Evaluation of Selected Plant Phenolics via Beta-Secretase-1 Inhibition, Molecular Docking, and Gene Expression Related to Alzheimer’s Disease
Abstract
:1. Introduction
2. Results
2.1. BACE1 Inhibition
2.2. Molecular Docking Studies with BACE1
2.3. Cytotoxic Activity Findings Obtained by the Alamar Blue Method
2.4. Expression Analysis Data by RT-PCR Method
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Beta Secretase (BACE-1) Inhibition Assay
- K0 = fluorescence value of the control group at minute 0
- K = fluorescence value of the control group at 60 min
- B0 = fluorescence value of the test compound at minute 0
- B = fluorescence value of the test compound at 60 min
4.3. Molecular Docking Simulations
4.4. Cell Culture Experiments
Cell Culture
4.5. Determination of Cytotoxicity by Alamar Blue Method
4.6. Expression Analysis of Selected Phenolic Compounds on Some Genes Associated with AD by Real-Time Polymerase Chain Reaction (Real-Time/RT-PCR) Method
RNA Isolation and Real-Time/RT-PCR
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Scheltens, P.; Blennow, K.; Breteler, M.M.; de Strooper, B.; Frisoni, G.B.; Salloway, S.; Van der Flier, W.M. Alzheimer’s disease. Lancet 2016, 388, 505–517. [Google Scholar] [CrossRef] [PubMed]
- Naseri, N.N.; Wang, H.; Guo, J.; Sharma, M.; Luo, W. The complexity of tau in Alzheimer’s disease. Neurosci. Lett. 2019, 705, 183–194. [Google Scholar] [CrossRef] [PubMed]
- Serý, O.; Povová, J.; Míšek, I.; Pešák, L.; Janout, V. Molecular mechanisms of neuropathological changes in Alzheimer’s disease: A review. Folia Neuropathol. 2013, 51, 1–9. [Google Scholar] [CrossRef]
- Minter, M.R.; Taylor, J.M.; Crack, P.J. The contribution of neuroinflammation to amyloid toxicity in Alzheimer’s disease. J. Neurochem. 2016, 136, 457–474. [Google Scholar] [CrossRef]
- Hampel, H.; Mesulam, M.M.; Cuello, A.C.; Farlow, M.R.; Giacobini, E.; Grossberg, G.T.; Khachaturian, A.S.; Vergallo, A.; Cavedo, E.; Snyder, P.J.; et al. The cholinergic system in the pathophysiology and treatment of Alzheimer’s disease. Brain 2018, 141, 1917–1933. [Google Scholar] [CrossRef]
- Nikolac Perkovic, M.; Pivac, N. Genetic markers of Alzheimer’s disease. Adv. Exp. Med. Biol. 2019, 1192, 27–52. [Google Scholar] [CrossRef] [PubMed]
- Ashleigh, T.; Swerdlow, R.H.; Beal, M.F. The role of mitochondrial dysfunction in Alzheimer’s disease pathogenesis. Alzheimer’s Dement. 2023, 19, 333–342. [Google Scholar] [CrossRef]
- Wang, H.; Li, R.; Shen, Y. β-Secretase: Its biology as a therapeutic target in diseases. Trends Pharmacol. Sci. 2013, 34, 215–225. [Google Scholar] [CrossRef]
- Taylor, H.A.; Przemylska, L.; Clavane, E.M.; Meakin, P.J. BACE1: More than just a β-secretase. Obes. Rev. 2022, 23, e13430. [Google Scholar] [CrossRef]
- Ghosh, A.K.; Osswald, H.L. BACE1 (β-secretase) inhibitors for the treatment of Alzheimer’s disease. Chem. Soc. Rev. 2014, 43, 6765–6813. [Google Scholar] [CrossRef]
