Exploring the Anti-Osteoporotic Effects of n-Hexane Fraction from Cotoneaster wilsonii Nakai: Activation of Runx2 and Osteoblast Differentiation In Vivo
Abstract
1. Introduction
2. Results
2.1. Stimulation of Osteoblastic Differentiation with the C. wilsonii n-Hexane Fraction
2.2. Suppression of Post-Menopausal Osteoporosis in Ovariectomized Mice by the C. wilsonii n-Hexane Fraction
2.3. Identification and Contents of Compounds in CWH and Its Osteoblastic Differentiation Effect
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Extraction and Isolation of Compounds 1−4 from C. wilsonill HPLC Analysis
4.3. MC3T3-E1 Mouse Pre-Osteoblast Cell Culture
4.4. Alkaline Phosphatase Activity
4.5. Western Blotting and RT-PCR
4.6. Animal Experiment
4.7. Mouse Osteoblast Primary Cell Culture
4.8. Micro-Computed Tomography Plant Materials
4.9. Hematoxylin–Eosin Staining (H&E) and Immunohistochemistry (IHC)
4.10. Serum Parameters
4.11. HPLC Analysis of n-Hexane Fraction from C. wilsonii
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bliuc, D.; Alarkawi, D.; Nguyen, T.V.; Eisman, J.A.; Center, J.R. Risk of subsequent fractures and mortality in elderly women and men with fragility fractures with and without osteoporotic bone density: The Dubbo Osteoporosis Epidemiology Study. J. Bone. Miner. Res. 2015, 30, 637–646. [Google Scholar] [CrossRef]
- Lin, J.T.; Lane, J.M. Osteoporosis: A Review. Clin. Orthop. Relat. Res. 2004, 425, 126–134. [Google Scholar] [CrossRef]
- Van den Bergh, J.P.; van Geel, T.A.; Geusens, P.P. Osteoporosis, frailty and fracture: Implications for case finding and therapy. Nat. Rev. Rheumatol. 2012, 8, 163–172. [Google Scholar] [CrossRef]
- Kendler, D.L.; Cosman, F.; Stad, R.K.; Ferrari, S. Denosumab in the treatment of osteoporosis: 10 years later: A narrative review. Adv. Ther. 2022, 39, 58–74. [Google Scholar] [CrossRef]
- Skjødt, M.K.; Frost, M.; Abrahamsen, B. Side effects of drugs for osteoporosis and metastatic bone disease. Br. J. Clin. Pharmacol. 2019, 85, 1063–1071. [Google Scholar] [CrossRef] [PubMed]
- Martiniakova, M.; Babikova, M.; Omelka, R. Pharmacological agents and natural compounds: Available treatments for osteoporosis. J. Physiol. Pharmacol. 2020, 71, 307–320. [Google Scholar]
- Gao, Y.; Patil, S.; Jia, J. Development of molecular biology of osteoporosis. Int. J. Mol. Sci. 2021, 22, 8182. [Google Scholar] [CrossRef]
- BMP signaling is required for RUNX2-dependent induction of the osteoblast phenotype. J. Bone Miner. Res. 2006, 21, 637–646. [CrossRef]
- Chen, G.; Deng, C.; Li, Y.-P. TGF-β and BMP signaling in osteoblast differentiation and bone formation. Int. J. Biol. Sci. 2012, 8, 272. [Google Scholar] [CrossRef]
- Kim, J.H.; Liu, X.; Wang, J.; Chen, X.; Zhang, H.; Kim, S.H.; Cui, J.; Li, R.; Zhang, W.; Kong, Y.; et al. Wnt signaling in bone formation and its therapeutic potential for bone diseases. Ther. Adv. Musculoskelet. Dis. 2013, 5, 13–31. [Google Scholar] [CrossRef] [PubMed]
- Hofbauer, L.C.; Kuhne, C.A.; Viereck, V. The OPG/RANKL/RANK system in metabolic bone diseases. J. Musculoskelet. Neuronal Interact. 2004, 4, 268. [Google Scholar]
