Next Article in Journal
Occurrence of Novel and Legacy Per/Polyfluoroalkyl Substances (PFASs) in Scopoli’s Shearwater (Calonectris diomedea) Feathers
Previous Article in Journal
Fungal Bioluminescence: Past, Present, and Future
Previous Article in Special Issue
Ground Beetle (Coleoptera: Carabidae) Assemblages in Hazelnut Groves in Calabria (Southern Italy)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Arachnid Assemblage Composition Diverge between South- and North-Facing Slopes in a Levantine Microgeographic Site †

1
The National Natural History Collections, Edmond J. Safra Campus, Giva’at Ram, The Hebrew University of Jerusalem, Jerusalem 9190401, Israel
2
Department of Zoology, University of Veterinary Medicine Budapest, Rottenbiller Street 50, 1077 Budapest, Hungary
*
Authors to whom correspondence should be addressed.
urn:lsid:zoobank.org:pub:CC846A98-A73C-4B4D-9B39-240E5870E0E7.
Diversity 2024, 16(9), 540; https://doi.org/10.3390/d16090540
Submission received: 4 July 2024 / Revised: 17 August 2024 / Accepted: 22 August 2024 / Published: 3 September 2024
(This article belongs to the Special Issue State-of-the-Art Mediterranean Soil Arthropods Diversity)

Abstract

Local microgeographic sites subdivided by sharp ecological and climatic contrasts are important platforms for measuring biodiversity patterns and inferring the possible effect of climatic and ecological variables on species distributions and habitat use. Here, we report results from 24 months (September 2019–August 2021) of continuous pitfall trapping collection in Lower Nahal Keziv, Western Upper Galilee, Israel (“Evolution Canyon” II (hereafter—EC II)). This site receives an average annual rainfall of 784 mm and contains two slopes that differ markedly by solar radiation and plant formation. The first is the south-facing slope (SFS), which is characterized as a semiarid garrigue and open grassland. The second is the contrasting north-facing slope (NFS), which is characterized by a more humid East Mediterranean forest. The slopes are separated by a narrow valley bottom (VB). Analysis of ca. 1750 arachnid specimens, collected from 70 pitfall traps along the slopes and valley, indicates significantly different arachnid assemblages between the NFS and SFS, likely due to the differences in solar radiation that affect plant-cover percentage, which in turn affects the arachnid assemblage composition. In addition to 98 arachnid taxa collected and identified to species and morphospecies level, this study resulted in the discovery of two species new to science, which are described as part of this publication (100 arachnid species and 11 additional taxa that were not identified to species, a total of 111 taxa). Our study, moreover, contributes new ecological data on the spatial and temporal distribution of arachnids, and therefore attests to the importance of year-round sampling in an understudied region. Overall, our study enables a better understanding of arachnid diversity and their distributions and serves as a reference for future research aimed at testing the effect of climate change and other environmental factors that influence arachnid assemblages in natural habitats.

Graphical Abstract

1. Introduction

Various factors at different spatial and temporal scales are involved in determining the species richness in a specific habitat [1,2]. At the regional scale, historical biogeography, geology, long-distance dispersal, extinction, and speciation processes affect the distribution of species and creates the regional species-pool [3,4,5,6]. Climatic conditions together with additional local biotic and abiotic conditions further determine the local species richness and assemblage composition [7]. Yet, there is no single factor that is responsible for determining which species from the regional species-pool will be found in a specific habitat or site. At the microscale, many environmental factors are similar, and sites subdivided by sharp contrasts of few biotic or abiotic conditions can be used to infer factors affecting biodiversity patterns between habitats in the same site. For example, the south-facing slopes (SFSs) of canyons north of the equator receive higher solar radiation than on the nearby north-facing slopes (NFSs) [8]. If rocks, soil, and topography are similar on the opposite slopes, microclimate remains the major interslope divergent factor. It is suggested that higher temperature and lower soil moisture content in SFSs, in comparison to NFSs, may cause remarkable biotic contrasts at the microscale [9,10].
An example of a long-term research project that studied natural habitats at microscale with sharp contrast is “Evolution Canyon” [11,12,13,14,15,16,17], where the effect of solar radiation on species composition was tested across taxonomic ranks in geographically close habitats. This study found that illumination was 300% higher in the SFS than NFS in the Karmel (Israel, “Evolution Canyon” [9]), and soil moisture content was higher in the NFS than the SFS in the Galilee (Israel, “Evolution Canyon II”, hereafter ECII), although it was affected by seasonality, with lower soil moisture content in the summer [17]. These differences were found to significantly affect the biodiversity composition of the NFS and SFS in the Mediterranean part of Israel [11,12,13,14,15,16,17]. The dry, warm, xeric SFS was found to be richer in terrestrial taxa than the NFS. In contrast, the cooler, mesic NFS was found to be richer in reproductively water-dependent lower plants and fungi than the SFS. Specifically, ECII sampling of plants, microfungi, beetles, and ants (1999–2001) revealed sharp interslope differences with significantly higher species richness in the SFS compared to the NFS: in plants (SFS: 205—NFS: 54) [14], microfungi (SFS: 149—NFS: 78) [17], beetles (SFS: 307—NFS: 198) [15], and ants (SFS: 19—NFS: 12) [16]. These findings were consistent in bacteria, plants, and animals, and suggests that such systems can be used to infer the effect of climate warming on species distribution and habitat use, at least in the Levant [18].
The Levant, a region at the junction of three continents (Africa, Asia, and Europe), is a species-rich biogeographic unit due to its geographic position. It includes three climate zones: Mediterranean, steppe, and desert, along with diverse habitats and different phytogeographical and zoogeographical zones. The most widespread zoogeographical element in the Levant is Palaearctic, which is found in the north and central areas of Israel, and mostly follows the Mediterranean phytogeograpical zone and climate. However, animals and plants of Palaeoeremic and Oriental zoogeographical elements, and Saharo-Arabian phytogeograpical distributions, respectively, can be found in the SFS in the coastal plain, Galilee, and high mountains of Israel [19,20]. It is very frequent to find in the Mediterranean region of the Levant, canyons with slopes contrasting in solar radiation.
As the solar radiation affects plant formation and plant diversity, it may also indirectly affect the arthropod species diversity. For example, plant species richness and vegetation structure [21,22,23], as well as prey availability, are the main factors that are used to explain spider and other arthropod species richness worldwide [24,25]. Several studies have tested the effect of spatial and seasonal changes of spider assemblages in Mediterranean habitats [26,27,28,29,30,31,32,33], yet only a few published studies have focused on spider diversity in natural habitats of the southeastern Levant (Israel and Palestine) [34,35,36,37]. Among those, only two were conducted in the Mediterranean region [34,36], and none conducted in a site where sharp radiation contrasts were tested. Moreover, it is infrequent to find studies testing the effect of climate (or proxies) on arachnid alpha and beta diversity at a local scale over a consecutive sampling (see [31], although not on a local scale). Here, we aimed to test if arachnid assemblage composition is affected by the sharp solar radiation and vegetation cover contrasts of two slopes of a canyon in the Galilee, Israel, over two years of consecutive sampling. We hypothesize that seasonality, slope, and microhabitat all significantly affect the arachnid assemblage composition, with higher species diversity in the SFS compared to the NFS.