- Moussa, C.E. Beta-secretase inhibitors in phase I and phase II clinical trials for Alzheimer’s disease. Expert Opin. Investig. Drugs 2017, 26, 1131–1136. [Google Scholar] [CrossRef] [PubMed]
- Kandalepas, P.C.; Vassar, R. Identification and biology of β-secretase. J. Neurochem. 2012, 120 (Suppl. S1), 55–61. [Google Scholar] [CrossRef] [PubMed]
- Yan, R.; Vassar, R. Targeting the β secretase BACE1 for Alzheimer’s disease therapy. Lancet Neurol. 2014, 13, 319–329. [Google Scholar] [CrossRef]
- Miranda, A.; Montiel, E.; Ulrich, H.; Paz, C. Selective secretase targeting for Alzheimer’s disease therapy. J. Alzheimers Dis. 2021, 81, 1–17. [Google Scholar] [CrossRef]
- Naushad, M.; Durairajan, S.S.K.; Bera, A.K.; Senapati, S.; Li, M. Natural compounds with anti-BACE1 activity as promising therapeutic drugs for treating Alzheimer’s disease. Planta Med. 2019, 85, 1316–1325. [Google Scholar] [CrossRef]
- Islam, M.S.; Quispe, C.; Hossain, R.; Islam, M.T.; Al-Harrasi, A.; Al-Rawahi, A.; Martorell, M.; Mamurova, A.; Seilkhan, A.; Altybaeva, N.; et al. Neuropharmacological effects of quercetin: A literature-based review. Front. Pharmacol. 2021, 12, 665031. [Google Scholar] [CrossRef]
- Zhang, J.L.; Laurence Souders, C.; Denslow, N.D.; Martyniuk, C.J. Quercetin, a natural product supplement, impairs mitochondrial bioenergetics and locomotor behavior in larval zebrafish (Danio rerio). Toxicol. Appl. Pharmacol. 2017, 327, 30–38. [Google Scholar] [CrossRef]
- Zhumanova, K.; Lee, G.; Baiseitova, A.; Shah, A.B.; Kim, J.H.; Kim, J.Y.; Lee, K.W.; Park, K.H. Inhibitory mechanism of O-methylated quercetins, highly potent β-secretase inhibitors isolated from Caragana balchaschensis (Kom.) Pojark. J. Ethnopharmacol. 2021, 272, 113935. [Google Scholar] [CrossRef] [PubMed]
- Elfiky, A.M.; Mahmoud, A.A.; Elreedy, H.A.; Ibrahim, K.S.; Ghazy, M.A. Quercetin stimulates the non-amyloidogenic pathway via activation of ADAM10 and ADAM17 gene expression in aluminum chloride-induced Alzheimer’s disease rat model. Life Sci. 2021, 285, 119964. [Google Scholar] [CrossRef]
- Yang, K.; Zhang, L.; Liao, P.; Xiao, Z.; Zhang, F.; Sindaye, D.; Xin, Z.; Tan, C.; Deng, J.; Yin, Y.; et al. Impact of gallic acid on gut health: Focus on the gut microbiome, immune response, and mechanisms of action. Front. Immunol. 2020, 11, 588020. [Google Scholar] [CrossRef]
- Daglia, M.; Di Lorenzo, A.; Nabavi, S.F.; Talas, Z.S.; Nabavi, S.M. Polyphenols: Well beyond the antioxidant capacity: Gallic acid and related compounds as neuroprotective agents: You are what you eat! Curr. Pharm. Biotechnol. 2014, 15, 362–372. [Google Scholar] [CrossRef] [PubMed]
- Elreedy, H.A.; Elfiky, A.M.; Mahmoud, A.A.; Ibrahim, K.S.; Ghazy, M.A. Neuroprotective effect of quercetin through targeting key genes involved in aluminum chloride-induced Alzheimer’s disease in rats. Egypt. J. Basic Appl. Sci. 2023, 10, 174–184. [Google Scholar] [CrossRef]
