Molecular Characterization, Expression Analysis, and CRISPR/Cas9 Mediated Gene Disruption of Myogenic Regulatory Factor 4 (MRF4) in Nile Tilapia
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Fish and Husbandry
2.2. Identifying Myogenic Regulatory Factor 4 (MRF4), Bioinformatic, and Expression Analysis
2.2.1. Identification of Myogenic Regulatory Factor 4 (MRF4) Gene in Nile Tilapia
2.2.2. Tissue Collection for Gene Cloning
2.2.3. Total RNA Extraction and cDNA Synthesis
2.2.4. Cloning of Full-Length Nile Tilapia MRF4 (NT-MRF4) cDNA
2.2.5. Bioinformatic Analysis of the NT-MRF4
Analysis of General Sequence Features
Multiple Sequence Alignment
Phylogenetic Analysis
Synteny Analysis
Structural Model Prediction of NT-MRF4 Protein
Prediction of Subcellular Localization
Protein–Protein Interaction Network Analysis
2.2.6. Quantitative Real-Time PCR (qRT-PCR) Analysis of NT-MRF4 mRNA
Tissue Sample Collection, Total RNA Extraction, and cDNA Synthesis
qRT-PCR Analysis
2.3. CRISPR/Cas9 Knockout of NT-MRF4 Gene in Nile Tilapia
2.3.1. Design and Preparation of Single-Guide RNAs and Cas9 Protein
2.3.2. Artificial Fertilization and Preparation of One-Cell Embryos
2.3.3. Preparation of sgRNA and Cas9 Complex and Microinjection
2.3.4. Mutation Analysis in Cas9/sgRNA Microinjected Offsprings
2.3.5. Downstream Gene Expression Analysis in NT-MRF4 Gene-Edited Nile Tilapia
Tissue Sample Collection, Total RNA Extraction, and cDNA Synthesis
qRT-PCR Analysis
2.4. Statistical Analysis
3. Results
3.1. General Features and Domains of NT-MRF4
3.2. Multiple Sequence Alignment and Identity Index of NT-MRF4
3.3. Phylogenetic Analysis
3.4. Evolutionary Synteny Analysis of NT-MRF4
3.5. The Two- and Three-Dimensional Structure of NT-MRF4
3.6. Subcellular Localization of NT-MRF4
3.7. Gene Ontology (GO) Analysis of NT-MRF4
3.8. Prediction of the Functional Protein–Protein Interaction Network of NT-MRF4
3.9. Relative mRNA Expression of NT-MRF4 in Different Experimental Tissues
3.10. Generation of NT-MRF4 Mutant Progeny Using CRISPR/Cas9 and Mutation Analysis
3.11. Change in mRNA Expressions of NT-MRF4 and Interacting Growth-Related Genes in WT and GE Nile Tilapia
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hernández-Hernández, J.M.; García-González, E.G.; Brun, C.E.; Rudnicki, M.A. The myogenic regulatory factors, determinants of muscle development, cell identity and regeneration. Semin. Cell Dev. Biol. 2017, 72, 10–18. [Google Scholar] [CrossRef] [PubMed]
- Davis, R.L.; Weintraub, H.; Lassar, A.B. Expression of a single transfected cDNA converts fibroblasts to myoblasts. Cell 1987, 51, 987–1000. [Google Scholar] [CrossRef] [PubMed]
- Wright, W.E.; Sassoon, D.A.; Lin, V.K. Myogenin, a factor regulating myogenesis, has a domain homologous to MyoD. Cell 1989, 56, 607–617. [Google Scholar] [CrossRef] [PubMed]
- Braun, T.; Buschhausen-Denker, G.; Bober, E.; Tannich, E.; Arnold, H.H. A novel human muscle factor related to but distinct from MyoD1 induces myogenic conversion in 10T1/2 fibroblasts. EMBO J. 1989, 8, 701–709. [Google Scholar] [CrossRef] [PubMed]