2. Materials and Methods

2.1. The Study Area

The study was conducted in the lower part of Nahal (stream) Keziv, in the Western Upper Galilee, Israel (33.04 N, 35.19 E, elevation: 100–200 m.a.s.l.) (Figure 1 and Figure 2), which is part of Keziv Nature Reserve, as part of a larger project (ECII). The study area has not been affected by urbanization, cultivation, herding, or pesticides since its establishment as a nature reserve in 1977. The reserve and study site are within a Plio-Pleistocene geological canyon estimated as several million years old [38], with a Mediterranean climate and average annual rainfall of 784 mm (1950–2020, Elon meteorological station, situated 3 km north of ECII). The average rainfall in the study period was higher with 870 mm in the first sampling year (2019–2020) and 800 mm in the second sampling year (2020–2021) [39]. Two slopes are found in the study area. The slopes are separated by only 50 m (at bottom) and 350 m (at top), and no interslope differences in rainfall is known, though such interslope differences have been recorded elsewhere [40,41,42,43]. The canyon is eroded in tectonically uplifted upper Cenomanian limestone [38], geologically identical on both slopes. Similar to other canyons north of the equator [8,44,45], the opposite slopes of this canyon display remarkable biotic contrasts due to higher solar radiation on the SFS than on the NFS [10].
Spatially, the SFS is more heterogeneous as it consists of more microhabitat patches than the homogeneous NFS. The SFS, which is warmer than the NFS [17], is characterized by xeric garrigue (shrubland) dominated by Calicotome villosa (Poir.) Link and Salvia fruticosa Mill. at the bottom and middle of the slope, which also hosts patches of evergreen Quercus coccifera L. trees 5–6 m in height, dry Mediterranean open park forest of evergreens Ceratonia siliqua L. and Pistacia lentiscus L. ~2–3 m in height, and dry savanna-like grassland dominated by Gramineae grasses (see below) at the top of the SFS. The leaf litter layer is up to 5 cm and is dry and patchy. The Gramineae grasses growing in the open patches at the top of the SFS (Hyparrhenia hirta (L.) Stapf, Andropogon distachyos L., and Pennisetum ciliare (L.) Link) originated from subtropical Africa, while Ceratonia siliqua that is a circum-Mediterranean species, originated in the Mediterranean from an Afrotropical ancestor [46]. By contrast, the milder, cooler, and more homogeneous NFS consists of a lush and dense homogenous forest of Acer obtusifolium ssp. syriacus SM. and Laurus nobilis L., averaging 7–10 m in height. The leaf litter is more humid, consisting of a 10–30 cm thick layer, with no grassland patches.
The SFS (slope angle: 20–40°) has three sampling stations (rows) 1, 2, and 3 at altitudes of 200, 170, and 140 m.a.s.l., respectively. The NFS (slope angle: 30–40°) has three sampling stations (rows) 5, 6, and 7 at 140, 170, and 200 m.a.s.l., respectively. All these stations (rows) lie on a perpendicular to the seasonal summer–dry streambed on the valley bottom (VB), where station (row) 4 is situated at 110 m.a.s.l., and each sampling station (row) consists of ten pitfall traps (Figure 2). The pitfall traps in the NFS (30 traps) and VB (ten traps) were all installed under a tree canopy (Acer obtusifolium ssp. syriacus, Laurus nobilis, and Quercus coccifera) as a result of the characteristics of these homogeneous habitats. However, the SFS (30 traps) included three microhabitats, and therefore pitfall traps were installed in different microhabitats: 7 traps (13, 14, 21, 26, 27, 29, 30) under tree canopy (Quercus coccifera and Ceratonia siliqua); 9 traps (10, 11, 12, 17, 19, 20, 22, 25, 28) under shrubs (Calicotome villosa and Salvia fruticose); and 14 traps (1–9, 15, 16, 18, 23, 24) in grassland open patches (Figure A1). Notably, within the SFS, small variations in aridity, mainly under trees versus far from trees [17], amplify the biotic differences in diversity both in space and time.

2.2. Arachnid Sampling, Sorting, and Identification

Spiders and other arachnids were sampled by means of pitfall traps (inner diameter 10 cm, depth 10 cm). The trap bottom was filled to 1 cm height with preservation liquid composed of 50% Ethylene Glycol 70%, 30% water, and 20% Ethanol 70%. Ten traps were placed along each row (sampling station), 10 m one from another. The traps were open during a 24-month period, between 1 September 2019 and 31 August 2021, and were emptied every 3–3.5 weeks (32 sampling events altogether). In this collecting protocol, all specimens were collected and counted. After collection, specimens were sorted to order level at Tefen High School, and preserved in 75% Ethanol at room temperature. All noninsect arthropod specimens were deposited at the Israel National Arachnid Collection, The National Natural History Collections (NNHC), The Hebrew University of Jerusalem (HUJ), and the Hungarian Natural History Museum (HNHM). Examination of the arachnid specimens was conducted using a Nikon SMZ25 motorized stereomicroscope at the NNHC, HUJ. Specimens were identified using taxonomic literature, for spiders [47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65], scorpions [66,67], solifuges [68], and pseudoscorpions [69]. All arachnids were identified by experts, using the above literature and the arachnid collection at NNHC, HUJ. Juveniles were identified to family or genus and species level, when possible, while adults were identified to species or morphospecies. If only one species in a genus was collected during the two-year sampling, juveniles were assigned to this species for the analysis.

2.3. Statistical Analysis

Rank abundance curves were produced for orders, species, and morphospecies, and species overlaps between the slopes and valley were visualized in a Venn diagram. We statistically analyzed, using Canoco 5.1 [70,71], the effect of three explanatory variables (df = 3), namely, plant-cover percentage (continuous variable measured in the spring), elevation (meters a.s.l., continuous variable), and habitat (slopes and valley (three categorial variables)) on arachnid assemblage composition. In Canoco, for categorial variables that have more than two levels, the levels are tested as separate categories (variables). Analysis was conducted in two taxonomic levels: on the arachnid orders (five orders: Araneae, Opiliones, Pseudoscorpiones, Scorpiones and Solifugae) and on species (111 species and morphospecies). Assemblage composition was analyzed using direct constrained ordination (redundancy analysis—RDA) with seven samples (rows (sampling stations). Each sample was the total number of individuals collected in a row along the whole sampling period. We used log transformation for the orders and species data, center and standardize by species, and forward selection for the explanatory variables. We used 9999 unrestricted permutations under a full model, with permutation of the revisualized predictors with forward selection. Only significant variables (p < 0.05) were included in the model.
In our study, the response curves method [72] was used to test the effect of plant-cover percentage on spider families that include more than one species, and on the orders Opiliones and Solifugae. The response to this explanatory variable demonstrates differences in the activity density of arachnids. Response curves were fitted using the scores of the RDA plotted against plant-cover percentage. The response variable is thus a measure of the abundance of the species that was affected significantly by plant-cover percentage. The curves were fitted using GAMs (generalized additive models). A normal distribution was assumed for the response variable. As in the RDA, a log transformation was used.
Habitat use, as a function of slope and microhabitat, was tested using nonparametric ANOVA (Kruskal–Wallis) and was visualized with violin plots (using the online application Statisty [73]). The Dunn–Bonferroni test was used to compare the groups in pairs to determine which was significantly different (p < 0.05, using the online application Statisty [73]).

