Polymorphisms of ABCG2 and SLC22A12 Genes Associated with Gout Risk in Vietnamese Population
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Subjects
2.2. SNP Genotyping
2.3. Statistical Analyses
3. Results
3.1. Comparison of Clinical Characteristics between Gout Patient and Control Groups
3.2. Genetic Analysis of ABCG2 and SLC22A12 SNPs
3.3. Association of SNPs Genotypes and Clinical Characteristics among the Studied Population
3.4. Analysis of Genotype and Phenotype Correlation in ABCG2 rs12505410 among Gout Patients
4. Discussion
Limitations of the Study
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Ethical Approval
References
- Kuo, C.F.; Grainge, M.J.; Zhang, W.; Doherty, M. Global epidemiology of gout: Prevalence, incidence and risk factors. Nat. Rev. Rheumatol. 2015, 11, 649–662. [Google Scholar] [CrossRef] [PubMed]
- Minh Hoa, T.T.; Darmawan, J.; Chen, S.L.; Van Hung, N.; Thi Nhi, C.; Ngoc An, T. Prevalence of the rheumatic diseases in urban Vietnam: A WHO-ILAR COPCORD study. J. Rheumatol. 2003, 30, 2252–2256. [Google Scholar] [PubMed]
- Kottgen, A.; Albrecht, E.; Teumer, A.; Vitart, V.; Krumsiek, J.; Hundertmark, C.; Pistis, G.; Ruggiero, D.; O’Seaghdha, C.M.; Haller, T.; et al. Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. Nat. Genet. 2013, 45, 145–154. [Google Scholar] [CrossRef] [PubMed]
- Tin, A.; Woodward, O.M.; Kao, W.H.; Liu, C.T.; Lu, X.; Nalls, M.A.; Shriner, D.; Semmo, M.; Akylbekova, E.L.; Wyatt, S.B.; et al. Genome-wide association study for serum urate concentrations and gout among African Americans identifies genomic risk loci and a novel urat1 loss-of-function allele. Hum. Mol. Genet. 2011, 20, 4056–4068. [Google Scholar] [CrossRef]
- Doyle, L.A.; Yang, W.; Abruzzo, L.V.; Krogmann, T.; Gao, Y.; Rishi, A.K.; Ross, D.D. A multidrug resistance transporter from human mcf-7 breast cancer cells. Proc. Natl. Acad. Sci. USA 1998, 95, 15665–15670. [Google Scholar] [CrossRef] [PubMed]
- Saison, C.; Helias, V.; Ballif, B.A.; Peyrard, T.; Puy, H.; Miyazaki, T.; Perrot, S.; Vayssier-Taussat, M.; Waldner, M.; Le Pennec, P.Y.; et al. Null alleles of abcg2 encoding the breast cancer resistance protein define the new blood group system junior. Nat. Genet. 2012, 44, 174–177. [Google Scholar] [CrossRef] [PubMed]
- Woodward, O.M.; Kottgen, A.; Coresh, J.; Boerwinkle, E.; Guggino, W.B.; Kottgen, M. Identification of a urate transporter, abcg2, with a common functional polymorphism causing gout. Proc. Natl. Acad. Sci. USA 2009, 106, 10338–10342. [Google Scholar] [CrossRef]
- Matsuo, H.; Ichida, K.; Takada, T.; Nakayama, A.; Nakashima, H.; Nakamura, T.; Kawamura, Y.; Takada, Y.; Yamamoto, K.; Inoue, H.; et al. Common dysfunctional variants in abcg2 are a major cause of early-onset gout. Sci. Rep. 2013, 3, 2014. [Google Scholar] [CrossRef]
