuvant in radiotherapy for radioprotection and radiosensitization. Clin. Transl. Oncol. 2019, 21, 268–279. [Google Scholar] [CrossRef]
- Bedini, A.; Fraternale, A.; Crinelli, R.; Mari, M.; Bartolucci, S.; Chiarantini, L.; Spadoni, G. Design, synthesis, and biological activity of hydrogen peroxide responsive arylboronate melatonin hybrids. Chem. Res. Toxicol. 2019, 32, 100–112. [Google Scholar] [CrossRef]
- Conlon, P.J.; Tyler, S.; Grabstein, K.H.; Morrissey, P. Interleukin-4 (B-cell stimulatory factor-1) augments the in vivo generation of cytotoxic cells in immunosuppressed animals. Biotechnol. Ther. 1989, 1, 31–41. [Google Scholar] [PubMed]
- Kioi, M.; Husain, S.R.; Croteau, D.; Kunwar, S.; Puri, R.K. Convection-enhanced delivery of interleukin-13 receptor-directed cytotoxin for malignant glioma therapy. Technol. Cancer Res. Treat. 2006, 5, 239–250. [Google Scholar] [CrossRef] [PubMed]
- Liang, L.; Hu, D.; Liu, W.; Williams, J.P.; Okunieff, P.; Ding, I. Celecoxib reduces skin damage after radiation: Selective reduction of chemokine and receptor mRNA expression in irradiated skin but not in irradiated mammary tumor. Am. J. Clin. Oncol. 2003, 26, S114–S121. [Google Scholar] [CrossRef] [PubMed]
- Dadrich, M.; Nicolay, N.H.; Flechsig, P.; Bickelhaupt, S.; Hoeltgen, L.; Roeder, F.; Hauser, K.; Tietz, A.; Jenne, J.; Lopez, R.; et al. Combined inhibition of TGFβ and PDGF signaling attenuates radiation-induced pulmonary fibrosis. Oncoimmunology 2016, 5, e1123366. [Google Scholar] [CrossRef] [PubMed]
- Groves, A.M.; Johnston, C.J.; Misra, R.S.; Williams, J.P.; Finkelstein, J.N. Effects of IL-4 on pulmonary fibrosis and the accumulation and phenotype of macrophage subpopulations following thoracic irradiation. Int. J. Radiat. Biol. 2016, 92, 754–765. [Google Scholar] [CrossRef] [PubMed]
- Esposito, E.; Cuzzocrea, S. Antiinflammatory activity of melatonin in central nervous system. Curr. Neuropharmacol. 2010, 8, 228–242. [Google Scholar] [CrossRef] [PubMed]
- Najafi, M.; Shirazi, A.; Motevaseli, E.; Geraily, G.; Amini, P.; Tooli, L.F.; Shabeeb, D. Melatonin modulates regulation of NOX2 and NOX4 following irradiation in the lung. Curr. Clin. Pharmacol. 2019. [Google Scholar] [CrossRef] [PubMed]
- Fernandez-Gil, B.; Moneim, A.E.; Ortiz, F.; Shen, Y.Q.; Soto-Mercado, V.; Mendivil-Perez, M.; Guerra-Librero, A.; Acuna-Castroviejo, D.; Molina-Navarro, M.M.; Garcia-Verdugo, J.M.; et al. Melatonin protects rats from radiotherapy-induced small intestine toxicity. PLoS ONE 2017, 12, e0174474. [Google Scholar] [CrossRef]
- Chen, Y.; Zhao, Q.; Sun, Y.; Jin, Y.; Zhang, J.; Wu, J. Melatonin induces anti-inflammatory effects via endoplasmic reticulum stress in RAW264.7 macrophages. Mol. Med. Rep. 2018, 17, 6122–6129. [Google Scholar] [CrossRef]
- Meziani, L.; Deutsch, E.; Mondini, M. Macrophages in radiation injury: A new therapeutic target. Oncoimmunology 2018, 7, e1494488. [Google Scholar] [CrossRef]