2.4. Species Descriptions

We described two species new to science. All material was preserved in 75% ethanol and deposited at the Israel National Arachnid Collection, National Natural History collections, The Hebrew University of Jerusalem (NNHC, HUJ).
Morphological descriptions and specimen lists were generated following Magalhaes [74] and Logunov [75]. Morphological examination of the specimens was performed using a Nikon SMZ25 motorized stereomicroscope mounted with a Nikon DS-F12 camera driven by NIS-Elements software 5.21.03 64-bit (NNHC, HUJ), and a Nikon S1000 equipped with a Tucsen MiChrome digital camera (Szűts). Image stacks were combined using Zerene Stacker (ver. 1.04, Richland, WA, USA) or Helicon Focus (8.0 licensed to Szűts), and edited using GIMP (ver. 2.10.10, https://www.gimp.org/ (accessed on 1 June 2024)) and Inkscape (ver. 0.92.4, https://inkscape.org/(accessed on 21 June 2024)). Ten percent KOH solution and commercial pancreas enzymatic pills were used for clearing the female genitalia. All measurements are given in millimeters. Leg measurements were taken from the dorsal side; measurements of legs are given in the order of femur, patella, tibia, metatarsus, and tarsus.
Abbreviations: aL—apical lobe (of the opaque part of the tegulum); opT—opaque part of the tegulum; pL—proximal lobe (of the opaque part of the tegulum); pR—pocket for RTA; RTA—retrolateral tibial apophysis; RTAh—handle retrolateral tibial apophysis; Vm—ventral margin of deep concavity. HNHM—Hungarian Natural History Museum; HUJ—The Hebrew University of Jerusalem National Natural History Collections.
Transliterated names of the localities follow the Toponomasticon—Geographical Gazetteer of Israel published by Survey of Israel (1994) and Israel Touring Map (1:250,000). Geographic coordinates are given in WGS84, unless otherwise stated.

2.5. DNA Extraction, COI Sequence Acquisition and Analysis

DNA was extracted from one or two legs of nine Lachesana specimens collected in this study and additional six Lachesana specimens from the historical collection at NNHC, HUJ, using the Qiagen QIAamp® DNA Micro Kit (Germantown, ML, USA) and protocol. The 700 bp barcoding fragment of the cytochrome c oxidase subunit I (COI) mitochondrial gene was amplified using the universal primers mt6/HCO1 [76]. Chromatograms were examined by eye and trimmed in Geneious v 11. 1.5. We inferred a partitioned and unpartitioned COI phylogeny for several zodariids and presumed sister genera of Lachesana. Although we made several attempts to sequence multiple individuals from Keziv, at this time we were able to recover one quality sequence for one male individual. We leveraged our newly acquired sequence with sequences from Genbank for our downstream phylogenetic analyses. Best-fit models for our partitioned and unpartitioned analyses were performed using ModelFinder [77] and subsequent phylogenetic analyses were performed using Iqtree2 [78] with 1000 bootstrap replicates [79]. In our partitioned and unpartitioned COI analyses, we included six outgroup sequences from several zodariid species (from NCBI) in addition to our three ingroup Lachesana species, and did not include a single outgroup taxon due to the uncertainty of the sister genus of Lachesana.

3. Results

3.1. Arachnid Abundance, Richness, Distribution, and Biogeography

A total of 1748 arachnids from five orders were collected using pitfall traps between 1 September 2019 and 31 August 2021 (total of 32 sampling events), consisting of 3 false-scorpions (Pseudoscorpiones), 47 scorpions (Scorpiones, mostly collected from the SFS), 60 sun-scorpions (Solifugae, mostly collected from the SFS), 287 harvestmen (Opiliones), and 1351 spiders (Araneae) (Figure 3 and Figure 4; Supplementary Tables S1 and S2). Most spiders were identified to species or morphospecies level. The majority of the harvestmen individuals (70%) were identified to a family level only, yet we were able to identify 30% of the individuals and assigned them to one genus and three species. Forty-five out of forty-seven scorpions were identified to a species level (overall two dominant species, and one singleton). All sun-scorpions (one species) and false-scorpions (one species) were identified to the species level. We found a significant difference in the total number of individuals by slope (SFS vs. NFS), with more individuals in the SFS, followed by the VB, and the lower number of individuals in the NFS (Welch’s ANOVA, F = 34.73, df = 2, p < 0.001; Fisher’s least significant difference: SFS-NFS comparison test statistic = 22.5, t = 7.4, p < 0.001; VB-NFS comparison test statistic = 19.8, t = 4.6, p < 0.001; VB-SFS comparison test statistic = 2.7, t = 0.63, p = 0.532; Figure 5, Table 1). Within the SFS, variation was found between microhabitats of trap installation, with slightly fewer individuals collected under tree canopy and shrub, compared to grassland in open patches; however, this variation was not significant (ANOVA, F = 0.43, df = 2, p = 0.654; Figure A2, Table 1).
The most abundant species was the ant-spider species Pax islamita (Simon, 1873) (Zodariidae, of a Levantine global distribution: Israel, Lebanon, Syria, Türkiye [50]; Figure 6A) with 229 individuals, of them 49% were collected from the NFS (NFS:113, VB:73, SFS:43); followed by the tarantula spider species Chaetopelma concolor (Simon, 1873) (Theraphosidae, of a Levantine global distribution: Egypt, Israel, Syria, Türkiye [80]; Figure 6B) with 116 individuals, of them 46.5% were collected from the VB (NFS:41, VB:54, SFS:21); followed by the wolf-spider species Hogna graeca (Roewer, 1951) (Lycosidae, of a Levantine global distribution: Greece, Israel, Türkiye [80]; Figure 6C) with 74 individuals, of them 55% were collected from the SFS (NFS:6, VB:27, SFS:41); followed by the miturgid spider species Prochora lycosiformis (O. Pickard-Cambridge, 1872) (Miturgidae, of a Palearctic global distribution: Algeria, Iran, Iraq, Israel, Italy (mainland, Sicily) [80]; Figure 6D) with 66 individuals, of them 92.5% were collected from the SFS (NFS:4, VB:1, SFS:61); followed by the recluse-spider species Loxosceles rufescens (Dufour, 1820) (Sicariidae, of a Palearctic global distribution: Afghanistan, Iran, Israel, northern Africa, southern Europe [80]; Figure 6E) with 65 individuals, of them 95% were collected from the SFS (NFS:8, VB:0, SFS:57); followed by the sun-spider species Paragaleodes fulvipes Birula, 1905 (Solifugae, Galeodidae, of a Palearctic distribution: Israel, Iran [81]) with 60 individuals, of them 96% were collected from the SFS (NFS:2, VB:0, SFS:58); followed by the harvestmen species Leiobunum seriatum Simon, 1878 (Opiliones, Sclerosomatidae, of a Levantine distribution (Syria, Israel)), with 57 individuals, of them 80% were collected from the SFS (NFS:5, VB:6, SFS:46); followed by the wolf-spider species Alopecosa albofasciata (Brullé, 1832) (Lycosidae, of a Palearctic distribution from Mediterranean to Central Asia [80]) with 55 individuals, of them 98% were collected from the SFS (NFS:0, VB:1, SFS:54); followed by the ant-spider species Lachesana salam sp. nov. (Zodariidae, endemic to Israel (may be also in the Israeli and Syrian Golan) with 51 individuals, of them 88% were collected from the SFS (NFS:3, VB:3, SFS:45). All other species had less than 50 individuals (Figure 4), including 17 doubletons and 29 singletons species. Remarkably, the 24 individuals of the harvestmen species Dicranolasma hoberlandti Šilhavý, 1956 (Dicranolasmatidae) and the singleton Trogulus gypseus Simon, 1879 (Trogulidae; Figure 6F) were collected only from the NFS and VB, while the 21 individuals of the scorpion species Hottentotta judaicus (Simon 1872) (Buthidae, of a Palearctic global distribution: Israel, Lebanon, Jordan, Palestine, Syria, Saudi Arabia; Figure 6G) and the 23 individuals of the scorpion species Scorpio fuscus (Ehrenberg, 1829) (Scorpionidae, of a local distribution in northern Israel; Figure 6H), were all collected from the SFS. Figure 7 shows the total arachnid abundance (activity density) and species richness between the slopes and valley. The highest species richness and abundance was in the SFS with 95 species and morphospecies and 1051 individuals, compared to 58 and 49 species in the NFS and VB, and 375 and 322 individuals, respectively (Figure 8). It should be noted that the VB holds only one row of ten traps, compared to three rows of ten traps in NFS and SFS, so the richness and abundance in the VB is comparable to those of the three rows of SFS. Forty-one species were found uniquely at the SFS, while 30 species were found in all habitats (SFS, NFS, and the valley), and 12 species were common to the SFS and the NFS, and to the SFS and the VB (Figure 8). Only three and twelve species were found solely in the VB and NFS, respectively, and four species were common to the NFS and the VB (Figure 8). The overlap between the SFS and the NFS was 37.8%, between the SFS and the VB 37.8%, and between the NFS and the VB 30.6%.