- Dehghan, A.; Kottgen, A.; Yang, Q.; Hwang, S.J.; Kao, W.L.; Rivadeneira, F.; Boerwinkle, E.; Levy, D.; Hofman, A.; Astor, B.C.; et al. Association of three genetic loci with uric acid concentration and risk of gout: A genome-wide association study. Lancet 2008, 372, 1953–1961. [Google Scholar] [CrossRef]
- Kolz, M.; Johnson, T.; Sanna, S.; Teumer, A.; Vitart, V.; Perola, M.; Mangino, M.; Albrecht, E.; Wallace, C.; Farrall, M.; et al. Meta-analysis of 28,141 individuals identifies common variants within five new loci that influence uric acid concentrations. PLoS Genet. 2009, 5, e1000504. [Google Scholar] [CrossRef]
- Matsuo, H.; Takada, T.; Ichida, K.; Nakamura, T.; Nakayama, A.; Ikebuchi, Y.; Ito, K.; Kusanagi, Y.; Chiba, T.; Tadokoro, S.; et al. Common defects of abcg2, a high-capacity urate exporter, cause gout: A function-based genetic analysis in a Japanese population. Sci. Transl. Med. 2009, 1, 5ra11. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Miao, Z.; Liu, S.; Wang, J.; Zhou, S.; Han, L.; Meng, D.; Wang, Y.; Li, C.; Ma, X. Genetic analysis of abcg2 gene c421a polymorphism with gout disease in Chinese Han male population. Hum. Genet. 2010, 127, 245–246. [Google Scholar] [CrossRef] [PubMed]
- Karns, R.; Zhang, G.; Sun, G.; Rao Indugula, S.; Cheng, H.; Havas-Augustin, D.; Novokmet, N.; Rudan, D.; Durakovic, Z.; Missoni, S.; et al. Genome-wide association of serum uric acid concentration: Replication of sequence variants in an island population of the Adriatic coast of Croatia. Ann. Hum. Genet. 2012, 76, 121–127. [Google Scholar] [CrossRef] [PubMed]
- Yang, Q.; Kottgen, A.; Dehghan, A.; Smith, A.V.; Glazer, N.L.; Chen, M.H.; Chasman, D.I.; Aspelund, T.; Eiriksdottir, G.; Harris, T.B.; et al. Multiple genetic loci influence serum urate levels and their relationship with gout and cardiovascular disease risk factors. Circ. Cardiovasc. Genet. 2010, 3, 523–530. [Google Scholar] [CrossRef] [PubMed]
- Enomoto, A.; Kimura, H.; Chairoungdua, A.; Shigeta, Y.; Jutabha, P.; Cha, S.H.; Hosoyamada, M.; Takeda, M.; Sekine, T.; Igarashi, T.; et al. Molecular identification of a renal urate anion exchanger that regulates blood urate levels. Nature 2002, 417, 447–452. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, M.; Itoh, K.; Matsushita, K.; Matsushita, K.; Wakita, N.; Adachi, M.; Nonoguchi, H.; Kitamura, K.; Hosoyamada, M.; Endou, H.; et al. Two male siblings with hereditary renal hypouricemia and exercise-induced arf. Am. J. Kidney Dis. 2003, 42, 1287–1292. [Google Scholar] [CrossRef]
