Pharmacological Activation of SIRT3 Modulates the Response of Cancer Cells to Acidic pH
Abstract
1. Introduction
2. Results
2.1. Viability and Proliferation of MDA-MB-231 and HEK293 Cells under Unbuffered Culture Medium Conditions
2.2. Interplay between SIRT3, CAVB, and Extracellular pH
2.3. SIRT3 Interacts with CAVB
2.4. Acidic pHe Increases SIRT3 and CAVB Activities but Does Not Affect GDH Activity
2.5. SIRT3 Modulates Autophagy in MDA-MB-231 and HEK293 Cells
3. Discussion
4. Materials and Methods
4.1. Cell Cultures and Reagents
4.2. Generation of Transient and Stable SIRT3 Transfectants
4.3. Lentiviral Transduction
4.4. Development of an Acidic Microenvironment
4.5. Cellular Viability and Proliferation Assay
4.6. Protein Extraction, Western Blotting Assay, and Antibodies
4.7. Isolation of Cytosolic and Mitochondrial Fractions
4.8. RT-PCR
4.9. Immunoprecipitation Assay
4.10. Proximity Ligation Assay
4.11. SIRT3 Activator
4.12. SIRT3 Deacetylase Activity Assay
4.13. CAVB Activity Measurements
4.14. Glutamate Dehydrogenase Activity Assay
4.15. Transmission Electron Microscopy (TEM)
4.16. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Correction Statement
References
- Krstic, M.N.; Mijac, D.D.; Popovic, D.D.; Pavlovic Markovic, A.; Milosavljević, T. General Aspects of Primary Cancer Prevention. Dig. Dis. 2019, 37, 406–415. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Walsh, M.; Fais, S.; Spugnini, E.P.; Harguindey, S.; Abu Izneid, T.; Scacco, L.; Williams, P.; Allegrucci, C.; Rauch, C.; Omran, Z. Proton pump inhibitors for the treatment of cancer in companion animals. J. Exp. Clin. Cancer Res. 2015, 34, 93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, R.H.; Pelicano, H.; Zhou, Y.; Carew, J.S.; Feng, L.; Bhalla, K.N.; Keating, M.J.; Huang, P. Inhibition of glycolysis in cancer cells: A novel strategy to overcome drug resistance associated with mitochondrial respiratory defect and hypoxia. Cancer Res. 2005, 65, 613–621. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cantor, J.R.; Sabatini, D.M. Cancer cell metabolism: One hallmark, many faces. Cancer Discov. 2012, 2, 881–898. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vaupel, P.; Schmidberger, H.; Mayer, A. The Warburg effect: Essential part of metabolic reprogramming and central contributor to cancer progression. Int. J. Radiat. Biol. 2019, 95, 912–919. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Milito, A.; Fais, S. Tumor acidity, chemoresistance and proton pump inhibitors. Future Oncol. 2005, 1, 779–786. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marino, M.L.; Fais, S.; Djavaheri-Mergny, M.; Villa, A.; Meschini, S.; Lozupone, F.; Venturi, G.; Della Mina, P.; Pattingre, S.; Rivoltini, L.; et al. Proton pump inhibition induces autophagy as a survival mechanism following oxidative stress in human melanoma cells. Cell Death Dis. 2010, 1, e87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tannock, I.F.; Rotin, D. Acid pH in tumors and its potential for therapeutic exploitation. Cancer Res. 1989, 49, 4373–4384. [Google Scholar]
- Gillies, R.J.; Robey, I.; Gatenby, R.A. Causes and consequences of increased glucose metabolism of cancers. J. Nucl. Med. 2008, 49 (Suppl. S2), 24S–42S. [Google Scholar] [CrossRef] [Scilit]