3.2. Seasonality

Our two-year consecutive sampling spanned from September 2019 to August 2021. During this period, one of the lowest catches of the pitfall traps was in the first month of the sampling (September 2019) with only 13 individuals collected from all traps together, and in the first winter with 12 individuals only (February 2020). By contrast, the highest catch of the pitfall traps was the last month (August 2021) with 141 individuals collected from all traps together, followed by the spring months (April 2020 with 119, May 2020 with 137, and May 2021 with 104 individuals) and by October 2020 with 110 individuals.
Spiders were collected year-round, with more individuals collected in the dry and warmer season (April–August) and with two peaks, one on April 2020 (103 individuals) and the second on August 2021 (101 individuals, Figure 9A). Of the nine most abundant spider families, Theraphosidae were the most abundant in December 2019 (27 individuals) and December 2020 (25 individuals, Figure 9B). Agelenidae were collected more in October (9 individuals in October 2019 and 12 in October 2020) and November (6 individuals in November 2019 and 18 in November 2020, Figure 9B). Several families were more abundant, with peaks in our pitfall traps, during springtime: Dysderidae in April 2020 (21 individuals) and Gnaphosidae (22 individuals on April 2020, 17 on May 2020, 11 on April 2021, and 15 on May 2021) (Figure 9C). By contrast, lycosids, miturgids, salticids, and zodariids were collected more in the dry and warmer months (Figure 9C), as well as the sicariid spider species L. rufescens that was most abundant in our pitfall traps in August 2021 (14 individuals) (Figure 9B).
Opiliones were collected almost year-round, with a peak in May 2020 (40 individuals), while scorpions and sun-spiders were collected mainly in the dry and warmer months (scorpions: April to October, solifuges: May to November, Figure 9D). Sun-spiders were represented by one species in our sampling, Paragaleodes fulvipes (Figure 10). From our records, adult males emerge in higher abundance beginning in May and decrease in August compared to female conspecifics. Immature abundance, on the other hand, was among the highest three months after the first adults appeared (Supplementary Table S3). Among the immatures that we encountered, we observed some distinction between the instar stages. We observed that early instars had a total of six malleoli and reduced dentition compared to the later stages; specifically their chelicerae are absent sub medial teeth on the fixed finger and moveable finger (Figure 11A). Late-stage immatures have 10 malleoli and chelicerae appear to resemble adult female chelicerae (Figure 11B–D).

3.3. Habitat and Microhabitat Use

We tested habitat-use by the most dominant species (with more than 50 individuals collected) using species response curves with the percentage of plant cover and slope as the explanatory variable (constrained axis 1). We found that both Chaetopelma concolor and Pax islamita use more habitat with high plant-cover percentage, but this was not significant, while Alopecosa albofasciata, Loxosceles rufescens, Lachesana salam sp. nov., and sun-spider Paragaleodes fulvipes significantly use more habitat with low plant-cover percentage (Figure 12). Other species like Prochora lycosiformis and the harvestmen species Leiobunum seriatum use significantly more habitat with an intermediate plant-cover percentage; this was similar for Hogna graeca but not significant (Figure 12).
The theraphosid species Chaetopelma concolor, with 116 individuals collected, was found almost solely in traps installed under trees (41 individuals in NFS, 54 in VB, and 17 out of 21 in SFS traps that were under tree canopy), with only 4 individuals that were collected in traps that were not installed under tree canopies. In contrast, in the species Ischnocolus meron Zonstein, 2023, of the same family, out of 16 individuals, 13 were collected from traps under shrubs in garrigue habitat (rows 2 and 3 (stations)) and only 3 under trees (rows 4 and 7 (stations)), (Figure A3). We found a similar trend in the effect of plant cover and habitat use for species in the genus Zelotes of the Gnaphosidae family (Figure 13 and Figure A4). Zelotes balcanicus Deltshev, 2006, a species with a Palearctic/Mediterranean distribution (Italy, Bulgaria, Romania, Greece, North Macedonia, and Israel, [80]), significantly use more habitat with high plant-cover percentage, while all other Zelotes species we collected significantly use more habitat with low plant-cover percentage. Zelotes balcanicus was collected solely from traps under tree canopies with (20 individuals: 2 individuals in NFS, 15 in VB and 3 in SFS traps that were under tree canopy). Zelotes meronensis Levy, 1998, a species endemic to Israel, was mostly collected from pitfalls under shrubs (13 individuals in garrigue habitat of the SFS and only 1 under a tree in VB). Zelotes scrutatus (O. Pickard-Cambridge, 1872) (10 individuals), a species with a wide distribution (Africa to Central Asia, Canary Islands [80]), was collected only from pitfall traps installed under shrubs in garrigue habitat of the SFS.