- Ichida, K.; Hosoyamada, M.; Kamatani, N.; Kamitsuji, S.; Hisatome, I.; Shibasaki, T.; Hosoya, T. Age and origin of the g774a mutation in slc22a12 causing renal hypouricemia in Japanese. Clin. Genet. 2008, 74, 243–251. [Google Scholar] [CrossRef] [PubMed]
- Tu, H.P.; Chen, C.J.; Lee, C.H.; Tovosia, S.; Ko, A.M.; Wang, S.J.; Ou, T.T.; Lin, G.T.; Chiang, S.L.; Chiang, H.C.; et al. The slc22a12 gene is associated with gout in Han Chinese and Solomon islanders. Ann. Rheum. Dis. 2010, 69, 1252–1254. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Han, L.; Levin, A.M.; Song, H.; Yan, S.; Wang, Y.; Wang, Y.; Meng, D.; Lv, S.; Ji, Y.; et al. Multiple single nucleotide polymorphisms in the human urate transporter 1 (hurat1) gene are associated with hyperuricaemia in Han Chinese. J. Med. Genet. 2010, 47, 204–210. [Google Scholar] [CrossRef]
- Neogi, T.; Jansen, T.L.; Dalbeth, N.; Fransen, J.; Schumacher, H.R.; Berendsen, D.; Brown, M.; Choi, H.; Edwards, N.L.; Janssens, H.J.; et al. 2015 gout classification criteria: An American college of rheumatology/European league against rheumatism collaborative initiative. Arthritis Rheumatol. 2015, 67, 2557–2568. [Google Scholar] [CrossRef]
- Szumilas, M. Explaining odds ratios. J. Can. Acad Child. Adolesc. Psychiatry 2010, 19, 227–229. [Google Scholar] [PubMed]
- Doherty, M. New insights into the epidemiology of gout. Rheumatology (Oxford) 2009, 48 (Suppl. 2), ii2–ii8. [Google Scholar] [CrossRef] [PubMed]
- Singh, J.A.; Reddy, S.G.; Kundukulam, J. Risk factors for gout and prevention: A systematic review of the literature. Curr. Opin. Rheumatol. 2011, 23, 192–202. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Li, Z.; Liu, S.; Wang, C.; Han, L.; Cui, L.; Zhou, J.; Zou, H.; Liu, Z.; Chen, J.; et al. Genome-wide association analysis identifies three new risk loci for gout arthritis in Han Chinese. Nat. Commun. 2015, 6, 7041. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Matsuo, H.; Yamamoto, K.; Nakaoka, H.; Nakayama, A.; Sakiyama, M.; Chiba, T.; Takahashi, A.; Nakamura, T.; Nakashima, H.; Takada, Y.; et al. Genome-wide association study of clinically defined gout identifies multiple risk loci and its association with clinical subtypes. Ann. Rheum. Dis. 2016, 75, 652–659. [Google Scholar] [CrossRef] [PubMed]
- Khan, N.C.; Khoi, H.H. Double burden of malnutrition: The Vietnamese perspective. Asia Pac. J. Clin. Nutr. 2008, 17, 116–118. [Google Scholar] [PubMed]
- Son, L.N.T.; Kunii, D.; Hung, N.T.K.; Sakai, T.; Yamamoto, S. The metabolic syndrome: Prevalence and risk factors in the urban population of Ho Chi Minh city. Diabetes Res. Clin. Pract. 2005, 67, 243–250. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.S.; Kim, Y.; Park, G.; Kim, S.K.; Choe, J.Y.; Park, B.L.; Kim, H.S. Genetic analysis of abcg2 and slc2a9 gene polymorphisms in gouty arthritis in a Korean population. Korean J. Intern. Med. 2015, 30, 913–920. [Google Scholar] [CrossRef] [PubMed]
