Lycopene from Red Guava (Psidium guajava L.): From Hepatoprotective Effect to Its Use as Promising Self-Emulsifying Drug Delivery System for Anti-Inflammatory and Antioxidant Applications
Abstract
1. Introduction
2. Results
2.1. Characterization of LEG and LPG
2.2. Thermodynamic Stability of nanoLPG
2.3. Effect of LEG on Liver Function and Histopathological Parameters of Hypercholesterolemic Hamsters
2.4. LPG Cytotoxicity against Vero Cells
2.5. Cytotoxic and Antioxidant Effects of LPG and nanoLPG on Human Keratinocytes
2.6. Vascular Antioxidant Effects of LPG and nanoLPG on Pyrogallol-Induced Endothelial Dysfunction in Isolated Rat Aorta
2.7. Effects of nanoLPG on the Expression of Immune-Related Genes in Human Peripheral Blood Mononuclear Cells (PBMCs) of Health Donors
3. Discussion
4. Material and Methods
4.1. Lycopene-Rich Extract from Red Guava (LEG), Purified Lycopene from Red Guava (LPG) and the Self-Emulsifying Drug Delivery System Loaded with Purified Lycopene from Red Guava (nanoLPG)
4.1.1. Samples
4.1.2. Characterization of nanoLPG
4.1.3. Thermodynamic Stability of nanoLPG
4.2. Blood Markers Indicative of Liver Function and Histopathological Study in Hypercholesterolemic Hamsters Treated with LEG
4.2.1. Ethical Aspects
4.2.2. Animals
4.2.3. Effect of LEG on Liver Function
4.2.4. Effect of LPG on Morphological Changes of the Liver
4.3. LPG Cytotoxicity Assays on Vero Cells
4.3.1. Cell Culture
4.3.2. Cristal Violet Assay
4.3.3. Evaluation of Vero Cell Viability by the LIVE/DEADTM Viability/Cytotoxicity Kit
4.4. Cytotoxic and Antioxidant Effects of LPG and nanoLPG on Human Keratinocytes
4.4.1. Cell Culture
4.4.2. MTT Assay
4.4.3. Intracellular ROS Scavenging Activity
4.5. Effects of LPG and nanoLPG on Pyrogallol-Induced Endothelial Dysfunction in Isolated Rat Aorta
4.5.1. Ethical Aspects
4.5.2. Animals
4.5.3. Preparation of Aortic Rings and Vascular Reactivity
4.6. Effect of nanoLPG on Immune-Related Gene Expression in Human Peripheral Blood Mononuclear Cells (PBMCs)
4.6.1. Obtaining Human PBMCs
4.6.2. Exposition of Human PBMCs to nanoLPG, RNA Extraction and cDNA Synthesis
4.6.3. Real-Time PCR
4.7. Statistical Processing
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jin, Y.; Arroo, R. The protective effects of flavonoids and carotenoids against diabetic complications-A review of in vivo evidence. Front. Nutr. 2023, 10, 1020950. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ribeiro, D.; Freitas, M.; Silva, A.M.S.; Carvalho, F.; Fernandes, E. Antioxidant and pro-oxidant activities of carotenoids and their oxidation products. Food Chem. Toxicol. 2018, 120, 681–699. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zakynthinos, G.; Varzakas, T. Carotenoids: From Plants to Food Industry. Curr. Res. Nutr. Food Sci. 2016, 4, 38–51. [Google Scholar] [CrossRef] [Scilit]
- Batool, Z.; Chen, J.H.; Gao, Y.; Lu, L.W.; Xu, H.; Liu, B.; Wang, M.; Chen, F. Natural Carotenoids as Neuroprotective Agents for Alzheimer’s Disease: An Evidence-Based Comprehensive Review. J. Agric. Food Chem. 2022, 70, 15631–15646. [Google Scholar] [CrossRef] [Scilit]
- Milani, A.; Basirnejad, M.; Shahbazi, S.; Bolhassani, A. Carotenoids: Biochemistry, pharmacology and treatment. Br. J. Pharmacol. 2017, 174, 1290–1324. [Google Scholar] [CrossRef] [Scilit]