3.4. Arachnid Assemblage Composition

In the order-level analysis, all variables explained 95.5% of the total variation in the arachnid order composition. The arachnid order composition was significantly affected by the slope (RDA; df = 3; slope (SFS): variation explained = 83.5%, F = 19.73, p = 0.02746; Figure 14).
In the species-level analysis, all variables explained 84% of the total variation in the arachnid species assemblage composition. The species composition was significantly affected by the plant-cover percentage and slope (RDA; df = 3; % plant cover: variation explained = 59.5%, F = 5, p = 0.00351; slope (NFS): variation explained = 19.6%, F = 1.97, p = 0.01786, Figure 15), which explained together ~80% of the total variation in the arachnid species assemblage composition (the SFS explained additional 13.5% but was not significant).

3.5. Species Description

3.5.1. Taxonomy and Description

Class Arachnida Lamarck, 1801.
Order Araneae Clerck, 1757.
Family Salticidae Blackwall, 1841.Genus Habrocestum Simon, 1876
Type-species. Habrocestum pullatum Simon, 1876, from France.
 
Habrocestum nahalit sp. nov. Szűts & Gavish-Regev.
LSID: urn:lsid:zoobank.org:act:DD6382A1-1BC0-4CF5-9A18-3DFD13338F9F
 
Habrocestum latefasciatum Prószyński, 1987: 30, 32–34 (mf) [83]; latifasciatum Prószyński, 2003: 65, f. 244, 247–249 (mf) [84].—misidentification
Habrocestum shulovi Logunov 2015: 11–12 (f) [75].—misidentification.
 
Holotype Male: Israel: Nahal Keziv Nature Reserve, Galilee, (N 33.041605°, E 35.191582°, 200 m.a.s.l.), Mediterranean dense forest, pitfall trap (row 7, trap 62) under tree, north-facing slope, Leg. Meir Finkel and Gur Shmula, 21 June 2020, 1 male (HUJ- Ar 21677 (Keziv 840)).
Paratypes: Israel: Nahal Keziv Nature Reserve, Galilee, (N 33.042373°, E 35.191524°, 110 m.a.s.l.), Mediterranean open park forest, pitfall trap (row 4, trap 35) under tree, valley bottom, Leg. Meir Finkel and Gur Shmula, 25 October 2019, 1 male (HUJ- Ar 21667 (Keziv 32)). Nahal Keziv Nature Reserve, Galilee, (N 33.043192°, E 35.191546°, 150 m.a.s.l.), Mediterranean open park forest, pitfall trap (row 2, trap12) under shrubs, south-facing slope, Leg. Meir Finkel and Gur Shmula, 21 April 2020, 2 males (HUJ- Ar 21668 (Keziv 535), HUJ- Ar 21669 (Keziv 536)). Nahal Keziv Nature Reserve, Galilee, (N 33.04361°, E 35.19145°, 170 m.a.s.l.), Mediterranean dry savanna-like grassland, pitfall trap (row 1, trap 9) in open patch, south-facing slope, Leg. Meir Finkel and Gur Shmula, 28 May 2020, 1 male (HUJ- Ar 21670 (Keziv 1980)). Nahal Keziv Nature Reserve, Galilee, (N 33.041758°, 35.191421°, 140 m.a.s.l.), Mediterranean dense forest, pitfall trap (row 6, trap 54) under tree, north slope, Leg. Meir Finkel and Gur Shmula, 9 July 2019, 1 male (HUJ- Ar 21671 (Keziv 2237)). Nahal Keziv Nature Reserve, Galilee, (N 33.04319°, E 35.19155°, 150 m.a.s.l.), Mediterranean dry savanna-like grassland, pitfall trap (row 2, trap 11) in open patch, south-facing slope, Leg. Meir Finkel and Gur Shmula, 2 August 2021, 1 female (HUJ- Ar 21672 (Keziv 2260)). Nahal Keziv Nature Reserve, Galilee, (N 33.04319°, E 35.19155°, 150 m.a.s.l.), Mediterranean dry savanna-like grassland, pitfall trap (row 2, trap 12) in open patch, south-facing slope, Leg. Meir Finkel and Gur Shmula, 28 May 2021, 1 female (HUJ- Ar 21673 (Keziv 1984)). Nahal Keziv Nature Reserve, Galilee, (N 33.041605°, 35.191582°, 160 m.a.s.l.), Mediterranean dense forest, pitfall trap (row 7, trap 70) under tree, north slope, Leg. Meir Finkel and Gur Shmula, 30 October 2020, 1 female (HUJ- Ar 21674 (Keziv 1281)). Nahal Keziv Nature Reserve, Galilee, (N 33.04361°, E 35.19145°, 170 m.a.s.l.), Mediterranean dry savanna-like grassland, pitfall trap (row 1, trap1) in open patch, south-facing slope, Leg. Meir Finkel and Gur Shmula, 18 April 2021, 1 female (HUJ- Ar 21675 (Keziv 1842)). Nahal Keziv Nature Reserve, Galilee, (N 33.04, E 35.19, 100–200 m.a.s.l.), Mediterranean dense forest, pitfall trap (row 7, trap 66) under tree, north-facing slope, Leg. Thomas Pavlicek, 17–31 October 1998, 1 male (HNHM 7444). Nahal Oren, Karmel Mountain, pitfall trap, north-facing slope, Leg. Csaba Csuzdi, 20 March 2001, 1 male, (HNHM 7443) [det. as Habrocestum latifasciatum by J. Prószyński].
 
Additional material examinedHabrocestum nahalit sp. nov.: ISRAEL, Nahal Keziv Nature Reserve, Galilee, (N 33.043192°, E 35.191546°, 150 m.a.s.l.), Mediterranean dry savanna-like grassland, pitfall trap (row 2, trap 15) under shrub, south-facing slope, Leg. Meir Finkel and Gur Shmula, 19 December 2019, 1 male (HUJ- Ar 21676 (Keziv 914)).
 