- Rhodes, S.J.; Konieczny, S.F. Identification of MRF4: A new member of the muscle regulatory factor gene family. Genes Dev. 1989, 3, 2050–2561. [Google Scholar] [CrossRef]
- Lassar, A.B.; Davis, R.L.; Wright, W.E.; Kadesch, T.; Murre, C.; Voronova, A.; Baltimore, D.; Weintraub, H. Functional activity of myogenic HLH proteins requires hetero-oligomerization with E12/E47-like proteins in vivo. Cell 1991, 66, 305–315. [Google Scholar] [CrossRef]
- Zhu, X.; Li, Y.L.; Liu, L.; Wang, J.H.; Li, H.H.; Wu, P.; Chu, W.Y.; Zhang, J.S. Molecular characterization of Myf5 and comparative expression patterns of myogenic regulatory factors in Siniperca chuatsi. Gene Expr. Patterns 2016, 20, 1–10. [Google Scholar] [CrossRef]
- Mommsen, T.P. Paradigms of growth in fish. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2001, 129, 207–219. [Google Scholar] [CrossRef]
- Johnston, I.A.; Bower, N.I.; Macqueen, D.J. Growth and the regulation of myotomal muscle mass in teleost fish. J. Exp. Biol. 2011, 214, 1617–1628. [Google Scholar] [CrossRef]
- Pin, C.L.; Konieczny, S.F. A fast fiber enhancer exists in the muscle regulatory factor 4 gene promoter. Biochem. Biophys. Res. Commun. 2002, 299, 7–13. [Google Scholar] [CrossRef]
- Voytik, S.L.; Przyborski, M.; Badylak, S.F.; Konieczny, S.F. Differential expression of muscle regulatory factor genes in normal and denervated adult rat hindlimb muscles. Dev. Dyn. 1993, 198, 214–224. [Google Scholar] [CrossRef] [PubMed]
- Aase-Remedios, M.E.; Coll-Lladó, C.; Ferrier, D.E.K. More Than One-to-Four via 2R: Evidence of an Independent Amphioxus Expansion and Two-Gene Ancestral Vertebrate State for MyoD-Related Myogenic Regulatory Factors (MRFs). Mol. Biol. Evol. 2020, 37, 2966–2982. [Google Scholar] [CrossRef] [PubMed]
- Moretti, I.; Ciciliot, S.; Dyar, K.A.; Abraham, R.; Murgia, M.; Agatea, L.; Akimoto, T.; Bicciato, S.; Forcato, M.; Pierre, P.; et al. MRF4 negatively regulates adult skeletal muscle growth by repressing MEF2 activity. Nat. Commun. 2016, 7, 12397. [Google Scholar] [CrossRef] [PubMed]
- Hinits, Y.; Osborn, D.P.; Carvajal, J.J.; Rigby, P.W.; Hughes, S.M. Mrf4 (myf6) is dynamically expressed in differentiated zebrafish skeletal muscle. Gene Expr. Patterns 2007, 7, 738–745. [Google Scholar] [CrossRef] [PubMed]
- Shi, B.; Sun, R.; Liu, X.; Zhang, Z.; Xu, Y.; Jiang, Y.; Wang, B. Molecular cloning, characterization and expression profile of Myf5 and Myf6 during growth and development in the Seriola lalandi. J. Ocean Univ. China 2021, 20, 1597–1605. [Google Scholar] [CrossRef]
- Rajesh, M.; Kamalam, B.S.; Ciji, A.; Akhtar, M.S.; Pandey, N.; Gupta, S.; Sarma, D.; Sahu, N.P.; Singh, A.K. Molecular characterisation and transcriptional regulation of muscle growth regulatory factors myogenin and myogenic factor 6 in the Trans-Himalayan cyprinid fish Schizothorax richardsonii. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2019, 231, 188–200. [Google Scholar] [CrossRef]
- Lin, Y.; Zhou, J.; Li, R.; Wang, S. MRF gene family in Schizothorax prenanti: Molecular cloning, tissue expression, and mRNA expression in muscle development. Turk. J. Fish. Aquat. Sci. 2016, 16, 461–467. [Google Scholar] [CrossRef]