- Mutsokoti, L.; Panozzo, A.; Tongonya, J.; Kebede, B.T.; Van Loey, A.; Hendrickx, M. Carotenoid Stability and Lipid Oxidation during Storage of Low-Fat Carrot and Tomato Based Systems. LWT-Food Sci. Technol. 2017, 80, 470–478. [Google Scholar] [CrossRef] [Scilit]
- Rao, A.V.; Agarwal, S. Role of Lycopene as Antioxidant Carotenoid in the Prevention of Chronic Diseases: A Review. Nutr. Res. 1999, 19, 305–323. [Google Scholar] [CrossRef] [Scilit]
- Di Mascio, P.; Kaiser, S.; Sies, H. Lycopene as the Most Efficient Biological Carotenoid Singlet Oxygen Quencher. Arch. Biochem. Biophys. 1989, 274, 532–538. [Google Scholar] [CrossRef] [Scilit]
- Islamian, J.P.; Mehrali, H. Lycopene as a Carotenoid Provides Radioprotectant and Antioxidant Effects by Quenching Radiation-Induced Radical Singlet Oxygen: An Overview. Cell J. (Yakhteh) 2015, 16, 386. [Google Scholar] [CrossRef] [Scilit]
- Krinsky, N.I.; Johnson, E.J. Carotenoid Actions and Their Relation to Health and Disease. Mol. Asp. Med. 2005, 26, 459–516. [Google Scholar] [CrossRef] [Scilit]
- Kruk, J.; Aboul-Enein, H.Y. Reactive Oxygen and Nitrogen Species in Carcinogenesis: Implications of Oxidative Stress on the Progression and Development of Several Cancer Types. Mini Rev. Med. Chem. 2017, 17, 904–919. [Google Scholar] [CrossRef] [Scilit]
- Fiedor, J.; Burda, K. Potential Role of Carotenoids as Antioxidants in Human Health and Disease. Nutrients 2014, 6, 466–488. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ejike, D.E.; Adam, M.A.; Sheu, O.S.; Nganda, P.; Iliya, E.; Moses, D.A.; Alfred, O.O.; Karimah. Lycopene Attenuates Diabetes-Induced Oxidative Stress in Wistar Rats. J. Diabetes Endocrinol. 2018, 9, 11–19. [Google Scholar] [CrossRef] [Scilit]
- Hedayati, N.; Naeini, M.B.; Nezami, A.; Hosseinzadeh, H.; Wallace Hayes, A.; Hosseini, S.; Imenshahidi, M.; Karimi, G. Protective Effect of Lycopene against Chemical and Natural Toxins: A Review. BioFactors (Oxf. Engl.) 2019, 45, 5–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Przybylska, S. Lycopene – a bioactive carotenoid offering multiple health benefits: A review. Int. J. Food Sci. Technol. 2020, 55, 11–32. [Google Scholar] [CrossRef] [Scilit]
- Watzl, B.; Bub, A.; Blockhaus, M.; Rechkemmer, G.; Herbert, B.M.; Lührmann, P.M.; Neuhäuser-Berthold, M. Prolonged Tomato Juice Consumption Has No Effect on Cell-Mediated Immunity of Well-Nourished Elderly Men and Women. J. Nutr. 2000, 130, 1719–1723. [Google Scholar] [CrossRef] [Scilit]
- Riso, P.; Visioli, F.; Grande, S.; Guarnieri, S.; Gardana, C.; Simonetti, P.; Porrini, M. Effect of a Tomato-Based Drink on Markers of Inflammation, Immunomodulation, and Oxidative Stress. J. Agric. Food Chem. 2006, 54, 2563–2566. [Google Scholar] [CrossRef] [Scilit]
- Colle, I.J.; Lemmens, L.; Van Buggenhout, S.; Met, K.; Van Loey, A.M.; Hendrickx, M.E. Processing Tomato Pulp in the Presence of Lipids: The Impact on Lycopene Bioaccessibility. Food Res. Int. 2013, 51, 32–38. [Google Scholar] [CrossRef] [Scilit]
- Amorim, A.G.N.; Souza, J.M.T.; Santos, R.C.; Gullón, B.; Oliveira, A.; Santos, L.F.A.; Virgino, A.L.E.; Mafud, A.C.; Petrilli, H.M.; Mascarenhas, Y.P.; et al. HPLC-DAD, ESI–MS/MS, and NMR of lycopene isolated from p. guajava l. and its biotechnological applications. Eur. J. Lipid Sci. Technol. 2018, 120, 1700330. [Google Scholar] [CrossRef] [Scilit]