- Zha, L.; He, L.; Liang, Y.; Qin, H.; Yu, B.; Chang, L.; Xue, L. TNF-α contributes to postmenopausal osteoporosis by synergistically promoting RANKL-induced osteoclast formation. Biomed. Pharmacother. 2018, 102, 369–374. [Google Scholar] [CrossRef]
- Henriksen, K.; Bollerslev, J.; Everts, V.; Karsdal, M.A. Osteoclast activity and subtypes as a function of physiology and pathology—Implications for future treatments of osteoporosis. Endocr. Rev. 2011, 32, 31–63. [Google Scholar] [CrossRef]
- Henriksen, K.; Tanko, L.B.; Qvist, P.; Delmas, P.D.; Christiansen, C.; Karsdal, M.A. Assessment of osteoclast number and function: Application in the development of new and improved treatment modalities for bone diseases. Osteoporos. Int. 2007, 18, 681–685. [Google Scholar] [CrossRef] [PubMed]
- Pereira, J.V.; Modesto-Filho, J.; de FAgra, M.; Barbosa-Filho, J.M. Plant and plant-derived compounds employed in prevention of the osteoporosis. Acta Farm. Bonaer. 2002, 21, 223–234. [Google Scholar]
- Hong, S.; Cha, K.H.; Hye Park, J.; Choi, J.H.; Yoo, G.; Nho, C.W. Cinnamic acid suppresses bone loss via induction of osteoblast differentiation with alteration of gut microbiota. J. Nutr. Biochem. 2022, 101, 108900. [Google Scholar] [CrossRef]
- Hong, S.; Cha, K.H.; Son, Y.J.; Kim, S.M.; Choi, J.H.; Yoo, G.; Nho, C.W. Agastache rugosa ethanol extract suppresses bone loss via induction of osteoblast differentiation with alteration of gut microbiota. Phytomedicine 2021, 84, 153517. [Google Scholar] [CrossRef] [PubMed]
- Chang, C.S.; Jeon, J.I. Leaf flavonoids in Cotoneaster wilsonii (Rosaceae) from the island Ulleung-do, Korea. Biochem. Syst. Ecol. 2003, 31, 171–179. [Google Scholar] [CrossRef]
- Yoo, N.H.; Kim, H.K.; Lee, C.O.; Park, J.H.; Kim, M.J. Comparison of anti-oxidant and anti-inflammatory activities of methanolic extracts obtained from different parts of Cotoneaster wilsonii Nakai. Korean J. Med. Crop Sci. 2019, 27, 194–201. [Google Scholar] [CrossRef]
- Yoo, N.H.; Kim, H.K.; Song, J.M.; Lee, C.O.; Park, J.H.; Park, B.J.; Choi, Y.B.; Baek, Y.S.; Hwang, Y.J.; Kim, M.J. Biological Activities and Separation of Active Substance of Extract and Fractions from Cotoneaster wilsonii Nakai Leaf. Korean J. Med. Crop Sci. 2019, 27, 412–418. [Google Scholar] [CrossRef]
- Vimalraj, S.; Arumugam, B.; Miranda, P.J.; Selvamurugan, N. Runx2: Structure, function, and phosphorylation in osteoblast differentiation. Int. J. Biol. Macromol. 2015, 78, 202–208. [Google Scholar] [CrossRef]
- Liu, T.M.; Lee, E.H. Transcriptional regulatory cascades in Runx2-dependent osteogenic differentiation. Tissue Eng. Part B Rev. 2013, 19, 254–263. [Google Scholar] [CrossRef]
- Karsenty, G. Update on the roles of Runx2 in skeletal biology. J. Bone Miner. Res. 2019, 34, 795–804. [Google Scholar]
- Dirckx, N.; Van Hul, M.; Maes, C. Osteoblast recruitment to sites of bone formation in skeletal development, homeostasis, and regeneration. Birth Defects Res. Part C Embryo Today Rev. 2013, 99, 170–191. [Google Scholar]
- Reffitt, D.M.; Ogston, N.; Jugdaohsingh, R.; Cheung, H.F.J.; Evans, B.A.J.; Thompson, R.P.H.; Powell, J.J.; Hampson, G.N. Orthosilicic acid stimulates collagen type 1 synthesis and osteoblastic differentiation in human osteoblast-like cells in vitro. Bone 2003, 32, 127–135. [Google Scholar] [CrossRef] [PubMed]