- Rahman, A.; Janic, B.; Rahman, T.; Singh, H.; Ali, H.; Rattan, R.; Kazi, M.; Ali, M.M. Immunotherapy Enhancement by Targeting Extracellular Tumor pH in Triple-Negative Breast Cancer Mouse Model. Cancers 2023, 15, 4931. [Google Scholar] [CrossRef] [Scilit]
- Fais, S. Proton pump inhibitor-induced tumour cell death by inhibition of a detoxification mechanism. J. Intern. Med. 2010, 267, 515–525. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frost, S.C.; McKenna, R. Carbonic Anhydrase: Mechanism, Regulation, Links to Disease, and Industrial Applications; Springer: Dordrecht, The Netherlands, 2014. [Google Scholar] [CrossRef] [Scilit]
- Supuran, C.T. Carbonic anhydrase versatility: From pH regulation to CO2 sensing and metabolism. Front. Mol. Biosci. 2023, 10, 1326633. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sly, W.S.; Hu, P.Y. Human carbonic anhydrases and carbonic anhydrase deficiencies. Annu. Rev. Biochem. 1995, 64, 375–401. [Google Scholar] [CrossRef] [PubMed]
- Supuran, C.T. Carbonic anhydrases: Novel therapeutic applications for inhibitors and activators. Nat. Rev. Drug Discov. 2008, 7, 168–181. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aspatwar, A.; Supuran, C.T.; Waheed, A.; Sly, W.S.; Parkkila, S. Mitochondrial carbonic anhydrase VA and VB: Properties and roles in health and disease. J. Physiol. 2023, 601, 257–274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Supuran, C.T. Carbonic anhydrases as drug targets-an overview. Curr. Top. Med. Chem. 2007, 7, 825–833. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shah, G.N.; Rubbelke, T.S.; Hendin, J.; Nguyen, H.; Waheed, A.; Shoemaker, J.D.; Sly, W.S. Targeted mutagenesis of mitochondrial carbonic anhydrases VA and VB implicates both enzymes in ammonia detoxification and glucose metabolism. Proc. Natl. Acad. Sci. USA 2013, 110, 7423–7428. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Acin-Perez, R.; Salazar, E.; Kamenetsky, M.; Buck, J.; Levin, L.R.; Manfredi, G. Cyclic AMP produced inside mitochondria regulates oxidative phosphorylation. Cell Metab. 2009, 9, 265–276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vander Heiden, M.G.; Cantley, L.C.; Thompson, C.B. Understanding the Warburg effect: The metabolic requirements of cell proliferation. Science 2009, 324, 1029–1033. [Google Scholar] [CrossRef] [Scilit]
- Schulze, A.; Harris, A.L. How cancer metabolism is tuned for proliferation and vulnerable to disruption. Nature 2012, 491, 364–373. [Google Scholar] [CrossRef] [Scilit]
- Supuran, C.T. Targeting carbonic anhydrases for the management of hypoxic metastatic tumors. Expert Opin. Ther. Pat. 2023, 33, 701–720. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Milito, A.; Canese, R.; Marino, M.L.; Borghi, M.; Iero, M.; Villa, A.; Venturi, G.; Lozupone, F.; Iessi, E.; Logozzi, M.; et al. pH-dependent antitumor activity of proton pump inhibitors against human melanoma is mediated by inhibition of tumor acidity. Int. J. Cancer 2010, 127, 207–219. [Google Scholar] [CrossRef] [Scilit]
- Frye, R.A. Phylogenetic classification of prokaryotic and eukaryotic Sir2-like proteins. Biochem. Biophys. Res. Commun. 2000, 273, 793–798. [Google Scholar] [CrossRef] [Scilit]
- Weir, H.J.; Lane, J.D.; Balthasar, N. SIRT3: A Central Regulator of Mitochondrial Adaptation in Health and Disease. Genes Cancer 2013, 4, 118–124. [Google Scholar] [CrossRef] [Scilit]