- El-Raey, M.A.; Ibrahim, G.E.; Eldahshan, O.A. Lycopene and Lutein; A Review for Their Chemistry and Medicinal Uses. J. Pharmacogn. Phytochem. 2013, 2, 245–254. [Google Scholar]
- Amorim, A.G.N.; Leite, J.R.S.A.; Ropke, C.D. Obtenção de Extrato Rico Em Licopeno e Licopeno Puro de Fonte Natural. Patent number BR 102016030594-2, 26 December 2016. [Google Scholar]
- Amorim, A.G.N.; Leite, J.R.S.A.; Pintado, M.E. Obtainment Process of Carotenoids Concentrate Rich in Lycopene from Red Fruits and/or Red Fruit Pulp. Patent number EP 3400812, 9 May 2018. [Google Scholar]
- Vasconcelos, A.G.; Amorim, A.D.G.; dos Santos, R.C.; Souza, J.M.T.; de Souza, L.K.M.; Araújo, T.D.S.; Nicolau, L.A.D.; Carvalho, L.D.L.; de Aquino, P.E.A.; Martins, C.D.S.; et al. Lycopene Rich Extract from Red Guava (Psidium guajava L.) Displays Anti-Inflammatory and Antioxidant Profile by Reducing Suggestive Hallmarks of Acute Inflammatory Response in Mice. Food Res. Int. 2017, 99 Pt 2, 959–968. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Santos, R.C.; Ombredane, A.S.; Souza, J.M.T.; Vasconcelos, A.G.; Plácido, A.; Amorim, A.D.G.; Barbosa, E.A.; Lima, F.C.D.A.; Ropke, C.D.; Alves, M.M.; et al. Lycopene-Rich Extract from Red Guava (Psidium guajava L.) Displays Cytotoxic Effect against Human Breast Adenocarcinoma Cell Line MCF-7 via an Apoptotic-like Pathway. Food Res. Int. 2018, 105, 184–196. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brito, A.K.d.S.; Lima, G.d.M.; de Farias, L.M.; Rodrigues, L.A.R.L.; de Carvalho, V.B.L.; Pereira, C.F.d.C.; Frota, K.d.M.G.; Conde-Júnior, A.M.; Silva, A.M.O.; Rizzo, M.d.S.; et al. Lycopene-Rich Extract from Red Guava (Psidium guajava L.) Decreases Plasma Triglycerides and Improves Oxidative Stress Biomarkers on Experimentally-Induced Dyslipidemia in Hamsters. Nutrients 2019, 11, 393. [Google Scholar] [CrossRef] [Scilit]
- Carvalho, G.C.; Sábio, R.M.; Chorilli, M. An Overview of Properties and Analytical Methods for Lycopene in Organic Nanocarriers. Crit. Rev. Anal. Chem. 2021, 51, 674–686. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chernyshova, M.P.; Pristenskiy, D.V.; Lozbiakova, M.V.; Chalyk, N.E.; Bandaletova, T.Y.; Petyaev, I.M. Systemic and Skin-Targeting Beneficial Effects of Lycopene-Enriched Ice Cream: A Pilot Study. J. Dairy Sci. 2019, 102, 14–25. [Google Scholar] [CrossRef] [Scilit]
- Rein, M.J.; Renouf, M.; Cruz-Hernandez, C.; Actis-Goretta, L.; Thakkar, S.K.; da Silva Pinto, M. Bioavailability of Bioactive Food Compounds: A Challenging Journey to Bioefficacy. Br. J. Clin. Pharmacol. 2013, 75, 588–602. [Google Scholar] [CrossRef] [Scilit]
- Srivastava, S.; Srivastava, A.K. Lycopene; Chemistry, Biosynthesis, Metabolism and Degradation under Various Abiotic Parameters. J. Food Sci. Technol. 2015, 52, 41–53. [Google Scholar] [CrossRef] [Scilit]
- Vasconcelos, A.G.; Barros, A.L.A.N.; Cabral, W.F.; Moreira, D.C.; da Silva, I.G.M.; Silva-Carvalho, A.; de Almeida, M.P.; Albuquerque, L.F.F.; dos Santos, R.C.; Brito, A.K.S.; et al. Promising Self-Emulsifying Drug Delivery System Loaded with Lycopene from Red Guava (Psidium guajava L.): In Vivo Toxicity, Biodistribution and Cytotoxicity on DU-145 Prostate Cancer Cells. Cancer Nanotechnol. 2021, 12, 30. [Google Scholar] [CrossRef] [Scilit]