Note. Habrocestum latifasciatum has been described from Corfu by Simon [85]. In Prószyński’s excellent salticid type-atlas [83] he illustrated the species. However, obtaining the exact data of the illustrated specimens provides a challenge. Three palps are illustrated under the following text: “2 ♂ “806 Hab./rocestum/latefasciatum ES. Corfu ICb.;. Syria/c.B/” coll. Simon, MNHN-Paris.” It is unclear whether the illustrated specimen is from Corfu or Syria and the three images are illustrating the same specimen or not, but it is worth noting that no other Habrocestum latifasciatum data are known from Corfu, than that of Simon’s. Moreover, apparently there are two distinct species illustrated in the arachnological literature under the name Habrocestum latifasciatum [86]. One of them is found in Greece and Türkiye, and has a long white longitudinal stripe on the carapace, extending into the ocular area, where it became thick (Figure 16B,C; Metzner 1999: Figure 25a [87]; Lecigne 2021: Figure 34d [88]). Due to the type locality of H. latifasciatum, we believe that the Greece and Türkiye species is in fact Habrocestum latifasciatum. The other form is distributed in Syria, Lebanon, and Israel, and its specimens’ white line is thin and ends at the ocular area (Figure 16A; Prószyński 2003: Figure 244 [84]). The two forms also significantly differ in the palp: RTA is small, curved, and upward pointing in the Turkish and Greek specimens’ palp (Metzner 1999: Figure 25c [87]; Logunov 2015: Figure 3 [75]; Lecigne 2021: Figure 34c [88]), embolus is thin, as seen from the ventral side, and the opaque part of the bulb almost covers the spermatophore switch (Figure 17D–E; Metzner 1999: Figure 25b [87]; but see Logunov 2015: Figure 2 [75]). The Israeli specimens’ RTA is thick and blunt (Figure 17C; Prószyński 2003: Figure 249 [84]), the bulb has a lower opaque part, having a large portion uncovered from the spermatophore switch (Figure 17B; Prószyński 1987: 32 [83]; Prószyński 2003: Figure 247 [84]). Based on consistent and firm differences in both palps and habitus, we are convinced these specimens represent two reproductively isolated groups, thus species. Simon’s original description of Habrocestum latifasciatum from Corfu strengthens the idea that the males have a wide white stripe in the ocular area: “Tête fauve à front blanc. Thorax noir à ligne mèdiane.” [Tawny head with white front. Black thorax with midline] [85]. Therefore, we see it established that Habrocestum latifasciatum name should be applied to those males possessing the wide white stripe in the ocular area. The other form, which differs significantly and consistently from H. latifasciatum, we regard as a new species, H. nahalit Szűts & Gavish-Regev, sp. nov., and described here formally.
Etymology. The specific epithet is a noun in apposition (nahal means stream (wadi) in Hebrew).
Distribution. ISRAEL: Galilee (Nahal Keziv Nature Reserve), Karmel (Nahal Oren). The species is probably well distributed in the northern parts of the East Mediterranean.
Diagnosis. Males of H. nahalit sp. nov. can be recognized by the thick embolus slightly bent as seen from proximal, straight as seen from the ventral side (Figure 17). Embolus end abruptly in a 30° angle. Opaque part of the tegulum (opT) low, its ledge is relative horizontal, with a clear hump between the embolus and spermatophore switch (Figure 17B). Prolateral apical edge of the opT is angular. The almost as high as wide opT with proximal and apical lobes, proximal lobe (Figure 17—pL) directed by a 90° angle. Apical lobe (Figure 17—aL) is rounded. Male coloration is also characteristic: relative dark, with a thin median longitudinal line on the thoracic area, ocular area is dark, without any longitudinal lines. Females can be recognized by the spermathecae that are touching and positioned above the large copulatory semicircular openings. Accessory glands are large, almost as large as spermathecae.
Differential diagnosis. There are three species described so far, where the embolus originates on the lower, proximal part of the bulbus, thus having a relatively long (longer than the bulbus itself) embolus: Habrocestum latifasciatum (Simon, 1868) [85], H. papilionaceum (L. Koch, 1867), and H. shulovi Prószyński, 1999 [89]. Males of H. nahalit sp. nov. can be distinguished from those by the following characters: it resembles H. papilionaceum by the thick embolus but differs from it by straight embolus (Figure 17B); medially bent in H. papilionaceum (see Oger 2024 [90]) with a prolateral turn at the end. Male colors are similar, but H. papilionaceum midline widens in front [91], H. nahalit sp. nov. has a thin line (Prószyński 2003: Figure 244 [84]). Females of H. nahalit sp. nov. can be separated by the spermathecae location: located below the openings in H. nahalit sp. nov. (Figure 18 and Figure 19) and above the openings in H. papilionaceum [87]. Habrocestum nahalit sp. nov. resembles H. latifasciatum by the overall outlook of the palp but can be differentiated by the shorter (shorter than the length of cymbium) and thicker, straight embolus, the lower opT with a rounded aL (Figure 17A–C). Habrocestum latifasciatum with a longer (longer than the cymbium), thinner embolus (Figure 21A–C), which is undulated, as seen from the ventral side (Figure 17B versus Figure 17E). The spermatophore switch is almost covered by opT; its aL is angular (versus rounded (Figure 17C versus Figure 17F)). Male color differs from H. nahalit sp. nov. without the thick longitudinal white stripe in the ocular area. Female epigyne of H. nahalit sp. nov. differs by