- Lazure, F.; Blackburn, D.M.; Corchado, A.H.; Sahinyan, K.; Karam, N.; Sharanek, A.; Nguyen, D.; Lepper, C.; Najafabadi, H.S.; Perkins, T.J.; et al. Myf6/MRF4 is a myogenic niche regulator required for the maintenance of the muscle stem cell pool. EMBO Rep. 2020, 21, e49499. [Google Scholar] [CrossRef]
- Rawls, A.; Valdez, M.R.; Zhang, W.; Richardson, J.; Klein, W.H.; Olson, E.N. Overlapping functions of the myogenic bHLH genes MRF4 and MyoD revealed in double mutant mice. Development 1998, 125, 2349–2358. [Google Scholar] [CrossRef]
- Li, M.; Dai, S.; Liu, X.; Xiao, H.; Wang, D. A detailed procedure for CRISPR/Cas9-mediated gene editing in tilapia. Hydrobiologia 2021, 848, 3865–3881. [Google Scholar] [CrossRef]
- Zhang, Y.; Lu, Y.; Xu, F.; Zhang, X.; Wu, Y.; Zhao, J.; Luo, Q.; Liu, H.; Chen, K.; Fei, S.; et al. Molecular characterization, expression pattern, DNA methylation and gene disruption of Figla in blotched snakehead (Channa maculata). Animals 2024, 14, 491. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Wei, M.; Liu, Y.; Fang, Z.; Zhang, Y.; Yang, L.; Lv, H.; Wang, Y.; Ji, J.; Zhang, X.; et al. Functional characterization of BoGL5 by an efficient CRISPR/Cas9 genome editing system in broccoli. Sci. Hortic. 2023, 319, 112136. [Google Scholar] [CrossRef]
- Yan, Q.; Li, W.; Gong, X.; Hu, R.; Chen, L. Transcriptomic and phenotypic analysis of CRISPR/Cas9-mediated gluk2 knockout in zebrafish. Genes 2022, 13, 1441. [Google Scholar] [CrossRef] [PubMed]
- Singh, P.; Ali, S.A. Impact of CRISPR-Cas9-Based genome engineering in farm animals. Vet. Sci. 2021, 8, 122. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Lee, J.Y. Compensatory responses of Nile tilapia Oreochromis niloticus under different feed-deprivation regimes. Fish. Aquat. Sci. 2012, 15, 305–311. [Google Scholar] [CrossRef]
- Awad, A.; Mohammady, E.Y.; Soaudy, M.R.; Rabetimarghezar, N.; El-Haroun, E.R.; Hassaan, M.S. Growth and physiological response of Nile tilapia (Oreochromis niloticus) fed a fermented mixture of plant protein sources. Anim. Feed Sci. Technol. 2024, 315, 116034. [Google Scholar] [CrossRef]
- Gur, G.; Bonfil, D.; Safarian, H.; Naor, Z.; Yaron, Z. GnRH signaling pathways regulate differentially the tilapia gonadotropin subunit genes. Mol. Cell. Endocrinol. 2002, 189, 125–134. [Google Scholar] [CrossRef]
- Wang, L.; Sun, F.; Yang, Z.; Lee, M.; Yeo, S.; Wong, J.; Wen, Y.; Yue, G.H. Mapping the genetic basis for sex determination and growth in hybrid tilapia (Oreochromis mossambicus × O. niloticus). Aquaculture 2024, 593, 741310. [Google Scholar] [CrossRef]
- Abd El-Hack, M.E.; El-Saadony, M.T.; Nader, M.M.; Salem, H.M.; El-Tahan, A.M.; Soliman, S.M.; Khafaga, A.F. Effect of environmental factors on growth performance of Nile tilapia (Oreochromis niloticus). Int. J. Biometeorol. 2022, 66, 2183–2194. [Google Scholar] [CrossRef]
- Ikeda, Y.; Fukushima, R.; Tange, K.; Motomura, H.; Saito, T.; Jinno, M. Growth acceleration of Nile tilapia at 21 to 31 weeks of age with plasma-treated air-supplied water. Free Radic. Res. 2023, 57, 21–29. [Google Scholar] [CrossRef]