- Ahn, B.H.; Kim, H.S.; Song, S.; Lee, I.H.; Liu, J.; Vassilopoulos, A.; Deng, C.X.; Finkel, T. A role for the mitochondrial deacetylase Sirt3 in regulating energy homeostasis. Proc. Natl. Acad. Sci. USA 2008, 105, 14447–14452. [Google Scholar] [CrossRef] [Scilit]
- Pellegrini, L.; Pucci, B.; Villanova, L.; Marino, M.L.; Marfe, G.; Sansone, L.; Vernucci, E.; Bellizzi, D.; Reali, V.; Fini, M.; et al. SIRT3 protects from hypoxia and staurosporine-mediated cell death by maintaining mitochondrial membrane potential and intracellular pH. Cell Death Differ. 2012, 19, 1815–1825. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Wei, H.; Li, J. A review on SIRT3 and its natural small molecule activators as a potential Preventive and therapeutic target. Eur. J. Pharmacol. 2024, 963, 176155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hallows, W.C.; Lee, S.; Denu, J.M. Sirtuins deacetylate and activate mammalian acetyl-CoA synthetases. Proc. Natl. Acad. Sci. USA 2006, 103, 10230–10235. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schwer, B.; Bunkenborg, J.; Verdin, R.O.; Andersen, J.S.; Verdin, E. Reversible lysine acetylation controls the activity of the mitochondrial enzyme acetyl-CoA synthetase 2. Proc. Natl. Acad. Sci. USA 2006, 103, 10224–10229. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Liu, Y.; Hou, M.; Xia, X.; Liu, J.; Xu, Y.; Shi, Q.; Zhang, Z.; Wang, L.; Shen, Y.; et al. Reprogramming of Mitochondrial Respiratory Chain Complex by Targeting SIRT3-COX4I2 Axis Attenuates Osteoarthritis Progression. Adv. Sci. 2023, 10, e2206144. [Google Scholar] [CrossRef] [Scilit]
- Jing, E.; Emanuelli, B.; Hirschey, M.D.; Boucher, J.; Lee, K.Y.; Lombard, D.; Verdin, E.M.; Kahn, C.R. Sirtuin-3 (Sirt3) regulates skeletal muscle metabolism and insulin signaling via altered mitochondrial oxidation and reactive oxygen species production. Proc. Natl. Acad. Sci. USA 2011, 108, 14608–14613. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schlicker, C.; Gertz, M.; Papatheodorou, P.; Kachholz, B.; Becker, C.F.; Steegborn, C. Substrates and regulation mechanisms for the human mitochondrial sirtuins Sirt3 and Sirt5. J. Mol. Biol. 2008, 382, 790–801. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sundaresan, N.R.; Gupta, M.; Kim, G.; Rajamohan, S.B.; Isbatan, A.; Gupta, M.P. Sirt3 blocks the cardiac hypertrophic response by augmenting Foxo3a-dependent antioxidant defense mechanisms in mice. J. Clin. Investig. 2009, 119, 2758–2771. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Samant, S.A.; Zhang, H.J.; Hong, Z.; Pillai, V.B.; Sundaresan, N.R.; Wolfgeher, D.; Archer, S.L.; Chan, D.C.; Gupta, M.P. SIRT3 deacetylates and activates OPA1 to regulate mitochondrial dynamics during stress. Mol. Cell. Biol. 2014, 34, 807–819. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qiao, A.; Wang, K.; Yuan, Y.; Guan, Y.; Ren, X.; Li, L.; Chen, X.; Li, F.; Chen, A.F.; Zhou, J.; et al. Sirt3-mediated mitophagy protects tumor cells against apoptosis under hypoxia. Oncotarget 2016, 7, 43390–43400. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, W.; Denu, R.A.; Krautkramer, K.A.; Grindle, K.M.; Yang, D.T.; Asimakopoulos, F.; Hematti, P.; Denu, J.M. Loss of SIRT3 Provides Growth Advantage for B Cell Malignancies. J. Biol. Chem. 2016, 291, 3268–3279. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Finley, L.W.; Haigis, M.C. Metabolic regulation by SIRT3: Implications for tumorigenesis. Trends Mol. Med. 2012, 18, 516–523. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Torrens-Mas, M.; Oliver, J.; Roca, P.; Sastre-Serra, J. SIRT3: Oncogene and Tumor Suppressor in Cancer. Cancers 2017, 9, 90. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, M.; Yang, C.; Pei, Y. Effects of downregulation of SIRT3 expression on proliferation and apoptosis in esophageal squamous cell carcinoma EC9706 cells and its molecular mechanisms. Bio-Med. Mater. Eng. 2014, 24, 3883–3890. [Google Scholar] [CrossRef] [Scilit]
- Wang, F.; Nguyen, M.; Qin, F.X.; Tong, Q. SIRT2 deacetylates FOXO3a in response to oxidative stress and caloric restriction. Aging Cell 2007, 6, 505–514. [Google Scholar] [CrossRef] [Scilit]
- Mao, Z.; Hine, C.; Tian, X.; Van Meter, M.; Au, M.; Vaidya, A.; Seluanov, A.; Gorbunova, V. SIRT6 promotes DNA repair under stress by activating PARP1. Science 2011, 332, 1443–1446. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Wang, L.; Yang, G.; Chi, X.; Liang, X.; Zhang, Y. Sirtuins: Promising Therapeutic Targets to Treat Ischemic Stroke. Biomolecules 2023, 13, 1210. [Google Scholar] [CrossRef] [Scilit]
- Carnevale, I.; Pellegrini, L.; D’Aquila, P.; Saladini, S.; Lococo, E.; Polletta, L.; Vernucci, E.; Foglio, E.; Coppola, S.; Sansone, L.; et al. SIRT1-SIRT3 Axis Regulates Cellular Response to Oxidative Stress and Etoposide. J. Cell. Physiol. 2017, 232, 1835–1844. [Google Scholar] [CrossRef] [Scilit]
- Torres-López, L.; Dobrovinskaya, O. Dissecting the Role of Autophagy-Related Proteins in Cancer Metabolism and Plasticity. Cells 2023, 12, 2486. [Google Scholar] [CrossRef] [Scilit]
- Mathew, R.; Karp, C.M.; Beaudoin, B.; Vuong, N.; Chen, G.; Chen, H.Y.; Bray, K.; Reddy, A.; Bhanot, G.; Gelinas, C.; et al. Autophagy suppresses tumorigenesis through elimination of p62. Cell 2009, 137, 1062–1075. [Google Scholar] [CrossRef] [Scilit]
- Longatti, A.; Tooze, S.A. Vesicular trafficking and autophagosome formation. Cell Death Differ. 2009, 16, 956–965. [Google Scholar] [CrossRef] [Scilit]
- Wojtkowiak, J.W.; Gillies, R.J. Autophagy on acid. Autophagy 2012, 8, 1688–1689. [Google Scholar] [CrossRef] [Scilit]
- Wojtkowiak, J.W.; Rothberg, J.M.; Kumar, V.; Schramm, K.J.; Haller, E.; Proemsey, J.B.; Lloyd, M.C.; Sloane, B.F.; Gillies, R.J. Chronic autophagy is a cellular adaptation to tumor acidic pH microenvironments. Cancer Res. 2012, 72, 3938–3947. [Google Scholar] [CrossRef] [Scilit]
- Frazier, D.P.; Wilson, A.; Graham, R.M.; Thompson, J.W.; Bishopric, N.H.; Webster, K.A. Acidosis regulates the stability, hydrophobicity, and activity of the BH3-only protein Bnip3. Antioxid. Redox Signal. 2006, 8, 1625–1634. [Google Scholar] [CrossRef] [Scilit]
- Xie, W.Y.; Zhou, X.D.; Li, Q.; Chen, L.X.; Ran, D.H. Acid-induced autophagy protects human lung cancer cells from apoptosis by activating ER stress. Exp. Cell Res. 2015, 339, 270–279. [Google Scholar] [CrossRef] [Scilit]