having two well-separated pockets for RTA (Figure 18: pR) facing each other, from H. latifasciatum, which pR-s face to the posterior (Figure 18E: pR). Also, H. latifasciatum with well-separated large spermathecae (Figure 18D), L. nahalit sp. nov. with smaller, touching spermathecae (Figure 18F). Habrocestum nahalit sp. nov. differs from H. shulovi by the apical lobe of of the opT (Logunov 2015: Figures 4 and 5 [75]; Prószyński 2003: Figure 245 [84]). In fact, we suspect Prószyński (2003) illustrated the two species in his excellent Levantine salticid monograph (H. shulovi see: Prószyński 2003: Figure 245 [84] versus H. nahalit sp. nov. see: Prószyński 2003: Figure 247 [89]). This is further strengthened by the description of the males: Prószyński 2003, p 65: “there is a striking median line of white setae along flat part of the thorax, extending in some specimens onto posterior eyefield” [84]. Logunov (2015) describes the male of H. shulovi (from Türkiye) as “there is a wide longitudinal stripe widening anteriorly and running across the eye field and over the thorax” [75], whereas we cannot name any difference from the illustrated female, thus regard it as H. nahalit sp. nov. The females can be separated by the anteriorly situated spermathecae, providing an empty space between the posterior pR-s (Figure 18E,F), whereas H. shulovi females spermathecae is located between the upper (anterior) (Figure 21D,E) sperm ducts, and the lower (posterior) pR (Prószyński 2003: Figures 254 and 255 [84]).
Description. Male holotype (HUJ- Ar 21677). Coloration. Carapace dark brown, thoracic area with a thin, white median stripe (Figure 16A; Prószyński 2003: Figure 244 [89]). Anterior part and sides of the ocular area with white setae above the eyes (Figure 16A). Labium, endites, and sternum brown. Palp segments yellow, patella and tibia with long white setae. Leg I patella-tarsus blackish on the ventral side, other leg segments yellow (Figure 16A). Abdomen dark grey, with an anterior transverse wide white band, and with a posterior white triangular-like shape on the dorsum (Figure 16A). Spinnerets uniformly yellow. Measurements. Total length 4.20. Carapace: 2.14 long, 1.95 wide, 1.43 high. Abdomen: 1.86 long, 1.74 wide. Leg segments: I: 5.55 (1.67 + 1.10 + 1.13 + 1.01 + 0.64); II: 4.35 (1.37 + 0.93 + 0.84 + 0.68 + 0.53); III: 5.81 (2.12 + 0.92 + 1.13 + 0.92 + 0.72); IV: 4.54 (1.53 + 0.62 + 0.86 + 0.83 + 0.70). Palp. Opaque part of the tegulum with a proximal and an apical lobe (Figure 17A–C arrows pL and aL respectively). Proximal lobe finger-like directed by a 90° angle (Figure 17A), apical lobe rounded (Figure 17A–C). Embolus wide, slightly bent and does not reach the tip of the cymbium (Figure 17B).
Description. Female paratype (HUJ- Ar 21672). Coloration. Carapace dark brown, thoracic area with sparsely dispersed long whitish setae. Labium, endites, and sternum brown. Legs yellowish brown with brown annulations on the proximal and apical ends of metatarsi and tibiae. Abdomen dark grey, with a faint posterior spot on the dorsum similar to that of males. Spinnerets uniformly yellow. Measurements. Total length 4.42. Carapace: 1.92 long, 1.87 wide, 1.35 high. Abdomen: 2.48 long, 2.31 wide. Leg segments: I: 3.83 (1.21 + 0.85 + 0.71 + 0.58 + 0.48); II: 3.74 (1.21 + 0.83 + 0.70 + 0.59 + 0.41); III: 5.49 (2.00 + 0.83 + 1.19 + 0.96 + 0.51); IV: 4.36 (1.44 + 0.53 + 0.83 + 0.95 + 0.61). Epigyne. Epigyne with two distinct parts (Figure 18B,C). Anterior part oval, with a undulate transverse slit, and two relatively wide (as wide as diameter of the spermatheca) copulatory openings (Figure 18C). Sperm ducts funnel-like, narrowing to the small spermathecae (Figure 18E,F). Sperm ducts with a pair of spermatheca-sized glands (Figure 18E,F). Posterior part of the epigyne connected with the anterior part by a median thin sclerotized area, posterior pockets for RTA well separated, and facing each other (Figure 18F) and separated by a deep indentation (Figure 18B,C,E,F).
Discussion. According to our conclusions, there are three species of Habrocestum found in the East Mediterraneum, namely H. shulovi (Israel, Türkiye), H. nahalit sp. nov. (Israel), and H. latifasciatum (Eastern Mediterranean to Middle East). No one has compared all three species’ males and females due to the insufficient material, and difficult access to the localities. We are aware of the possibility that H. nahalit sp. nov. and H. shulovi are not isolated reproductively, thus may be the same species. However, we encourage integrative investigations in the future. Acquiring new material from areas where these species are found is extremely difficult at these times. Therefore, we have illustrated the female genitalia in eight images (Figure 18B,C,E,F and Figure 19), and the holotype, and an additional paratype male has been illustrated to facilitate further investigation regarding this species complex (Figure 20). Molecular data were impossible to gather from the pitfall material at this time; however, we suspect that new molecular data will help support our conclusions of species diversity.
Family Zodariidae Simon, 1864
Genus Lachesana Strand, 1932.
Lachesis Audouin, 1826: 110 (1827: 309, 311), preoccupied by Daudin, 1803 for a reptilian.
Lestes Gistel, 1848: 9, a replacement name, preoccupied by Leach, 1815 for an insect.
Laches Thorell, 1869: 37, a replacement name, preoccupied by Gistel, 1848 for an insect.
Lachese Simon, 1873: 66, lapsus stated explicitly by Simon, 1893: 429.
Lachesana Strand, 1932: 140, a replacement name.
Type-species. Lachesis perversa (Audouin, 1826), from Egypt.
 