- Vasconcelos, A.G.; Valim, M.O.; Amorim, A.G.; do Amaral, C.P.D.; de Almeida, M.P.; Borges, T.K.; Socodato, R.; Portugal, C.; Brand, G.D.; Mattos, J.S.C.; et al. Cytotoxic Activity of Poly-ɛ-Caprolactone Lipid-Core Nanocapsules Loaded with Lycopene-Rich Extract from Red Guava (Psidium guajava L.) on Breast Cancer Cells. Food Res. Int. 2020, 136, 109548. [Google Scholar] [CrossRef] [Scilit]
- Lee, M.T.; Chen, B.H. Stability of Lycopene during Heating and Illumination in a Model System. Food Chem. 2002, 78, 425–432. [Google Scholar] [CrossRef] [Scilit]
- Klang, V.; Valenta, C. Lecithin-Based Nanoemulsions. J. Drug Deliv. Sci. Technol. 2011, 21, 55–76. [Google Scholar] [CrossRef] [Scilit]
- De Abreu, I.C.M.E.; Guerra, J.F.D.C.; Pereira, R.R.; Silva, M.; Lima, W.; Silva, M.E.; Pedrosa, M.L. Hypercholesterolemic diet induces hepatic steatosis and alterations in mRNA expression of NADPH oxidase in rat livers. Arq. Bras. Endocrinol. Metabol. 2014, 58, 251–259. [Google Scholar] [CrossRef] [Scilit]
- Mailer, R.K.W.; Gisterå, A.; Polyzos, K.A.; Ketelhuth, D.F.J.; Hansson, G.K. Hypercholesterolemia Induces Differentiation of Regulatory T Cells in the Liver. Circ. Res. 2017, 120, 1740–1753. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, H.; Li, L.; Deng, Y.; Song, G.; Wang, Y. Protective effects of lycopene on TiO2 nanoparticle-induced damage in the liver of mice. J. Appl. Toxicol. 2023, 43, 913–928. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Micronutrients, Institute of Medicine (US) Panel on. Dietary Reference Intakes for Vitamin A, Vitamin K, Arsenic, Boron, Chromium, Copper, Iodine, Iron, Manganese, Molybdenum, Nickel, Silicon, Vanadium, and Zinc; The National Academies Press: Washington, DC, USA, 2001. [Google Scholar] [CrossRef] [Scilit]
- Institute of Medicine. Dietary Reference Intakes for Vitamin C, Vitamin E, Selenium, and Carotenoids; National Academies Press: Washington, DC, USA, 2000. [Google Scholar] [CrossRef] [Scilit]
- Amorim, A.G.; Souza, J.; Oliveira, A.; Santos, R.; Vasconcelos, A.; Souza, L.; Araujo, T.; Cabral, W.; Silva, M.; Mafud, A.; et al. Anti-Inflammatory and Antioxidant Activity Improvement of Lycopene from Guava on Nanoemulsifying System. J. Dispers. Sci. Technol. 2020, 42, 760–770. [Google Scholar] [CrossRef] [Scilit]
- Baba, T.; Hanada, K.; Hashimoto, I. The Study of Ultraviolet B-Induced Apoptosis in Cultured Mouse Keratinocytes and in Mouse Skin. J. Dermatol. Sci. 1996, 12, 18–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Henseleit, U.; Rosenbach, T.; Kolde, G. Induction of Apoptosis in Human HaCaT Keratinocytes. Arch. Dermatol. Res. 1996, 288, 676–683. [Google Scholar] [CrossRef] [PubMed]
- Kannan, K.; Jain, S.K. Oxidative Stress and Apoptosis. Pathophysiol. Off. J. Int. Soc. Pathophysiol. 2000, 7, 153–163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, H.; Oehrl, W.; Elsner, P.; Thiele, J.J. The Role of H2O2 as a Mediator of UVB-Induced Apoptosis in Keratinocytes. Free Radic. Res. 2003, 37, 655–663. [Google Scholar] [CrossRef] [Scilit]