- Montcourrier, P.; Silver, I.; Farnoud, R.; Bird, I.; Rochefort, H. Breast cancer cells have a high capacity to acidify extracellular milieu by a dual mechanism. Clin. Exp. Metastasis 1997, 15, 382–392. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Madshus, I.H. Regulation of intracellular pH in eukaryotic cells. Biochem. J. 1988, 250, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Logozzi, M.; Mizzoni, D.; Angelini, D.F.; Di Raimo, R.; Falchi, M.; Battistini, L.; Fais, S. Microenvironmental pH and Exosome Levels Interplay in Human Cancer Cell Lines of Different Histotypes. Cancers 2018, 10, 370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Swietach, P.; Vaughan-Jones, R.D.; Harris, A.L.; Hulikova, A. The chemistry, physiology and pathology of pH in cancer. Philos. Trans. R. Soc. London Ser. B Biol. Sci. 2014, 369, 20130099. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mboge, M.Y.; Mahon, B.P.; McKenna, R.; Frost, S.C. Carbonic Anhydrases: Role in pH Control and Cancer. Metabolites 2018, 8, 19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suenkel, B.; Valente, S.; Zwergel, C.; Weiss, S.; Di Bello, E.; Fioravanti, R.; Aventaggiato, M.; Amorim, J.A.; Garg, N.; Kumar, S.; et al. Potent and Specific Activators for Mitochondrial Sirtuins Sirt3 and Sirt5. J. Med. Chem. 2022, 65, 14015–14031. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, T.; Su, H.; Ganapathy, S.; Yuan, Z.M. Modulation of autophagic activity by extracellular pH. Autophagy 2011, 7, 1316–1322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marino, M.L.; Pellegrini, P.; Di Lernia, G.; Djavaheri-Mergny, M.; Brnjic, S.; Zhang, X.; Hägg, M.; Linder, S.; Fais, S.; Codogno, P.; et al. Autophagy is a protective mechanism for human melanoma cells under acidic stress. J. Biol. Chem. 2012, 287, 30664–30676. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hanahan, D.; Weinberg, R.A. Hallmarks of cancer: The next generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [Scilit]
- Vernucci, E.; Abrego, J.; Gunda, V.; Shukla, S.K.; Dasgupta, A.; Rai, V.; Chaika, N.; Buettner, K.; Illies, A.; Yu, F.; et al. Metabolic Alterations in Pancreatic Cancer Progression. Cancers 2019, 12, 2. [Google Scholar] [CrossRef] [Scilit]
- Ward, P.S.; Thompson, C.B. Metabolic reprogramming: A cancer hallmark even warburg did not anticipate. Cancer Cell 2012, 21, 297–308. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kallinowski, F.; Schlenger, K.H.; Runkel, S.; Kloes, M.; Stohrer, M.; Okunieff, P.; Vaupel, P. Blood flow, metabolism, cellular microenvironment, and growth rate of human tumor xenografts. Cancer Res. 1989, 49, 3759–3764. [Google Scholar]
- Peppicelli, S.; Bianchini, F.; Toti, A.; Laurenzana, A.; Fibbi, G.; Calorini, L. Extracellular acidity strengthens mesenchymal stem cells to promote melanoma progression. Cell Cycle 2015, 14, 3088–3100. [Google Scholar] [CrossRef] [Scilit]
- Avnet, S.; Di Pompo, G.; Chano, T.; Errani, C.; Ibrahim-Hashim, A.; Gillies, R.J.; Donati, D.M.; Baldini, N. Cancer-associated mesenchymal stroma fosters the stemness of osteosarcoma cells in response to intratumoral acidosis via NF-κB activation. Int. J. Cancer 2017, 140, 1331–1345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fang, J.S.; Gillies, R.D.; Gatenby, R.A. Adaptation to hypoxia and acidosis in carcinogenesis and tumor progression. Semin. Cancer Biol. 2008, 18, 330–337. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, Q.; Zhou, J.; Li, F.; Guo, S.; Zhang, L.; Li, J.; Qi, Q.; Shi, Y. The Role and Therapeutic Perspectives of Sirtuin 3 in Cancer Metabolism Reprogramming, Metastasis, and Chemoresistance. Front. Oncol. 2022, 12, 910963. [Google Scholar] [CrossRef] [Scilit]