- Khan, H.; Ullah, H.; Aschner, M.; Cheang, W.S.; Akkol, E.K. Neuroprotective effects of quercetin in Alzheimer’s disease. Biomolecules 2020, 10, 59. [Google Scholar] [CrossRef]
- Chang, Y.J.; Hsu, S.L.; Liu, Y.T.; Lin, Y.H.; Lin, M.H.; Huang, S.J.; Ho, J.A.A.; Wu, L.C. Gallic acid induces necroptosis via TNF-α signaling pathway in activated hepatic stellate cells. PLoS ONE 2015, 10, e0120713. [Google Scholar] [CrossRef]
- Griciuc, A.; Tanzi, R.E. The role of innate immune genes in Alzheimer’s disease. Curr. Opin. Neurol. 2021, 34, 228–236. [Google Scholar] [CrossRef] [PubMed]
- Reinhard, S.M.; Razak, K.; Ethell, I.M. A delicate balance: Role of MMP-9 in brain development and pathophysiology of neurodevelopmental disorders. Front. Cell. Neurosci. 2015, 9, 280. [Google Scholar] [CrossRef]
- Carter, C. Alzheimer’s disease: APP, gamma-secretase, APOE, CLU, CR1, PICALM, ABCA7, BIN1, CD2AP, CD33, EPHA1, and MS4A2, and their relationships with Herpes simplex, C. pneumoniae, other suspect pathogens, and the immune system. Int. J. Alzheimer’s Dis. 2011, 2011, 501862. [Google Scholar] [CrossRef]
- Mori, T.; Koyama, N.; Yokoo, T.; Segawa, T.; Maeda, M.; Sawmiller, D.; Tan, J.; Town, T. Gallic acid is a dual α/β-secretase modulator that reverses cognitive impairment and remediates pathology in Alzheimer mice. J. Biol. Chem. 2020, 295, 16251–16266. [Google Scholar] [CrossRef]
- Orhan, I.; Aslan, S.; Kartal, M.; Sener, B.; Baser, K.H.C. Inhibitory effect of Turkish Rosmarinus officinalis L. on acetylcholinesterase and butyrylcholinesterase enzymes. Food Chem. 2008, 108, 663–668. [Google Scholar] [CrossRef]
- Szwajgier, D. Anticholinesterase activity of selected phenolic acids and flavonoids-interaction testing in model solutions. Ann. Agric. Environ. Med. 2015, 22, 690–694. [Google Scholar] [CrossRef]
- Gülçin, I.; Scozzafava, A.; Supuran, C.T.; Koksal, Z.; Turkan, F.; Çetinkaya, S.; Bingöl, Z.; Huyut, Z.; Alwasel, S.H. Rosmarinic acid inhibits some metabolic enzymes including glutathione S-transferase, lactoperoxidase, acetylcholinesterase, butyrylcholinesterase and carbonic anhydrase isoenzymes. J. Enzyme Inhib. Med. Chem. 2016, 31, 1698–1702. [Google Scholar] [CrossRef] [PubMed]
- Kocakaya, S.O.; Ertas, A.; Yener, I.; Ercan, B.; Oral, E.V.; Akdeniz, M.; Kaplaner, E.; Topcu, G.; Kolak, U. Selective in vitro enzymes’ inhibitory activities of fingerprints compounds of Salvia species and molecular docking simulations. Iran. J. Pharm. Res. 2020, 19, 187–198. [Google Scholar] [CrossRef] [PubMed]
- Choi, S.H.; Hur, J.M.; Yang, E.J.; Jun, M.; Park, H.J.; Lee, K.B.; Moon, E.; Song, K.S. Beta-secretase (BACE1) inhibitors from Perilla frutescens var. acuta. Arch. Pharm. Res. 2008, 31, 183–187. [Google Scholar] [CrossRef] [PubMed]
- Ehrnhoefer, D.E.; Duennwald, M.; Markovic, P.; Wacker, J.L.; Engemann, S.; Roark, M.; Legleiter, J.; Marsh, J.L.; Thompson, L.M.; Lindquist, S.; et al. Green tea (-)-epigallocatechin-gallate modulates early events in huntingtin misfolding and reduces toxicity in Huntington’s disease models. Hum. Mol. Genet. 2006, 15, 2743–2751. [Google Scholar] [CrossRef]