- Koul, A.; Bansal, M.P.; Aniqa, A.; Chaudhary, H.; Chugh, N.A. Lycopene Enriched Tomato Extract Suppresses Chemically Induced Skin Tumorigenesis in Mice. International Journal for Vitamin and Nutrition Research. Internationale Zeitschrift Fur Vitamin- Und Ernahrungsforschung. J. Int. Vitaminol. Nutr. 2020, 90, 493–513. [Google Scholar] [CrossRef] [Scilit]
- Ascenso, A.; Ribeiro, H.; Marques, H.C.; Oliveira, H.; Santos, C.; Simões, S. Chemoprevention of Photocarcinogenesis by Lycopene. Exp. Dermatol. 2014, 23, 874–878. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, P.; Xu, S.; Qu, J. Lycopene Protects Keratinocytes Against UVB Radiation-Induced Carcinogenesis via Negative Regulation of FOXO3a through the MTORC2/AKT Signaling Pathway. J. Cell. Biochem. 2018, 119, 366–377. [Google Scholar] [CrossRef] [Scilit]
- Cooperstone, J.L.; Tober, K.L.; Riedl, K.M.; Teegarden, M.D.; Cichon, M.J.; Francis, D.M.; Schwartz, S.J.; Oberyszyn, T.M. Tomatoes Protect against Development of UV-Induced Keratinocyte Carcinoma via Metabolomic Alterations. Sci. Rep. 2017, 7, 5106. [Google Scholar] [CrossRef] [Scilit]
- Cheng, H.M.; Koutsidis, G.; Lodge, J.K.; Ashor, A.W.; Siervo, M.; Lara, J. Lycopene and tomato and risk of cardiovascular diseases: A systematic review and meta-analysis of epidemiological evidence. Crit. Rev. Food Sci. Nutr. 2019, 59, 141–158. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, N.; Wu, X.; Zhuang, W.; Xia, L.; Chen, Y.; Wu, C.; Rao, Z.; Du, L.; Zhao, R.; Yi, M.; et al. Tomato and lycopene and multiple health outcomes: Umbrella review. Food Chem. 2021, 343, 128396. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duan, H.; Zhang, Q.; Liu, J.; Li, R.; Wang, D.; Peng, W.; Wu, C. Suppression of apoptosis in vascular endothelial cell, the promising way for natural medicines to treat atherosclerosis. Pharmacol. Res. 2021, 168, 105599. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mozos, I.; Stoian, D.; Caraba, A.; Malainer, C.; Horbańczuk, J.O.; Atanasov, A.G. Lycopene and Vascular Health. Front. Pharmacol. 2018, 9, 521. [Google Scholar] [CrossRef] [Scilit]
- Zhu, N.W.; Yin, X.L.; Lin, R.; Fan, X.L.; Chen, S.J.; Zhu, Y.M.; Zhao, X.Z. Possible mechanisms of lycopene amelioration of learning and memory impairment in rats with vascular dementia. Neural Regen. Res. 2020, 15, 332–341. [Google Scholar] [CrossRef] [Scilit]
- Bergman, M.; Djaldetti, M.; Salman, H.; Bessler, H. On the Combined Effect of Statins and Lycopene on Cytokine Production by Human Peripheral Blood Cells. Heart Vessel. 2010, 25, 426–431. [Google Scholar] [CrossRef] [Scilit]
- Bessler, H.; Salman, H.; Bergman, M.; Alcalay, Y.; Djaldetti, M. In Vitro Effect of Lycopene on Cytokine Production by Human Peripheral Blood Mononuclear Cells. Immunol. Investig. 2008, 37, 183–190. [Google Scholar] [CrossRef] [Scilit]
- Huang, C.-S.; Chuang, C.-H.; Lo, T.-F.; Hu, M.-L. Anti-Angiogenic Effects of Lycopene through Immunomodualtion of Cytokine Secretion in Human Peripheral Blood Mononuclear Cells. J. Nutr. Biochem. 2013, 24, 428–434. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bonvissuto, G.; Minutoli, L.; Morgia, G.; Bitto, A.; Polito, F.; Irrera, N.; Marini, H.; Squadrito, F.; Altavilla, D. Effect of Serenoa Repens, Lycopene, and Selenium on Proinflammatory Phenotype Activation: An in Vitro and in Vivo Comparison Study. Urology 2011, 77, 248.e9–248.e16. [Google Scholar] [CrossRef] [Scilit]