- Yáñez, J.M.; Joshi, R.; Yoshida, G.M. Genomics to accelerate genetic improvement in tilapia. Anim. Genet. 2020, 51, 658–674. [Google Scholar] [CrossRef] [PubMed]
- Barreto, R.E.; Moreira, P.S.; Carvalho, R.F. Sex-specific compensatory growth in food-deprived Nile tilapia. Braz. J. Med. Biol. Res. 2003, 36, 477–483. [Google Scholar] [CrossRef]
- Sukhan, Z.P.; Hossen, S.; Cho, Y.; Lee, W.K.; Kho, K.H. Molecular and structural analysis of Hdh-MIRP3 and its impact on reproductive regulation in female Pacific abalone, Haliotis discus hannai. Int. J. Biol. Macromol. 2024, 263, 130352. [Google Scholar] [CrossRef]
- Nguyen, N.T.T.; Vincens, P.; Dufayard, J.F.; Roest Crollius, H.; Louis, A. Genomicus in 2022: Comparative tools for thousands of genomes and reconstructed ancestors. Nucleic Acids Res. 2022, 50, D1025–D1031. [Google Scholar] [CrossRef] [PubMed]
- Sukhan, Z.P.; Hossen, S.; Cho, Y.; Lee, W.K.; Kho, K.H. Hdh-Tektin-4 regulates motility of fresh and cryopreserved sperm in Pacific abalone, Haliotis discus hannai. Front. Cell Dev. Biol. 2022, 10, 870743. [Google Scholar] [CrossRef] [PubMed]
- Zammit, P.S. Function of the myogenic regulatory factors Myf5, MyoD, Myogenin and MRF4 in skeletal muscle, satellite cells and regenerative myogenesis. Semin. Cell Dev. Biol. 2017, 72, 19–32. [Google Scholar] [CrossRef]
- Hughes, S.M.; Taylor, J.M.; Tapscott, S.J.; Gurley, C.M.; Carter, W.J.; Peterson, C.A. Selective accumulation of MyoD and myogenin mRNAs in fast and slow adult skeletal muscle is controlled by innervation and hormones. Development 1993, 118, 1137–1147. [Google Scholar] [CrossRef]
- Weintraub, H. The MyoD family and myogenesis: Redundancy, networks, and thresholds. Cell 1993, 75, 1241–1244. [Google Scholar] [CrossRef]
- Watabe, S. Myogenic regulatory factors and muscle differentiation during ontogeny in fish. J. Fish Biol. 1999, 55, 1–18. [Google Scholar] [CrossRef]
- Codina, M.; Bian, Y.H.; Gutiérrez, J.; Du, S.J. Cloning and characterization of myogenin from seabream (Sparus aurata) and analysis of promoter muscle specificity. Comp. Biochem. Physiol. D Genom. Proteom. 2008, 3, 128–139. [Google Scholar] [CrossRef]
- Atchley, W.R.; Fitch, W.M.; Bronner-Fraser, M. Molecular evolution of the MyoD family of transcription factors. Proc. Natl. Acad. Sci. USA 1994, 91, 11522–11526. [Google Scholar] [CrossRef] [PubMed]
- Tan, X.; Xu, P.; Zhang, Y.; Zhang, P.J. Olive flounder (Paralichthys olivaceus) myogenic regulatory factor 4 and its muscle-specific promoter activity. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2019, 236, 110310. [Google Scholar] [CrossRef] [PubMed]
- Zhu, C.; Gi, G.; Tao, Z.; Song, C.; Zhu, W.; Song, W.; Li, H. Development of skeletal muscle and expression of myogenic regulatory factors during embryonic development in Jinding ducks (Anas platyrhynchos domestica). Poult. Sci. 2014, 93, 1211–1216. [Google Scholar] [CrossRef] [PubMed]
- Jennings, C.G. Expression of the myogenic gene MRF4 during Xenopus development. Dev. Biol. 1992, 151, 319–332. [Google Scholar] [CrossRef]