- Guo, X.; Wang, X.F. Signaling cross-talk between TGF-β/BMP and other pathways. Cell Res. 2009, 19, 71–88. [Google Scholar] [CrossRef]
- Glass, D.A., II; Karsenty, G. Molecular bases of the regulation of bone remodeling by the canonical Wnt signaling pathway. Curr. Top. Dev. Biol. 2006, 73, 43–84. [Google Scholar]
- Wu, M.; Chen, G.; Li, Y.P. TGF-β and BMP signaling in osteoblast, skeletal development, and bone formation, homeostasis and disease. Bone Res. 2016, 4, 16009. [Google Scholar] [CrossRef] [PubMed]
- Jing, Z.; Liang, Z.; Yang, L.; Du, W.; Yu, T.; Tang, H.; Li, C.; Wei, W. Bone formation and bone repair: The roles and crosstalk of osteoinductive signaling pathways. Process Biochem. 2022, 118, 252–262. [Google Scholar] [CrossRef]
- Paniagua-Pérez, R.; Flores-Mondragón, G.; Reyes-Legorreta, C.; Herrera-López, B.; Cervantes-Hernández, I.; Madrigal-Santillán, O.; Moralez-González, J.A.; Álvarez-González, I.; Madrigal-Bujaidar, E. Evaluation of the anti-inflammatory capacity of beta-sitosterol in rodent assays. Afr. J. Tradit. Complement. Altern. Med. 2017, 14, 123–130. [Google Scholar] [CrossRef]
- Ikeda, I.; Sugano, M. Some aspects of mechanism of inhibition of cholesterol absorption by β-sitosterol. Biochim. Biophys. Acta Biomembr. 1983, 732, 651–658. [Google Scholar] [CrossRef]
- Babu, S.; Jayaraman, S. An update on β-sitosterol: A potential herbal nutraceutical for diabetic management. Biomed. Pharmacother. 2020, 131, 110702. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Li, S.; Yi, C.; Wang, X.; Han, X. Protective Role of β-Sitosterol in Glucocorticoid-Induced Osteoporosis in Rats Via the RANKL/OPG Pathway. Altern. Ther. Health Med. 2022, 28, 18–25. [Google Scholar] [PubMed]
- Liu, Y.; Xue, Y. Study on the Mechanism of Beta-Sitosterol Involved in the Regulation of Senile Postmenopausal Osteoporosis through PI3K-Akt Signal Pathway. Indian J. Pharm. Sci. 2023, 85, 1719–1724. [Google Scholar] [CrossRef]
- Ci, X.; Zhou, J.; Lv, H.; Yu, Q.; Peng, L.; Hua, S. Betulin exhibits anti-inflammatory activity in LPS-stimulated macrophages and endotoxin-shocked mice through an AMPK/AKT/Nrf2-dependent mechanism. Cell Death Dis. 2017, 8, e2798. [Google Scholar] [CrossRef] [PubMed]
- Virginia, F.; Cathrine, L.; Fernandez, S. Isolation, purification, and characterization of betulin, a pentacyclic triterpenoid from the ethanolic extracts of Coleus forskohlii tuberous roots; its antimicrobial, antioxidant, anti-inflammatory and cytotoxicity appraisals: Phytochemistry. Moroc. J. Chem. 2024, 12, 1531–1553. [Google Scholar]
- Kim, K.J.; Lee, Y.; Hwang, H.G.; Sung, S.H.; Lee, M.; Son, Y.J. Betulin suppresses osteoclast formation via down-regulating NFATc1. J. Clin. Med. 2018, 7, 154. [Google Scholar] [CrossRef] [PubMed]
- Im, N.K.; Lee, D.S.; Lee, S.R.; Jeong, G.S. Lupeol isolated from Sorbus commixta suppresses 1α, 25-(OH) 2D3-mediated osteoclast differentiation and bone loss in vitro and in vivo. J. Nat. Prod. 2016, 79, 412–420. [Google Scholar] [CrossRef]
- Chauhan, S.; Sharma, A.; Upadhyay, N.K.; Singh, G.; Lal, U.R.; Goyal, R. In-vitro osteoblast proliferation and in-vivo anti-osteoporotic activity of Bombax ceiba with quantification of Lupeol, gallic acid and β-sitosterol by HPTLC and HPLC. BMC Complement. Altern. Med. 2018, 18, 233. [Google Scholar] [CrossRef] [PubMed]