- Cha, J.H.; Kim, W.K.; Ha, A.W.; Kim, M.H.; Chang, M.J. Anti-Inflammatory Effect of Lycopene in SW480 Human Colorectal Cancer Cells. Nutr. Res. Pract. 2017, 11, 90–96. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, J.; Li, W.; Cheng, L.M.; Wang, G.G. Lycopene Attenuates LPS-Induced Liver Injury by Inactivation of NF-ΚB/COX-2 Signaling. Int. J. Clin. Exp. Pathol. 2019, 12, 817. [Google Scholar] [PubMed]
- Hazewindus, M.; Haenen, G.R.M.M.; Weseler, A.R.; Bast, A. Protection against Chemotaxis in the Anti-Inflammatory Effect of Bioactives from Tomato Ketchup. PLoS ONE 2014, 9, e114387. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Makon-Sébastien, N.; Francis, F.; Eric, S.; Henri, V.P.; François, L.J.; Laurent, P.; Yves, B.; Serge, C. Lycopene Modulates THP1 and Caco-2 Cells Inflammatory State through Transcriptional and Nontranscriptional Processes. Mediat. Inflamm. 2014, 2014, 507272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marcotorchino, J.; Romier, B.; Gouranton, E.; Riollet, C.; Gleize, B.; Malezet-Desmoulins, C.; Landrier, J.-F. Lycopene Attenuates LPS-Induced TNF-α Secretion in Macrophages and Inflammatory Markers in Adipocytes Exposed to Macrophage-Conditioned Media. Mol. Nutr. Food Res. 2012, 56, 725–732. [Google Scholar] [CrossRef] [Scilit]
- Lin, H.-Y.; Huang, B.-R.; Yeh, W.-L.; Lee, C.-H.; Huang, S.-S.; Lai, C.-H.; Lin, H.; Lu, D.-Y. Antineuroinflammatory Effects of Lycopene via Activation of Adenosine Monophosphate-Activated Protein Kinase-A1/Heme Oxygenase-1 Pathways. Neurobiol. Aging 2014, 35, 191–202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Azeem, A.; Rizwan, M.; Ahmad, F.; Iqbal, Z.; Khar, R.K.; Aqil, M.; Talegaonkar, S. Nanoemulsion Components Screening and Selection: A Technical Note. AAPS PharmSciTech 2009, 10, 69–76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Ritis, F.; Caltori, M.; Giusti, G. Serum tranaminase activities in liver disease. Lancet 2017, 1, 685–687. [Google Scholar] [CrossRef] [Scilit]
- Farias, L.M.; Brito, A.K.D.S.; Oliveira, A.S.D.S.S.; Lima, G.D.M.; Rodrigues, L.A.R.L.; de Carvalho, V.B.L.; Cunha, F.V.M.; Pereira, C.F.D.C.; Rizzo, M.D.S.; Nunes, P.H.M.; et al. Hypotriglyceridemic and hepatoprotective effect of pumpkin (Cucurbita moschata) seed flour in an experimental model of dyslipidemia. S. Afr. J. Bot. 2022, 151, 484–492. [Google Scholar] [CrossRef] [Scilit]
- Arcanjo, D.D.R.; Vasconcelos, A.G.; Comerma-Steffensen, S.G.; Jesus, J.R.; Silva, L.P.; Pires, O.R.; Costa-Neto, C.M.; Oliveira, E.B.; Migliolo, L.; Franco, O.L.; et al. A Novel Vasoactive Proline-Rich Oligopeptide from the Skin Secretion of the Frog Brachycephalus ephippium. PLoS ONE 2015, 10, e0145071. [Google Scholar] [CrossRef] [Scilit]
- Bangshaab, M.; Gutierrez, A.; Huynh, K.D.; Knudsen, J.S.; Arcanjo, D.; Petersen, A.G.; Rungby, J.; Gejl, M.; Simonsen, U. Different mechanisms involved in liraglutide and glucagon-like peptide-1 vasodilatation in rat mesenteric small arteries. Br. J. Pharmacol. 2019, 176, 386–399. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Furtado, M.M.; Rocha, J.L.; Mendes, A.V.d.S.; Neto, R.S.M.; Brito, A.K.D.S.; de Almeida, J.O.C.S.; Queiroz, E.I.R.; França, J.V.d.S.; Sales, A.L.D.C.C.; Vasconcelos, A.G.; et al. Effects of ω-3 PUFA-Rich Oil Supplementation on Cardiovascular Morphology and Aortic Vascular Reactivity of Adult Male Rats Submitted to an hypercholesterolemic diet. Biology 2022, 11, 202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego Calif.) 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Pfaffl, M.W. A New Mathematical Model for Relative Quantification in Real-Time RT-PCR. Nucleic Acids Res. 2001, 29, E45. [Google Scholar] [CrossRef] [Scilit]









| Parameter | No Stress (Day 0) | No Stress (Day 60) | Thermal Stress (Day 30) |
|---|---|---|---|
| Size (nm) | 258.60 ± 4.65 | 263.00 ± 5.76 | 243.30 ± 3.51 |
| PDI | 0.22 ± 0.00 | 0.23 ± 0.01 | 0.19 ± 0.02 |
| Zeta Potential (mV) | −39.20 ± 1.46 | −34.10 ± 1.27 | −37.60 ± 1.27 |
| Macroscopic aspect | Intense orange-coloured, turbid, milky liquid, homogeneous | Intense orange-coloured, turbid, milky liquid homogeneous | Weaker colour, turbid, creamy, phase separation |
| Gene | Forward | Reverse |
|---|---|---|
| COX-2 | GAAGTTGGCAGCAAATTGAGC | TTCTCCTGTGAAGGCGATGA |
| IFN-γ | ACTGTCGCCAGCAGCTAAAA | TATTGCAGGCAGGACAACCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alves, M.B.; Vasconcelos, A.G.; Silva de Carvalho, A.É.; Slompo, R.C.; Sá, B.S.; Gonçalves, M.J.L.; Lima Moura, L.N.R.d.C.; Brito, A.K.d.S.; França, J.V.d.S.; Martins, M.d.C.d.C.e.; et al. Lycopene from Red Guava (Psidium guajava L.): From Hepatoprotective Effect to Its Use as Promising Self-Emulsifying Drug Delivery System for Anti-Inflammatory and Antioxidant Applications. Pharmaceuticals 2023, 16, 905. https://doi.org/10.3390/ph16060905
Alves MB, Vasconcelos AG, Silva de Carvalho AÉ, Slompo RC, Sá BS, Gonçalves MJL, Lima Moura LNRdC, Brito AKdS, França JVdS, Martins MdCdCe, et al. Lycopene from Red Guava (Psidium guajava L.): From Hepatoprotective Effect to Its Use as Promising Self-Emulsifying Drug Delivery System for Anti-Inflammatory and Antioxidant Applications. Pharmaceuticals. 2023; 16(6):905. https://doi.org/10.3390/ph16060905
Chicago/Turabian StyleAlves, Maíra Bernardes, Andreanne Gomes Vasconcelos, Amandda Évelin Silva de Carvalho, Robson Camilotti Slompo, Bruno Silva Sá, Maria Júlia Lima Gonçalves, Liz Nayara Ribeiro da Costa Lima Moura, Ana Karolinne da Silva Brito, José Vinícius de Sousa França, Maria do Carmo de Carvalho e Martins, and et al. 2023. "Lycopene from Red Guava (Psidium guajava L.): From Hepatoprotective Effect to Its Use as Promising Self-Emulsifying Drug Delivery System for Anti-Inflammatory and Antioxidant Applications" Pharmaceuticals 16, no. 6: 905. https://doi.org/10.3390/ph16060905
APA StyleAlves, M. B., Vasconcelos, A. G., Silva de Carvalho, A. É., Slompo, R. C., Sá, B. S., Gonçalves, M. J. L., Lima Moura, L. N. R. d. C., Brito, A. K. d. S., França, J. V. d. S., Martins, M. d. C. d. C. e., Rizzo, M. d. S., Soares, S., Bastos, V., Saldanha de Araujo, F., Mogharbel, B. F., Carvalho, K. A. T. d., Oliveira, H., Plácido, A., Arcanjo, D. D. R., ... Leite, J. R. d. S. d. A. (2023). Lycopene from Red Guava (Psidium guajava L.): From Hepatoprotective Effect to Its Use as Promising Self-Emulsifying Drug Delivery System for Anti-Inflammatory and Antioxidant Applications. Pharmaceuticals, 16(6), 905. https://doi.org/10.3390/ph16060905