- Wu, X.Y.; Lai, J.S.; Chen, Y.Y.; Liu, Y.; Song, M.J.; Li, F.Y.; Shi, Q.C.; Gong, Q. Characterization of MRF genes and their tissue distributions and analysis of the effects of starvation and refeeding on the expression of these genes in Acipenser dabryanus muscle. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2021, 256, 110648. [Google Scholar] [CrossRef]
- Becker, C.; Della Gaspera, B.; Guyot, M.; Donsez, E.; Armand, A.S.; Charbonnier, F.; Launay, T.; Chanoine, C. Expression of MRF4 protein in adult and in regenerating muscles in Xenopus. Dev. Dyn. 2003, 227, 445–449. [Google Scholar] [CrossRef]
- Tao, B.; Tan, J.; Chen, L.; Xu, Y.; Liao, X.; Li, Y.; Chen, J.; Song, Y.; Hu, W. CRISPR/Cas9 system-based myostatin-targeted disruption promotes somatic growth and adipogenesis in loach, Misgurnus anguillicaudatus. Aquaculture 2021, 544, 737097. [Google Scholar] [CrossRef]
- Potthoff, M.J.; Olson, E.N. MEF2: A central regulator of diverse developmental programs. Development 2007, 134, 4131–4140. [Google Scholar] [CrossRef]
- Edmondson, D.G.; Cheng, T.C.; Cserjesi, P.; Chakraborty, T.; Olson, E.N. Analysis of the myogenin promoter reveals an indirect pathway for positive autoregulation mediated by the muscle-specific enhancer factor MEF-2. Mol. Cell. Biol. 1992, 12, 3665–3677. [Google Scholar] [CrossRef]
- Molkentin, J.D.; Black, B.L.; Martin, J.F.; Olson, E.N. Cooperative activation of muscle gene expression by MEF2 and myogenic bHLH proteins. Cell 1995, 83, 1125–1136. [Google Scholar] [CrossRef]
- Hinterberger, T.J.; Sassoon, D.A.; Rhodes, S.J.; Konieczny, S.F. Expression of the muscle regulatory factor MRF4 during somite and skeletal myofiber development. Dev. Biol. 1991, 147, 144–156. [Google Scholar] [CrossRef] [PubMed]
- Arnold, H.H.; Winter, B. Muscle differentiation: More complexity to the network of myogenic regulators. Curr. Opin. Genet. Dev. 1998, 8, 539–544. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Sequence (5′—3′) | Purpose |
---|---|---|
MRF4-Fw | GTACAATGGCAATGACAGCTC | RT-PCR |
MRF4-Rv | CACTGGCTCCTTCTGTGCA | |
NT-MRF4-5′RACE | GATTACGCCAAGCTTCTCTCCCCACCGGACGGGACATTATC | RACE PCR |
NT-MRF4-3′RACE | GATTACGCCAAGCTTCAACCTCCGCTGACCATTCCACTTCAG | |
NT-MRF4-Fw | TGGCAATGACAGCCCACTG | qRT-PCR |
NT-MRF4-Rv | CTTACGTCTATCCGTGGGAG | |
NT-EF1a-Fw | GGTGTGAAGCAGCTCATCG | |
NT-EF1a-Rv | CACTGGTCTCCAGCATGTTG |
Primer Name | Sequence (5′—3′) | Accession No. | Purpose |
---|---|---|---|
sgRNA1 | CACGATAATGTCCCGTCCGGTGG | NM_001282891 | CRISPR/Cas9 target site |
sgRNA2 | CGAGGGTCAGTGCCTCATGTGGG | ||
MRF4-Mut-Fw | TTGCGCTATCTGGAGGAAGC | Mutation analysis | |
MRF4-Mut-Rv | CTCCTGCAGCCTCTCTATGT |
Primer Name | Sequence (5′—3′) | Accession No. | Length (bp) |
---|---|---|---|
MRF4-Fw | TGGCAATGACAGCCCACTG | PQ497691 | 178 |
MRF4-Rv | CTTACGTCTATCCGTGGGAG | ||
MyoG-Fw | TGTTGGAGTTGGAGTGACAG | GU246725 | 171 |
MyoG-Rv | CGTCTCTTCTCCCTCAGTGT | ||
MRF5-Fw | TCCAGTACATCGAGAGCCTG | XM_005456634 | 172 |
MRF5-Rv | CCGTTGCTGTAGTTTGCATTC | ||