- Lee, J.W.; Lee, Y.K.; Ban, J.O.; Ha, T.Y.; Yun, Y.P.; Han, S.B.; Oh, K.W.; Hong, J.T. Green tea (-)-epigallocatechin-3-gallate inhibits beta-amyloid-induced cognitive dysfunction through modification of secretase activity via inhibition of ERK and NF-kappaB pathways in mice. J. Nutr. 2009, 139, 1987–1993. [Google Scholar] [CrossRef]
- Omar, S.H.; Scott, C.J.; Hamlin, A.S.; Obied, H.K. Biophenols: Enzymes (β-secretase, cholinesterases, histone deacetylase and tyrosinase) inhibitors from olive (Olea europaea L.). Fitoterapia 2018, 128, 118–129. [Google Scholar] [CrossRef]
- Giamarellos-Bourboulis, E.J.; Geladopoulos, T.; Chrisofos, M.; Koutoukas, P.; Vassiliadis, J.; Alexandrou, I.; Tsaganos, T.; Sabracos, L.; Karagianni, V.; Pelekanou, E.; et al. Oleuropein: A novel immunomodulator conferring prolonged survival in experimental sepsis by Pseudomonas aeruginosa. Shock 2006, 26, 410–416. [Google Scholar] [CrossRef]
- Barbaro, B.; Toietta, G.; Maggio, R.; Arciello, M.; Tarocchi, M.; Galli, A.; Balsano, C. Effects of the olive-derived polyphenol oleuropein on human health. Int. J. Mol. Sci. 2014, 15, 18508–18524. [Google Scholar] [CrossRef]
- Agarwal, A.; Kansal, V.; Farooqi, H.; Prasad, R.; Singh, V.K. Epigallocatechin gallate (EGCG), an active phenolic compound of green tea, inhibits tumor growth of head and neck cancer cells by targeting DNA hypermethylation. Biomedicines 2023, 11, 789. [Google Scholar] [CrossRef]
- Bazoti, F.N.; Bergquist, J.; Markides, K.E.; Tsarbopoulos, A. Noncovalent interaction between amyloid-β-peptide1-40 and oleuropein studied by electrospray ionization mass spectrometry. J. Am. Soc. Mass. Spectr. 2006, 17, 568–575. [Google Scholar] [CrossRef]
- Bazoti, F.N.; Bergquist, J.; Markides, K.; Tsarbopoulos, A. Localization of the noncovalent binding site between amyloid-β-peptide and oleuropein using electrospray ionization FT-ICR mass spectrometry. J. Am. Soc. Mass Spectrom. 2008, 19, 1078–1085. [Google Scholar] [CrossRef] [PubMed]
- Ahn, H.Y.; Xu, Y.; Davidge, S.T. Epigallocatechin-3-O-gallate inhibits TNFα-induced monocyte chemotactic protein-1 production from vascular endothelial cells. Life Sci. 2008, 82, 964–968. [Google Scholar] [CrossRef] [PubMed]
- Cascella, M.; Bimonte, S.; Muzio, M.R.; Schiavone, V.; Cuomo, A. The efficacy of epigallocatechin-3-gallate (green tea) in the treatment of Alzheimer’s disease: An overview of pre-clinical studies and translational perspectives in clinical practice. Infect. Agents Cancer 2017, 12, 36. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.; Bae, J.H.; Lee, S.R. Protective effect of green tea polyphenol EGCG against neuronal damage and brain edema after unilateral cerebral ischemia in gerbils. J. Neurosci. Res. 2004, 77, 892–900. [Google Scholar] [CrossRef]