- Ouyang, S.; Zhang, Q.; Lou, L.; Zhu, K.; Li, Z.; Liu, P.; Zhang, X. The Double-Edged Sword of SIRT3 in Cancer and Its Therapeutic Applications. Front. Pharmacol. 2022, 13, 871560. [Google Scholar] [CrossRef] [Scilit]
- Aventaggiato, M.; Vernucci, E.; Barreca, F.; Russo, M.A.; Tafani, M. Sirtuins’ control of autophagy and mitophagy in cancer. Pharmacol. Ther. 2021, 221, 107748. [Google Scholar] [CrossRef] [Scilit]
- Xiong, Y.; Wang, M.; Zhao, J.; Han, Y.; Jia, L. Sirtuin 3: A Janus face in cancer (Review). Int. J. Oncol. 2016, 49, 2227–2235. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Y.; Yang, H.; Wang, X.; Zhang, R.; Wang, C.; Guo, Z. Sirtuin-3 (SIRT3) expression is associated with overall survival in esophageal cancer. Ann. Diagn. Pathol. 2013, 17, 483–485. [Google Scholar] [CrossRef] [Scilit]
- Zou, X.; Santa-Maria, C.A.; O’Brien, J.; Gius, D.; Zhu, Y. Manganese Superoxide Dismutase Acetylation and Dysregulation, Due to Loss of SIRT3 Activity, Promote a Luminal B-Like Breast Carcinogenic-Permissive Phenotype. Antioxid. Redox Signal. 2016, 25, 326–336. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bell, E.L.; Emerling, B.M.; Ricoult, S.J.; Guarente, L. SirT3 suppresses hypoxia inducible factor 1α and tumor growth by inhibiting mitochondrial ROS production. Oncogene 2011, 30, 2986–2996. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Swietach, P.; Patiar, S.; Supuran, C.T.; Harris, A.L.; Vaughan-Jones, R.D. The role of carbonic anhydrase 9 in regulating extracellular and intracellular ph in three-dimensional tumor cell growths. J. Biol. Chem. 2009, 284, 20299–20310. [Google Scholar] [CrossRef] [Scilit]
- Hao, G.; Xu, Z.P.; Li, L. Manipulating extracellular tumour pH: An effective target for cancer therapy. RSC Adv. 2018, 8, 22182–22192. [Google Scholar] [CrossRef] [Scilit]
- Barathova, M.; Takacova, M.; Holotnakova, T.; Gibadulinova, A.; Ohradanova, A.; Zatovicova, M.; Hulikova, A.; Kopacek, J.; Parkkila, S.; Supuran, C.T.; et al. Alternative splicing variant of the hypoxia marker carbonic anhydrase IX expressed independently of hypoxia and tumour phenotype. Br. J. Cancer 2008, 98, 129–136. [Google Scholar] [CrossRef] [Scilit]
- Pouysségur, J.; Dayan, F.; Mazure, N.M. Hypoxia signalling in cancer and approaches to enforce tumour regression. Nature 2006, 441, 437–443. [Google Scholar] [CrossRef] [Scilit]
- Enerson, B.E.; Drewes, L.R. Molecular features, regulation, and function of monocarboxylate transporters: Implications for drug delivery. J. Pharm. Sci. 2003, 92, 1531–1544. [Google Scholar] [CrossRef] [Scilit]
- Pouysségur, J.; Mechta-Grigoriou, F. Redox regulation of the hypoxia-inducible factor. Biol. Chem. 2006, 387, 1337–1346. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baine, M.J.; Chakraborty, S.; Smith, L.M.; Mallya, K.; Sasson, A.R.; Brand, R.E.; Batra, S.K. Transcriptional profiling of peripheral blood mononuclear cells in pancreatic cancer patients identifies novel genes with potential diagnostic utility. PLoS ONE 2011, 6, e17014. [Google Scholar] [CrossRef] [Scilit]