MyoD-Fw | CAAGAGGAAGACGACCAACG | GU246715 | 170 |
MyoD-Rv | CGATGTAGCTGATGGCGTTG | ||
MEF2a-Fw | TCATGGACGAAAGGAACAGG | XM_025908678 | 170 |
MEF2a-Rv | CAGCAACACTTTGTCCATGTC | ||
MEF2b-Fw | GACCAGAGAAATAGACAGGTG | XM_005478988 | 160 |
MEF2b-Rv | GAACTTTGTCCATGTCTGTGC | ||
MEF2c-Fw | AGATCACGCGGATTATGGATG | XR_003213332 | 173 |
MEF2c-Rv | CTTGTCCATGTCTGTGCTGG | ||
MEF2d-Fw | CAGAGGATCACTGACGAACG | XM_025911272 | 171 |
MEF2d-Rv | GACCTTGTCCATGTCAGTGC | ||
EF1a-Fw | GGTGTGAAGCAGCTCATCG | AB075952 | 187 |
EF1a-Rv | CACTGGTCTCCAGCATGTTG |
Characteristics | Values | Amino Acid (aa) Composition | |||
---|---|---|---|---|---|
aa | No. | % | |||
Number of amino acids | 222 | Alanine | (A) | 20 | 8.9 |
Molecular weight (kDa) | 24.91 | Arginine | (R) | 14 | 6.2 |
Theoretical isoelectric point (pI) | 5.83 | Asparagine | (N) | 12 | 5.3 |
Total number of negatively charged residues (Asp + Glu) | 32 | Aspartic acid | (D) | 13 | 5.8 |
Cysteine | (C) | 6 | 2.7 | ||
Total number of positively charged residues (Arg + Lys) | 27 | Glutamine | (Q) | 8 | 3.6 |
Glutamic acid | (E) | 19 | 8.4 | ||
Atomic composition: | Glycine | (G) | 11 | 4.9 | |
Carbon (C) | 1063 | Histidine | (H) | 7 | 3.1 |
Hydrogen (H) | 1697 | Isoleucine | (I) | 7 | 3.1 |
Nitrogen (N) | 317 | Leucine | (L) | 22 | 9.8 |
Oxygen (O) | 353 | Lysine | (K) | 13 | 5.8 |
Sulfur (S) | 11 | Methionine | (M) | 5 | 2.2 |
Formula | C1063H1697N317O353S11 | Phenylalanine | (F) | 3 | 1.3 |
Total number of atoms | 3441 | Proline | (P) | 12 | 5.3 |
Estimated half-life (Mammalian reticulocytes, in vitro) | 30 h | Serine | (S) | 27 | 12.0 |
Threonine | (T) | 11 | 4.9 | ||
Instability index (II) | 64.1 | Tryptophan | (W) | 3 | 1.3 |
Aliphatic index | 68.18 | Tyrosine | (Y) | 5 | 2.2 |
Grand average of hydropathicity | −0.741 | Valine | (V) | 7 | 3.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sukhan, Z.P.; Cho, Y.; Hossen, S.; Cho, D.H.; Kho, K.H. Molecular Characterization, Expression Analysis, and CRISPR/Cas9 Mediated Gene Disruption of Myogenic Regulatory Factor 4 (MRF4) in Nile Tilapia. Curr. Issues Mol. Biol. 2024, 46, 13725-13745. https://doi.org/10.3390/cimb46120820
Sukhan ZP, Cho Y, Hossen S, Cho DH, Kho KH. Molecular Characterization, Expression Analysis, and CRISPR/Cas9 Mediated Gene Disruption of Myogenic Regulatory Factor 4 (MRF4) in Nile Tilapia. Current Issues in Molecular Biology. 2024; 46(12):13725-13745. https://doi.org/10.3390/cimb46120820
Chicago/Turabian StyleSukhan, Zahid Parvez, Yusin Cho, Shaharior Hossen, Doo Hyun Cho, and Kang Hee Kho. 2024. "Molecular Characterization, Expression Analysis, and CRISPR/Cas9 Mediated Gene Disruption of Myogenic Regulatory Factor 4 (MRF4) in Nile Tilapia" Current Issues in Molecular Biology 46, no. 12: 13725-13745. https://doi.org/10.3390/cimb46120820
APA StyleSukhan, Z. P., Cho, Y., Hossen, S., Cho, D. H., & Kho, K. H. (2024). Molecular Characterization, Expression Analysis, and CRISPR/Cas9 Mediated Gene Disruption of Myogenic Regulatory Factor 4 (MRF4) in Nile Tilapia. Current Issues in Molecular Biology, 46(12), 13725-13745. https://doi.org/10.3390/cimb46120820