- Hase, T.; Shishido, S.; Yamamoto, S.; Yamashita, R.; Nukima, H.; Taira, S.; Toyoda, T.; Abe, K.; Hamaguchi, T.; Ono, K.; et al. Rosmarinic acid suppresses Alzheimer’s disease development by reducing amyloid β aggregation by increasing monoamine secretion. Sci. Rep. 2019, 9, 8711. [Google Scholar] [CrossRef]
- Lee, J.; Jung, E.; Kim, Y.; Lee, J.; Park, J.; Hong, S.; Hyun, C.G.; Park, D.; Kim, Y.S. Rosmarinic acid as a downstream inhibitor of IKK-β in TNF-α-induced upregulation of CCL11 and CCR3. Br. J. Pharmacol. 2006, 148, 366–375. [Google Scholar] [CrossRef]
- Ma, Z.; Lu, Y.; Yang, F.; Li, S.; He, X.; Gao, Y.; Zhang, G.; Ren, E.; Wang, Y.; Kang, X. Rosmarinic acid exerts a neuroprotective effect on spinal cord injury by suppressing oxidative stress and inflammation via modulating the Nrf2/HO-1 and TLR4/NF-κB pathways. Toxicol. Appl. Pharmacol. 2020, 397, 115014. [Google Scholar] [CrossRef]
- Gaggelli, E.; Kozlowski, H.; Valensin, D.; Valensin, G. Copper homeostasis and neurodegenerative disorders (Alzheimer’s, prion, and Parkinson’s diseases and amyotrophic lateral sclerosis). Chem. Rev. 2006, 106, 1995–2044. [Google Scholar] [CrossRef]
- Barnham, K.J.; Bush, A.I. Metals in Alzheimer’s and Parkinson’s diseases. Curr. Opin. Chem. Biol. 2008, 12, 222–228. [Google Scholar] [CrossRef]
- Mandel, S.; Youdim, M.B. Catechin polyphenols: Neurodegeneration and neuroprotection in neurodegenerative diseases. Free Rad. Biol. Med. 2012, 53, 857–868. [Google Scholar] [CrossRef]
- Stefani, M.; Rigacci, S. Protein folding and aggregation into amyloid: The interference by natural phenolic compounds. Int. J. Mol. Sci. 2013, 14, 12411–12457. [Google Scholar] [CrossRef] [PubMed]
- Ayaz, M.; Sadiq, A.; Junaid, M.; Ullah, F.; Ovais, M.; Ullah, I.; Ahmed, J.; Shahid, M. Flavonoids as prospective neuroprotectants and their therapeutic propensity in aging associated neurological disorders. Front. Aging Neurosci. 2019, 11, 155. [Google Scholar] [CrossRef] [PubMed]
- Youn, K.; Ho, C.T.; Jun, M. Multifaceted neuroprotective effects of (-)-epigallocatechin-3-gallate (EGCG) in Alzheimer’s disease: An overview of pre-clinical studies focused on β-amyloid peptide. Food Sci. Hum. Wellness 2022, 11, 43–493. [Google Scholar] [CrossRef]
- Nicholls, A.; Mcgaughey, G.B.; Sheridan, R.P.; Good, A.C.; Warren, G.; Mathieu, M.; Muchmore, S.W.; Brown, S.P.; Grant, J.A.; Haigh, J.A.; et al. Molecular shape and medicinal chemistry: A perspective. J. Med. Chem. 2010, 53, 3862–3886. [Google Scholar] [CrossRef] [PubMed]
- Friesner, R.A.; Murphy, R.B.; Repasky, M.P.; Frye, L.L.; Greenwood, J.R.; Halgren, T.A.; Sanschagrin, P.C.; Mainz, D.T. Extra precision glide: Docking and scoring incorporating a model of hydrophobic enclosure for protein-ligand complexes. J. Med. Chem. 2006, 49, 6177–6196. [Google Scholar] [CrossRef]
- Erkekoglu, P.; Baydar, T. Current in vitro cytotoxicity tests. Hacettepe Univ. J. Fac. Pharm. 2021, 41, 45–63. [Google Scholar]