- Nimesh, S.; Thibault, M.M.; Lavertu, M.; Buschmann, M.D. Enhanced gene delivery mediated by low molecular weight chitosan/DNA complexes: Effect of pH and serum. Mol. Biotechnol. 2010, 46, 182–196. [Google Scholar] [CrossRef] [Scilit]
- Stepanenko, A.A.; Dmitrenko, V.V. HEK293 in cell biology and cancer research: Phenotype, karyotype, tumorigenicity, and stress-induced genome-phenotype evolution. Gene 2015, 569, 182–190. [Google Scholar] [CrossRef] [Scilit]
- Bai, X.; Yao, L.; Ma, X.; Xu, X. Small Molecules as SIRT Modulators. Mini Rev. Med. Chem. 2018, 18, 1151–1157. [Google Scholar] [CrossRef] [Scilit]
- Villalba, J.M.; Alcaín, F.J. Sirtuin activators and inhibitors. BioFactors 2012, 38, 349–359. [Google Scholar] [CrossRef] [Scilit]
- Ye, J.S.; Chen, L.; Lu, Y.Y.; Lei, S.Q.; Peng, M.; Xia, Z.Y. SIRT3 activator honokiol ameliorates surgery/anesthesia-induced cognitive decline in mice through anti-oxidative stress and anti-inflammatory in hippocampus. CNS Neurosci. Ther. 2019, 25, 355–366. [Google Scholar] [CrossRef] [Scilit]
- Ferreri, C.J.; Bhutani, M. Mechanisms and management of CAR T toxicity. Front. Oncol. 2024, 14, 1396490. [Google Scholar] [CrossRef] [Scilit]
- Willyard, C. Do cutting-edge CAR-T-cell therapies cause cancer? What the data say. Nature 2024, 629, 22–24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maren, T.H. A simplified micromethod for the determination of carbonic anhydrase and its inhibitors. J. Pharmacol. Exp. Ther. 1960, 130, 26–29. [Google Scholar] [PubMed]









| Accession Nb. | Primer | Length | Position | Tm | %GC | Sequence |
|---|---|---|---|---|---|---|
| NM_012239.5 (SIRT3) | Left | 20 | 940–959 | 59 | 45 | cttgctgcatgtggttgatt |
| Right | 18 | 1011–1028 | 60 | 56 | cggtcaagctggcaaaag | |
| NM_007220 (CAVB) | Left | 21 | 716–736 | 60 | 43 | tgccgtcaattaagcataagg |
| Right | 19 | 777–795 | 60 | 58 | atctgggcaggtaggcatc |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Aventaggiato, M.; Arcangeli, T.; Vernucci, E.; Barreca, F.; Sansone, L.; Pellegrini, L.; Pontemezzo, E.; Valente, S.; Fioravanti, R.; Russo, M.A.; et al. Pharmacological Activation of SIRT3 Modulates the Response of Cancer Cells to Acidic pH. Pharmaceuticals 2024, 17, 810. https://doi.org/10.3390/ph17060810
Aventaggiato M, Arcangeli T, Vernucci E, Barreca F, Sansone L, Pellegrini L, Pontemezzo E, Valente S, Fioravanti R, Russo MA, et al. Pharmacological Activation of SIRT3 Modulates the Response of Cancer Cells to Acidic pH. Pharmaceuticals. 2024; 17(6):810. https://doi.org/10.3390/ph17060810
Chicago/Turabian StyleAventaggiato, Michele, Tania Arcangeli, Enza Vernucci, Federica Barreca, Luigi Sansone, Laura Pellegrini, Elena Pontemezzo, Sergio Valente, Rossella Fioravanti, Matteo Antonio Russo, and et al. 2024. "Pharmacological Activation of SIRT3 Modulates the Response of Cancer Cells to Acidic pH" Pharmaceuticals 17, no. 6: 810. https://doi.org/10.3390/ph17060810
APA StyleAventaggiato, M., Arcangeli, T., Vernucci, E., Barreca, F., Sansone, L., Pellegrini, L., Pontemezzo, E., Valente, S., Fioravanti, R., Russo, M. A., Mai, A., & Tafani, M. (2024). Pharmacological Activation of SIRT3 Modulates the Response of Cancer Cells to Acidic pH. Pharmaceuticals, 17(6), 810. https://doi.org/10.3390/ph17060810