- Nakayama, A.; Nakaoka, H.; Yamamoto, K.; Sakiyama, M.; Shaukat, A.; Toyoda, Y.; Okada, Y.; Kamatani, Y.; Nakamura, T.; Takada, T.; et al. Gwas of clinically defined gout and subtypes identifies multiple susceptibility loci that include urate transporter genes. Ann. Rheum. Dis. 2017, 76, 869–877. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Miao, L.; Qin, L.; Xiang, Y.; Zhang, X.; Peng, H.; Mailamuguli; Sun, Y.; Yao, H. A meta-analysis of the associations between the q141k and q126x abcg2 gene variants and gout risk. Int. J. Clin. Exp. Pathol. 2015, 8, 9812–9823. [Google Scholar] [PubMed]
- Nakayama, A.; Matsuo, H.; Nakaoka, H.; Nakamura, T.; Nakashima, H.; Takada, Y.; Oikawa, Y.; Takada, T.; Sakiyama, M.; Shimizu, S.; et al. Common dysfunctional variants of abcg2 have stronger impact on hyperuricemia progression than typical environmental risk factors. Sci. Rep. 2014, 4, 5227. [Google Scholar] [CrossRef] [PubMed]
- Cheng, S.T.; Wu, S.; Su, C.W.; Teng, M.S.; Hsu, L.A.; Ko, Y.L. Association of abcg2 rs2231142-a allele and serum uric acid levels in male and obese individuals in a Han Taiwanese population. J. Formos Med. Assoc. 2017, 116, 18–23. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Zhou, Z.; Hou, X.; Lu, D.; Yuan, X.; Lu, J.; Wang, C.; Han, L.; Cui, L.; Liu, Z.; et al. Replication of gout/urate concentrations gwas susceptibility loci associated with gout in a Han Chinese population. Sci. Rep. 2017, 7, 4094. [Google Scholar] [CrossRef] [PubMed]
- Yu, K.H.; Chang, P.Y.; Chang, S.C.; Wu-Chou, Y.H.; Wu, L.A.; Chen, D.P.; Lo, F.S.; Lu, J.J. A comprehensive analysis of the association of common variants of abcg2 with gout. Sci. Rep. 2017, 7, 9988. [Google Scholar] [CrossRef] [PubMed]
- Campa, D.; Pardini, B.; Naccarati, A.; Vodickova, L.; Novotny, J.; Forsti, A.; Hemminki, K.; Barale, R.; Vodicka, P.; Canzian, F. A gene-wide investigation on polymorphisms in the abcg2/brcp transporter and susceptibility to colorectal cancer. Mutat. Res. 2008, 645, 56–60. [Google Scholar] [CrossRef] [PubMed]
- Delord, M.; Rousselot, P.; Cayuela, J.M.; Sigaux, F.; Guilhot, J.; Preudhomme, C.; Guilhot, F.; Loiseau, P.; Raffoux, E.; Geromin, D.; et al. High imatinib dose overcomes insufficient response associated with abcg2 haplotype in chronic myelogenous leukemia patients. Oncotarget 2013, 4, 1582–1591. [Google Scholar] [CrossRef]