- Eilenberger, C.; Kratz, S.R.A.; Rothbauer, M.; Ehmoser, E.K.; Ertl, P.; Küpcü, S. Optimized Alamar Blue assay protocol for drug dose-response determination of 3D tumor spheroids. MethodsX 2018, 5, 781–787. [Google Scholar] [CrossRef]
- Karch, C.M.; Jeng, A.T.; Nowotny, P.; Cady, J.; Cruchaga, C.; Goate, A.M. Expression of novel Alzheimer’s disease risk genes in control and Alzheimer’s disease brains. PLoS ONE 2012, 7, e50976. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Tested Compounds | BACE1 Inhibition (Inhibition% ± SD a) | IC50 ± SD a (mM) |
---|---|---|
Rosmarinic acid | 67.04 ± 0.64 | 4.06 ± 0.68 |
Gallic acid | 27.51 ± 2.97 | - b |
Oleuropein | 52.38 ± 2.08 | 9.87 ± 1.01 |
EGCG | 90.58 ± 1.07 | 1.62 ± 0.12 |
3-Hydroxytyrosol | 45.33 ± 0.22 | >10 |
Quercetin c | 86.87 ± 4.48 | 3.16 ± 0.30 |
Tested Compounds | Binding Energy (XP Gscore, kcal/mol) | H-Bonding | π-π Interaction |
---|---|---|---|
Rosmarinic acid | −7.49 | Y198, D228, T231 | - |
EGCG | −10.23 | N37, Q73, K107, I126, D228 | F108 |
Oleuropein | −9.59 | G34, P70, Y198, G230 | - |
Quercetin | −9.04 | G34, V69, I126, Y198 | - |
Phenolic Compounds | IC08 Values (µM) |
---|---|
Rosmarinic acid | 546 ± 31.55 |
Gallic acid | 187 ± 7.11 |
Oleuropein | 171 ± 22.01 |
EGCG | 103 ±12.47 |
3-Hydroxytyrosol | 278 ± 12.21 |
Quercetin | 27 ± 5.30 |
(a) | |||||||
No. | Genes | Rosmarinic Acid | EGCG | Oleuropein | |||
Fold Regulation | p Value | Fold Regulation | p Value | Fold Regulation | p Value | ||
1 | APP | 1.01 | 0.987519 | 2.45 a | 0.09315 | 1.05 | 0.909799 |
2 | PSEN1 | 1.55 | 0.027961 | 1.75 | 0.016982 | −1.07 | 0.605031 |
3 | ABCA7 | −1.07 | 0.744866 | 1.60 | 0.028730 | 2.42 | 0.000844 |
4 | APOE | 1.45 | 0.201926 | 1.02 | 0.849047 | −1.33 | 0.2225886 |
5 | CLU | 1.11 | 0.494337 | 1.74 | 0.001902 | −1.78 | 0.004846 |
6 | PICALM | 1.32 | 0.88009 | 2.28 | 0.000377 | 1.43 | 0.055542 |
7 | BIN1 | 1.33 | 0.1070883 | 2.65 | 0.000730 | −1.14 | 0.435954 |
8 | CD2AP | 1.08 | 0.595778 | 2.12 | 0.001512 | 1.31 | 0.032858 |
9 | CR1 | 1.34 | 0.261793 | 3.02 | 0.010446 | 3.45 | 0.000003 |
10 | CD33 | 1.88 | 0.033980 | 3.47 | 0.008747 | 3.88 | 0.000002 |
11 | SORL1 | 1.23 | 0.357220 | 2.24 | 0.015080 | 1.90 | 0.003181 |
12 | MMP9 | 3.02 | 0.000025 | 7.86 | 0.000006 | 5.31 | 0.000001 |
13 | TNF | 1.75 | 0.099466 | 3.10 | 0.001685 | 2.09 | 0.047554 |
14 | CCL5 | 1.82 | 0.042974 | 3.10 | 0.000600 | 2.67 | 0.002246 |
15 | BACT | 1.00 | Nan | 1.00 | Nan | 1.00 | Nan |
(b) | |||||||
No. | Genes | Quercetin | 3-Hydroxytyrosol | Gallic acid | |||
Fold regulation | p Value | Fold Regulation | p Value | Fold Regulation | p Value | ||
1 | APP | 1.14 | 0.486887 | −1.07 | 0.531044 | 1.15 | 0.365962 |
2 | PSEN1 | 1.13 | 0.3988239 | −1.08 | 0.565985 | −1.11 | 0.459730 |
3 | ABCA7 | 1.82 | 0.003884 a | 1.82 | 0.0028886 | 1.55 | 0.083223 |
4 | APOE | −1.02 | 0.721477 | −1.17 | 0.419436 | −1.07 | 0.64335 |
5 | CLU | −1.09 | 0.427842 | 1.15 | 0.352617 | −1.11 | 0.437737 |