- Oishi, Y.; Manabe, I. Macrophages in age-related chronic inflammatory diseases. NPJ Aging Mech. Dis. 2016, 2, 16018. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Chen, X.; Liu, T.; Gong, Y.; Chen, S.; Pan, G.; Cui, W.; Luo, Z.P.; Pei, M.; Yang, H.; et al. Melatonin reverses H2 O2 -induced premature senescence in mesenchymal stem cells via the SIRT1-dependent pathway. J. Pineal Res. 2015, 59, 190–205. [Google Scholar] [CrossRef] [PubMed]
- Gurses, I.; Ozeren, M.; Serin, M.; Yucel, N.; Erkal, H.S. Histopathological efficiency of amifostine in radiation induced heart disease in rats. Bratisl. Lek Listy 2018, 119, 54–59. [Google Scholar] [CrossRef] [PubMed]
- Thorstad, W.L.; Chao, K.S.; Haughey, B. Toxicity and compliance of subcutaneous amifostine in patients undergoing postoperative intensity-modulated radiation therapy for head and neck cancer. Semin. Oncol. 2004, 31, 8–12. [Google Scholar] [CrossRef] [PubMed]
- Rezaeyan, A.; Haddadi, G.H.; Hosseinzadeh, M.; Moradi, M.; Najafi, M. Radioprotective effects of hesperidin on oxidative damages and histopathological changes induced by X-irradiation in rats heart tissue. J. Med. Phys. 2016, 41, 182–191. [Google Scholar]




| Gene | Forward Sequence | Reverse Sequence |
|---|---|---|
| IL-4r1 | GAGTGAGTGGAGTCCCAGCATC | GCTGAAGTAACAGGTCAGGC |
| Duox1 | AAGAAAGGAAGCATCAACACCC | ACCAGGGCAGTCAGGAAGAT |
| Duox2 | AGTCTCATTCCTCACCCGGA | GTAACACACACGATGTGGCG |
| PGM1 | CATGATTCTGGGCAAGCACG | GCCAGTTGGGGTCTCATACAAA |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Farhood, B.; Aliasgharzadeh, A.; Amini, P.; Saffar, H.; Motevaseli, E.; Rezapoor, S.; Nouruzi, F.; Shabeeb, D.; Eleojo Musa, A.; Ashabi, G.; et al. Radiation-Induced Dual Oxidase Upregulation in Rat Heart Tissues: Protective Effect of Melatonin. Medicina 2019, 55, 317. https://doi.org/10.3390/medicina55070317
Farhood B, Aliasgharzadeh A, Amini P, Saffar H, Motevaseli E, Rezapoor S, Nouruzi F, Shabeeb D, Eleojo Musa A, Ashabi G, et al. Radiation-Induced Dual Oxidase Upregulation in Rat Heart Tissues: Protective Effect of Melatonin. Medicina. 2019; 55(7):317. https://doi.org/10.3390/medicina55070317
Chicago/Turabian StyleFarhood, Bagher, Akbar Aliasgharzadeh, Peyman Amini, Hana Saffar, Elahe Motevaseli, Saeed Rezapoor, Farzad Nouruzi, Dheyauldeen Shabeeb, Ahmed Eleojo Musa, Ghorbangol Ashabi, and et al. 2019. "Radiation-Induced Dual Oxidase Upregulation in Rat Heart Tissues: Protective Effect of Melatonin" Medicina 55, no. 7: 317. https://doi.org/10.3390/medicina55070317
APA StyleFarhood, B., Aliasgharzadeh, A., Amini, P., Saffar, H., Motevaseli, E., Rezapoor, S., Nouruzi, F., Shabeeb, D., Eleojo Musa, A., Ashabi, G., Mohseni, M., Moradi, H., & Najafi, M. (2019). Radiation-Induced Dual Oxidase Upregulation in Rat Heart Tissues: Protective Effect of Melatonin. Medicina, 55(7), 317. https://doi.org/10.3390/medicina55070317