- Wakida, N.; Tuyen, D.G.; Adachi, M.; Miyoshi, T.; Nonoguchi, H.; Oka, T.; Ueda, O.; Tazawa, M.; Kurihara, S.; Yoneta, Y.; et al. Mutations in human urate transporter 1 gene in presecretory reabsorption defect type of familial renal hypouricemia. J. Clin. Endocrinol. Metab. 2005, 90, 2169–2174. [Google Scholar] [CrossRef]
- Iwai, N.; Mino, Y.; Hosoyamada, M.; Tago, N.; Kokubo, Y.; Endou, H. A high prevalence of renal hypouricemia caused by inactive slc22a12 in japanese. Kidney Int. 2004, 66, 935–944. [Google Scholar] [CrossRef]
- Graessler, J.; Graessler, A.; Unger, S.; Kopprasch, S.; Tausche, A.K.; Kuhlisch, E.; Schroeder, H.E. Association of the human urate transporter 1 with reduced renal uric acid excretion and hyperuricemia in a German Caucasian population. Arthritis Rheum. 2006, 54, 292–300. [Google Scholar] [CrossRef]
- Torres, R.J.; de Miguel, E.; Bailen, R.; Banegas, J.R.; Puig, J.G. Tubular urate transporter gene polymorphisms differentiate patients with gout who have normal and decreased urinary uric acid excretion. J. Rheumatol. 2014, 41, 1863–1870. [Google Scholar] [CrossRef]
PCR Primer Sequence | |||
---|---|---|---|
Gene/SNP | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Fragment Size (bp) |
ABCG2/rs72552713 | AGCTGCAAGGAAAGATCCAA | GGGTAAGTGCTTTGGCTGAT | 166 |
ABCG2/rs12505410 | CCCTTGGCACCTTAAATGAA | ATAGGTGGCTGGCCCTATTT | 308 |
SLC22A12/rs11231825 | CCCTAGAGGTCACCAGACCA | ACTGGGCCATGGGCTTCTGATC | 168 |
SLC22A12/rs7932775 | GCCTGAAAGTCAGGGACAAG | ACCACACAAGAGGGAGATGC | 325 |
Gene/SNP | Sequencing Primer (5′-3′) | ||
ABCG2/rs72552713 | AGCTGCAAGGAAAGATCCAA | ||
ABCG2/rs12505410 | CCCTTGGCACCTTAAATGAA | ||
SLC22A12/rs11231825 | CCCTAGAGGTCACCAGACCA | ||
SLC22A12/rs7932775 | GCCTGAAAGTCAGGGACAAG |
Characteristics | Controls (n = 351) | Gout Patients (n = 170) | Total (n = 521) | p-Value |
---|---|---|---|---|
Age | 52 (13) | 52 (20) | 52 (15) | 0.469 (2) |
Height (cm) | 165 (8) | 165 (9.3) | 165 (9) | 0.697 (2) |
Weight (kg) | 66 (11) | 67 (13) | 66 (12) | 0.026 (2) |
BMI (kg/m2) | 24.11 (4.4) | 24.78 (3.83) | 24.31 (4.14) | 0.038 (2) |
SUA (mg/dL) | 6.9 (1.98) | 9.25 (2.18) | 7.61 (2.66) | <0.001 (2) |
ALT (U/L) | 26.4 (18.8) | 26.05 (21.52) | 26.2 (18.95) | 0.567 (2) |
AST (U/L) | 23.1 (9.1) | 23.1 (11.2) | 23.1 (9.95) | 0.354 (2) |
BUN (mg/dL) | 21.4 (6.1) | 22.52 (10.07) | 21.93 (7.9) | 0.053 (2) |
CREA (mg/dL) | 1.06 (0.17) | 1.07 (0.16) | 1.06 (0.17) | 0.722 (2) |
CRP (mg/dL) | 1.56 (4.34) | 3.53 (6.7) | 2.02 (5.24) | <0.001 (2) |
Diastolic BP (mmHg) | 70 (10) | 70 (10) | 70 (10) | 0.533 (2) |
Systolic BP (mmHg) | 120 (20) | 120 (20) | 120 (20) | 0.84 (2) |
GLU (mg/dL) | 101 (13) | 103 (15.75) | 101 (14) | 0.145 (2) |
HDL-C (mg/dL) | 45.6 (16) | 43.75 (19.12) | 44.6 (16.6) | 0.204 (2) |
LDL-C (mg/dL) | 120.8 (53.8) | 126 (56.65) | 122.3 (53.9) | 0.04 (2) |