6 | PICALM | 1.26 | 0.16215 | 1.21 | 0.263041 | 1.22 | 0.259037 |
7 | BIN1 | 1.58 | 0.022014 | 1.87 | 0.000833 | 1.16 | 0.427674 |
8 | CD2AP | 1.36 | 0.044197 | 1.36 | 0.056017 | 1.15 | 0.351825 |
9 | CR1 | 2.20 | 0.04126 | 2.86 | 0.000826 | 2.20 | 0.025013 |
10 | CD33 | 2.29 | 0.006086 | 2.88 | 0.000687 | 2.40 | 0.020188 |
11 | SORL1 | 1.49 | 0.075158 | 1.81 | 0.008297 | 1.65 | 0.049611 |
12 | MMP9 | 4.31 | 0.000006 | 4.38 | 0.000010 | 3.14 | 0.003766 |
13 | TNF | 2.59 | 0.008301 | 2.04 | 0.030457 | 2.06 | 0.049659 |
14 | CCL5 | 2.38 | 0.007989 | 3.61 | 0.000005 | 1.92 | 0.033933 |
15 | BACT | 1.00 | Nan | 1.00 | Nan | 1.00 | Nan |
Genes | Advance Sequence | Back Sequence | Primer Adhesion Temperature (Annealing) (°C) |
---|---|---|---|
APP | GCCCTGCGGAATTGACAAG | CCATCTGCATAGTCTGTGTCTG | 62 |
PSEN1 | GCAGTATCCTCGCTGGTGAAGA | CAGGCTATGGTTGTGTTCCAGTC | 54.5 |
ABCA7 | CACTCTTCCGAGAGCTAGACAC | CTCCATATCTGTGTCCGCAGCA | 54.5 |
APOE | GGGTCGCTTTTGGGATTACCTG | CAACTCCTTCATGGTCTCGTCC | 54.5 |
CLU | TGCGGATGAAGGACCAGTGTGA | TTTCCTGGTCAACCTCTCAGCG | 54.5 |
PICALM | GGCAGCATTAGAGGAAGAACAGG | CTGCTGAGGTGGATACAGGAGA | 54.5 |
BIN1 | CGTCAACACGTTCCAGAGCATC | CTTGACCGTGAAGGTGTTGCTC | 54.5 |
CD2AP | CCAAAGCCTGAACTGATAGCTGC | GGACTTGTGGAGCTGCTGGTTT | 54.5 |
CR1 | TAGGTGTCAGCCTGGCTTTGTC | GACATCTGGAGGTGGCTGACAT | 54.5 |
CD33 | GTGACTACGGAGAGAACCATCC | GCTGTAACACCAGCTCCTCCAA | 54.5 |
SORL1 | GAACACCTGTCTTCGCAACCAG | TGTCCAGGTCACAGATGGTGGT | 54.5 |
MMP9 | GGGACGCAGACATCGTCATC | TCGTCATCGTCGAAATGGGC | 62 |
TNF | TGGGATCATTGCCCTGTGAG | GGTGTCTGAAGGAGGGGGTA | 62 |
CCL5 | CAGTCGTCTTTGTCACCCGA | AGAGCAAGCAGAAACAGGCA | 62 |
β-Actin | GCCGCCAGCTCACCAT | GATGCCTCTCTTGCTCTGGG | 59 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Uçar Akyürek, T.; Orhan, I.E.; Şenol Deniz, F.S.; Eren, G.; Acar, B.; Sen, A. Evaluation of Selected Plant Phenolics via Beta-Secretase-1 Inhibition, Molecular Docking, and Gene Expression Related to Alzheimer’s Disease. Pharmaceuticals 2024, 17, 1441. https://doi.org/10.3390/ph17111441
Uçar Akyürek T, Orhan IE, Şenol Deniz FS, Eren G, Acar B, Sen A. Evaluation of Selected Plant Phenolics via Beta-Secretase-1 Inhibition, Molecular Docking, and Gene Expression Related to Alzheimer’s Disease. Pharmaceuticals. 2024; 17(11):1441. https://doi.org/10.3390/ph17111441
Chicago/Turabian StyleUçar Akyürek, Tugba, Ilkay Erdogan Orhan, F. Sezer Şenol Deniz, Gokcen Eren, Busra Acar, and Alaattin Sen. 2024. "Evaluation of Selected Plant Phenolics via Beta-Secretase-1 Inhibition, Molecular Docking, and Gene Expression Related to Alzheimer’s Disease" Pharmaceuticals 17, no. 11: 1441. https://doi.org/10.3390/ph17111441
APA StyleUçar Akyürek, T., Orhan, I. E., Şenol Deniz, F. S., Eren, G., Acar, B., & Sen, A. (2024). Evaluation of Selected Plant Phenolics via Beta-Secretase-1 Inhibition, Molecular Docking, and Gene Expression Related to Alzheimer’s Disease. Pharmaceuticals, 17(11), 1441. https://doi.org/10.3390/ph17111441