- Maciel e Silva, A.T.; Gonçalves Magalhães, C.; Pains Duarte, L.; da Nova Mussel, W.; Gois Ruiz, A.L.T.; Shiozawa, L.; de Carvalho, J.E.; Trindade, I.C.; Vieira Filho, S.A. Lupeol and its esters: NMR, powder XRD data and in vitro evaluation of cancer cell growth. Braz. J. Pharm. Sci. 2017, 53, e00251. [Google Scholar]
- Credo, D.; Mabiki, F.P.; Machumi, F.; Cornett, C. Structural elucidation and toxicity evaluation of bioactive compounds from the leaves and stem woods of Synadenium glaucescens pax. Pharm. Sci. Res. 2022, 9, 59–66. [Google Scholar]
- Patra, A.; Chaudhuri, S.K.; Panda, S.K. Betulin-3-caffeate from Quercus suber, 13C-nmr spectra of some lupenes. J. Nat. Prod. 1988, 51, 217–220. [Google Scholar] [CrossRef]
- Xiang, M.; Su, H.; Hu, J.; Yan, Y. Isolation, identification and determination of methyl caffeate, ethyl caffeate and other phenolic compounds from Polygonum amplexicaule var. sinense. J. Med. Plants Res. 2011, 5, 1685–1691. [Google Scholar]
- Park, J.H.; Son, Y.J.; Lee, C.H.; Nho, C.W.; Yoo, G. Circaea mollis Siebold & Zucc. Alleviates postmenopausal osteoporosis in a mouse model via the BMP-2/4/Runx2 pathway. BMC Complement. Med. Ther. 2020, 20, 123. [Google Scholar]
- Soleimani, M.; Nadri, S. A protocol for isolation and culture of mesenchymal stem cells from mouse bone marrow. Nat. Protoc. 2009, 4, 102–106. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward (5′–3′) | Reverse (5′–3′) |
---|---|---|
Alp | GATCATTCCCACGTTTTCAC | TGCGGGCTTGTGGGACCTGC |
Ocn | AGACTCCGGCGCTACCTT | CTCGTCACAAGCAGGGTTAAG |
Osx | TGAGGAAGAAGCCCATTCAC | ACTTCTTCTCCCGGGTGTG |
Runx2 | TCCACAAGGACAGAGTCAGATTAC | TGGCTCAGATAGGAGGGGTA |
Gapdh | AAGAGGGATGCTGCCCTTAC | CCATTTTGTCTACGGGACGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hong, S.; Lee, H.J.; Jung, D.S.; Erdenebileg, S.; Hwang, H.; Kwon, H.C.; Kwon, J.; Yoo, G. Exploring the Anti-Osteoporotic Effects of n-Hexane Fraction from Cotoneaster wilsonii Nakai: Activation of Runx2 and Osteoblast Differentiation In Vivo. Pharmaceuticals 2025, 18, 45. https://doi.org/10.3390/ph18010045
Hong S, Lee HJ, Jung DS, Erdenebileg S, Hwang H, Kwon HC, Kwon J, Yoo G. Exploring the Anti-Osteoporotic Effects of n-Hexane Fraction from Cotoneaster wilsonii Nakai: Activation of Runx2 and Osteoblast Differentiation In Vivo. Pharmaceuticals. 2025; 18(1):45. https://doi.org/10.3390/ph18010045
Chicago/Turabian StyleHong, Soyeon, Hee Ju Lee, Da Seul Jung, Saruul Erdenebileg, Hoseong Hwang, Hak Cheol Kwon, Jaeyoung Kwon, and Gyhye Yoo. 2025. "Exploring the Anti-Osteoporotic Effects of n-Hexane Fraction from Cotoneaster wilsonii Nakai: Activation of Runx2 and Osteoblast Differentiation In Vivo" Pharmaceuticals 18, no. 1: 45. https://doi.org/10.3390/ph18010045
APA StyleHong, S., Lee, H. J., Jung, D. S., Erdenebileg, S., Hwang, H., Kwon, H. C., Kwon, J., & Yoo, G. (2025). Exploring the Anti-Osteoporotic Effects of n-Hexane Fraction from Cotoneaster wilsonii Nakai: Activation of Runx2 and Osteoblast Differentiation In Vivo. Pharmaceuticals, 18(1), 45. https://doi.org/10.3390/ph18010045