Hyperuricemia * | 166 (47.3%) | 157 (92.4%) | 323 (62%) | <0.001 (1) |
TG (mg/dL) | 169.2 (133.4) | 231.2 (164.85) | 189.2 (142.35) | 0.001 (2) |
WBC (per µL) | 7300 (2550) | 7110 (2477.5) | 7260 (2540) | 0.778 (2) |
Gene/SNP | Position | Type of Variant | Allele | MAF in Gout Group | HWE in Gout Group (p) | MAF in Control Group | HWE in Control Group (p) | HWE in all Population (p) |
---|---|---|---|---|---|---|---|---|
ABCG2/rs72552713 | 4:88131805 | Stop gained | C/T | 0.029 | 0.925 | 0.001 | 1.000 | 0.97 |
ABCG2/rs12505410 | 4:88109689 | Intron | T/G | 0.403 | 0.374 | 0.385 | 1.000 | 0.708 |
SLC22A12/rs11231825 | 11:64592802 | Synonymous | T/C | 0.224 | 0.304 | 0.288 | 0.438 | 0.914 |
SLC22A12/rs7932775 | 11:64600390 | Missense | C/T | 0.418 | 0.03 | 0.487 | 0.074 | 0.003 |
SNP/Gene | Test model | Controls (n = 351) | Gout patients (n = 170) | OR | 95% CI | p-Value |
---|---|---|---|---|---|---|
rs72552713 | Dominant | |||||
(ABCG2) | CC | 350 (99.7%) | 160 (94.1%) | 1.00 | ||
CT | 1 (0.3%) | 10 (5.9%) | 21.875 | 2.77–172.34 | <0.001 (1) | |
Alleles | ||||||
C | 701 (99.86%) | 330 (97.06%) | 1.00 | |||
T | 1 (0.14%) | 10 (2.94%) | 21.19 | 3.00–918.96 | <0.001 (1) | |
rs12505410 | Additive | 0.458 (2) | ||||
(ABCG2) | TT | 133 (37.9%) | 66 (38.8%) | 1.00 | ||
TG | 167 (47.6%) | 73 (42.9%) | 0.881 | 0.588–1.319 | 0.538 (2) | |
GG | 51 (14.5%) | 31 (18.2%) | 1.225 | 0.717–2.092 | 0.457 (2) | |
Dominant | ||||||
TT | 133 (37.9%) | 66 (38.8%) | 1.00 | |||
TG + GG | 218 (62.1%) | 104 (61.2%) | 0.961 | 0.66–1.401 | 0.837 (2) | |
Recessive | ||||||
TT + TG | 300 (85.5%) | 139 (81.8%) | 1.00 | |||
GG | 51 (14.5%) | 31 (18.2%) | 1.312 | 0.804–2.141 | 0.276 (2) | |
Alleles | ||||||
T | 433 (61.7%) | 205 (60.3%) | 1.00 | |||
G | 269 (38.3%) | 135 (39.7%) | 1.06 | 0.805–1.393 | 0.684 (2) | |
rs11231825 | Additive | 0.021 (2) | ||||
(SLC22A12) | TT | 183 (52.1%) | 99 (58.2%) | 1.00 | ||
TC | 134 (38.2%) | 66 (38.8%) | 0.91 | 0.621–1.335 | 0.631 (2) | |
CC | 34 (9.7%) | 5 (2.9%) | 0.272 | 0.103–0.717 | 0.005 (2) | |
Dominant | ||||||
TT | 183 (52.1%) | 99 (58.2%) | 1.00 | |||
TC + CC | 168 (47.9%) | 71 (41.8%) | 0.781 | 0.54–1.131 | 0.19 (2) | |
Recessive | ||||||
TT + TC | 317 (90.3%) | 165 (97.1%) | 1.00 | |||
CC | 34 (9.7%) | 5 (2.9%) | 0.283 | 0.108–0.736 | 0.006 (2) | |
Alleles | ||||||
T | 500 (71.2%) | 264 (77.6%) | 1.00 | |||
C | 202 (28.8%) | 76 (22.4%) | 0.712 | 0.526–0.964 | 0.0302 (2) |
SNP/Gene | Test Model | Genotype | Uric Acid | Hyperuricemia | ||
---|---|---|---|---|---|---|
Median (Interquartile Range) | p-Value (1) | Positive n (%) | p-Value (2) | |||
rs72552713 | Dominant | 0.004 | 0.008 | |||
(ABCG2) | CC | 7.57 (2.65) | 311 (61%) | |||
CT | 9.2 (2.28) | 11 (100%) | ||||
rs12505410 | Additive | 0.131 | 0.791 | |||
(ABCG2) | TT | 7.66 (2.77) | 126 (63.6%) | |||
TG | 7.65 (2.67) | 147 (61.5%) | ||||
GG | 7.45 (2.47) | 50 (59.5%) | ||||
Dominant | 0.105 | 0.546 | ||||
TT | 7.66 (2.77) | 126 (63.6%) | ||||
TG + GG | 7.58 (2.65) | 197 (61%) | ||||
Recessive | 0.092 | 0.61 | ||||
TT + TG | 7.65 (2.47) | 273 (62.5%) | ||||
GG | 7.45 (2.47) | 50 (59.5%) | ||||
rs11231825 | Additive | 0.057 | 0.178 | |||
(SLC22A12) | TT | 7.6 (2.7) | 175 (62.1%) | |||
TC | 7.7 (2.6) | 129 (64.5%) | ||||
CC | 7.0 (2.6) | 19 (48.7%) | ||||
Dominant | 0.647 | 0.975 | ||||
TT | 7.6 (2.7) | 175 (62.1%) | ||||
TC + CC | 7.61 (2.73) | 148 (61.9%) | ||||
Recessive | 0.018 | 0.076 | ||||
TT + TC | 7.69 (2.66) | 304 (63.1%) | ||||
CC | 7.0 (2.6) | 19 (48.7%) |
rs12505410 | Genotype | p-Value Additive (TT/TG/GG) | p-Value Dominant (TT/TG + GG) | p-Value Recessive (TT + TG/GG) | ||
---|---|---|---|---|---|---|
TT (n = 65) | TG (n = 73) | GG (n = 32) | ||||
CREA (mg/dL) | 1.04 (0.26) | 1.07 (0.17) | 1.1 (0.12) | 0.444 | 0.291 | 0.289 |
CRP (mg/dL) | 3.67 (5.8) | 3.45 (6.2) | 3.68 (7.9) | 0.661 | 0.992 | 0.398 |
Diastolic BP (mmHg) | 70 (10) | 80 (10) | 70 (10) | 0.385 | 0.262 | 0.749 |
SUA (mg/dL) | 9.54 (2.38) | 9.62 (2.12) | 8.5 (1.48) | 0.011 | 0.23 | 0.003 |
Systolic BP (mmHg) | 120 (20) | 120 (20) | 110 (17.5) | 0.064 | 0.707 | 0.045 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Thuy Duong, N.; Thy Ngoc, N.; Tran Minh Thang, N.; Thi Hoai Phuong, B.; Thanh Nga, N.; Doan Tinh, N.; Hai Quynh, D.; Dang Ton, N.; Van Hai, N. Polymorphisms of ABCG2 and SLC22A12 Genes Associated with Gout Risk in Vietnamese Population. Medicina 2019, 55, 8. https://doi.org/10.3390/medicina55010008
Thuy Duong N, Thy Ngoc N, Tran Minh Thang N, Thi Hoai Phuong B, Thanh Nga N, Doan Tinh N, Hai Quynh D, Dang Ton N, Van Hai N. Polymorphisms of ABCG2 and SLC22A12 Genes Associated with Gout Risk in Vietnamese Population. Medicina. 2019; 55(1):8. https://doi.org/10.3390/medicina55010008
Chicago/Turabian StyleThuy Duong, Nguyen, Nguyen Thy Ngoc, Nguyen Tran Minh Thang, Bach Thi Hoai Phuong, Nguyen Thanh Nga, Nguyen Doan Tinh, Do Hai Quynh, Nguyen Dang Ton, and Nong Van Hai. 2019. "Polymorphisms of ABCG2 and SLC22A12 Genes Associated with Gout Risk in Vietnamese Population" Medicina 55, no. 1: 8. https://doi.org/10.3390/medicina55010008
APA StyleThuy Duong, N., Thy Ngoc, N., Tran Minh Thang, N., Thi Hoai Phuong, B., Thanh Nga, N., Doan Tinh, N., Hai Quynh, D., Dang Ton, N., & Van Hai, N. (2019). Polymorphisms of ABCG2 and SLC22A12 Genes Associated with Gout Risk in Vietnamese Population. Medicina, 55(1), 8. https://doi.org/10.3390/medicina55010008