Lachesana salamsp. nov. Hammouri, Ganem & Gavish-Regev.
LSID: urn:lsid:zoobank.org:act:D9F64DBC-373D-4B65-B099-85339EE1CCAD
 
Lachesana rufiventris Thaler & Knoflach 2004: Figures 5, 7, 8, 13, 16, 18, 21, 24, and 27 [92].—misidentification.
 
HOLOTYPE MALE: ISRAEL: Nahal Keziv Nature Reserve, Galilee, (N 33.042877°, E 35.191551°, 130 m.a.s.l.), Mediterranean open park forest, pitfall trap (row 3, trap 30) under tree, south-facing slope, Leg. Meir Finkel and Gur Shmula, 25 October 2019, 1 male (HUJ- Ar 21618 (Keziv 43)).
Paratypes: Israel: Nahal Keziv Nature Reserve, Galilee, (N 33.043607°, E 35.191452°, 170 m.a.s.l.), Mediterranean dry savanna-like grassland, pitfall trap (row 1, trap 3) in open patch, south-facing slope, Leg. Meir Finkel and Gur Shmula, 19 December 2019, 1 male (HUJ- Ar 21619 (Keziv 170)). Israel, Nahal Keziv Nature Reserve, Galilee, (N 33.042877°, E 35.191551°, 130 m.a.s.l.), Mediterranean dry savanna-like grassland, pitfall trap (row 1, trap 8) in open patch, south-facing slope, Leg. Meir Finkel and Gur Shmula, 19 December 2019, 1 male (HUJ- Ar 21620 (Keziv 1492)). Israel, Nahal Keziv Nature Reserve, Galilee, (N 33.043192°, E 35.191546°, 150 m.a.s.l.), Mediterranean dry savanna-like grassland, pitfall trap (row 2, trap 18) in open patch, south-facing slope, Leg. Meir Finkel and Gur Shmula, 19 December 2019, 1 male (HUJ- Ar 21621(Keziv 2415)).
DNA voucher: Israel, Nahal Keziv Nature Reserve, Galilee, (N 33.041758°, E 35.191421°, 120 m.a.s.l.), Mediterranean dense forest, pitfall trap (row 6, trap 52) under tree, north-facing slope, Leg. Meir Finkel and Amit Ben Asher, 18 November 2020, 1 male (HUJ- Ar 21622 (Keziv 1419), DNA voucher).
Additional material examinedLachesana salam sp. nov.: Israel, Nahal Keziv Nature Reserve, Galilee, (N 33.043607°, E 35.191452°, 170 m.a.s.l.), Mediterranean dry savanna-like grassland, pitfall trap (row 1, trap 2) under tree, south-facing slope, Leg. Meir Finkel and Gur Shmula, 19 December 2019, 1 male (HUJ- Ar 21,623 (Keziv 165)). Israel, Nahal Keziv Nature Reserve, Galilee, (N 33.043607°, E 35.191452°, 170 m.a.s.l.), Mediterranean dry savanna-like grassland, pitfall trap (row 1, trap 8) under tree, south-facing slope, Leg. Meir Finkel and Gur Shmula, 19 December 2019, 1 male (HUJ- Ar 21624 (Keziv 172)). Israel, Nahal Keziv Nature Reserve, Galilee, (N 33.042877°, E 35.191551°, 130 m.a.s.l.), Mediterranean open park forest, pitfall trap (row, trap 22) under tree, south-facing slope, Leg. Meir Finkel and Gur Shmula, 19 December 2019, 1 male (HUJ- Ar 21625 (Keziv 178)). Israel, Nahal Keziv Nature Reserve, Galilee (N 33.042877°, E 35.191551°, 130 m.a.s.l.), Mediterranean open park forest, pitfall trap (row 3, trap 27) under tree, south-facing slope, Leg. Meir Finkel and Gur Shmula, 19 December 2019, 1 male (HUJ- Ar 21626 (Keziv 180)). Israel, Nahal Keziv Nature Reserve, Galilee, (N 33.042373°, E 35.191524°, 110 m.a.s.l.), Mediterranean dense forest, pitfall trap (row 4, trap 37) under tree, valley bottom, Leg. Meir Finkel and Gur Shmula, 19 December 2019, 1 male (HUJ- Ar 21627 (Keziv 364)). Israel, Nahal Keziv Nature Reserve, Galilee, (N 33.043607°, E 35.191452°, 170 m.a.s.l.), Mediterranean dry savanna-like grassland, pitfall trap (row 1, trap 5) in open patch, south-facing slope, Leg. Meir Finkel and Gur Shmula, 19 December 2019, 1 male (HUJ- Ar 21628 (Keziv 366)). Israel, Nahal Keziv Nature Reserve, Galilee, (N 33.042877°, E 35.191551°, 130 m.a.s.l.), Mediterranean open park forest, pitfall trap (row 3, trap 30) under tree, south-facing slope, Leg. Meir Finkel and Amit Ben Asher, 18 November 2020, 1 male (HUJ- Ar 21629 (Keziv 1399)). Israel, Nahal Keziv Nature Reserve, Galilee, (N 33.042373°, E 35.191524°, 110 m.a.s.l.), Mediterranean dense forest, pitfall trap (row 4, trap 38) under tree, valley bottom, Leg. Meir Finkel and Amit Ben Asher, 18 November 2020, 1 male (HUJ- Ar 21635 (Keziv 1401)). Israel, Nahal Keziv Nature Reserve, Galilee, (N 33.042877°, E 35.191551°, 130 m.a.s.l.), Mediterranean open park forest, pitfall trap (row 3, trap 22) under shrub, south-facing slope, Leg. Meir Finkel and Amit Ben Asher, 10 December 2020, 1 male (HUJ- Ar 21630 (Keziv 1498)). Israel, Nahal Keziv Nature Reserve, Galilee, (N 33.042877°, E 35.191551°, 130 m.a.s.l.), Mediterranean open park forest, pitfall trap (row 3, trap 23) in open patch, south-facing slope, Leg. Meir Finkel and Amit Ben Asher, 10 December 2020, 1 male (HUJ- Ar 21631 (Keziv 1500)). Israel, Nahal Keziv Nature Reserve, (same locality and collecting information as HUJ- Ar 21631 (Keziv 1500), 1 male (HUJ- Ar 21634 (Keziv 1501)). Israel, Nahal Keziv Nature Reserve, Galilee, (N 33.043192°, E 35.191546°, 150 m.a.s.l.), Mediterranean open park forest, pitfall trap (row 2, trap 11) under shrub, south-facing slope, Leg. Meir Finkel and Amit Ben Asher, 3 January 2021, 1 male (HUJ- Ar 21632 (Keziv 1580)). Israel, Nahal Keziv Nature Reserve, Galilee, (same locality as HUJ- Ar 21621 (Keziv 2415). Mediterranean open park forest, pitfall trap (row 2, trap 13) under tree, south-facing slope, Leg. Meir Finkel and Amit Ben Asher, 28 May 2021, 1 subadult female (HUJ- Ar 21617 (Keziv 1986)). Israel, Nahal Keziv Nature Reserve, Galilee, (N 33.043192°, E 35.191546°, 150 m.a.s.l.), Mediterranean open park forest, pitfall trap (row 2, trap 18) under tree, south-facing slope, Leg. Meir Finkel and Amit Ben Asher, 19 December 2020, 1 male (HUJ- Ar 21633 (Keziv 2416)). Israel, Rosh Pinna, Galilee, ([N 32.97°, E 35.542°[, 308 m.a.s.l.), Leg. Shosh Ashkenazi, 11 November 1992, 1 male (HUJ- Ar 14879).
Additional material examinedLachesana blackwelli: Israel, Jerusalem, Judean Mountains, Leg. Aharon Shulov, 5 October 1950, 1 male (HUJ- Ar 14189). Israel, Jerusalem, Judean Mountains, Leg. Aharon Shulov, 18 March 1944, 1 female (HUJ- Ar 15052).
Additional material examinedLachesana rufiventris: Israel, Jerusalem, Judean Mountains, Leg. Unspecified, 27 December 1955, 3 males (HUJ- Ar 10146, 10148, 10149). Israel, Jerusalem, Judean Mountains, Leg. Aharon Shulov, 13 February 1937, 1 male (HUJ- Ar 14193). Israel, Jerusalem–Jericho Road, Leg. Aharon Shulov, 13 February 1940, 1 male (HUJ- Ar 14193). Israel, Jerusalem (Bait VaGan), Judean Mountains, Leg. Aharon Shulov, 23 January 1952, 1 male (HUJ- Ar 14195). Israel, Jerusalem, Judean Mountains, Leg. Gideon Tsabar, 15 December 1966, 1 male (HUJ-Ar 14196). Palestine, Al Aziriya, Judean Mountains, Leg. Jacob Ofer, January 1972, 1 male (HUJ-Ar 14197).
Additional material not examinedLachesana salam sp. nov.: SYRIA, Golan, Camp Fauar near El Qunaitra ([N 33°09′35″, E 35°50′30″]), Leg. P. H. Schneider and K. Kollnberger, 1–31 October 1979, NMW, 1979/80. (Thaler & Knoflach 2004, missidentification). Testing the excellent figures of Thaler & Knoflach 2004 (Figures 5, 7, 8, 13, 16, 18, 21, 24, and 27), we assign this specimen to Lachesana salam sp. nov.
 
Note. Lachesana are medium to large ant-spiders (Figure 22), living in burrows in the ground, and therefore are not frequent in collections [50,92]. Male pedipalp are similar between species, while only the RTA shape seems to be useful for species identification [50]. We suggest that the dense setae-tufts on the male endites together with the length of the filiform fangs are useful characters to distinguish among the Lachesana species that occur in Israel, i.e., L. rufiventris (Simon, 1873), L. blackwelli (O. Pickard-Cambridge, 1872), and L. salam sp. nov. These characters may also be useful for other Lachesana species identification. Lachesana specimens collected from the Negev Desert, Israel, might belong to the type species Lachesana perversa (Audouin, 1826), which was described from Egypt, but as the type is lost and the description is lacking good characteristics, it is therefore impossible to assign them to a species [50]. Moreover, some authors may have misidentified the Negev specimens as Lachesana insensibilis Jocqué, 1991, described from Saudi Arabia, as no thorough taxonomical examination was performed to establish their identification. An integrative taxonomical revision for Lachesana is needed, but this is out of the scope of the current publication. We were able to sequence COI of one of the specimens of L. salam sp. nov. and added it here for future use of molecular tools to understand the species boundaries within Lachesena (Table A1).
The continuous sampling by the coauthors Finkel, Shamula, and Ben Asher at Nahal Keziv Nature Reserve reveal new ecological information, and sufficient material of males (45 out of 51 individuals) to describe a new species, i.e., Lachesana salam sp. nov. Only one subadult female (Keziv 1986) was found; no adult females were collected, and therefore we do not describe here the female of Lachesana salam sp. nov. Although Lachesana salam sp. nov. resembles Lachesana rufiventris, several characteristics allow for distinguishing it from this species and other species in the genus. We suspect that the specimen Thaler and Knoflach referred to as Lachesana rufiventris (Thaler & Knoflach 2004: Figure 13 [92]) from the Syrian Golan is Lachesana salam sp. nov. Thus, we present figures to compare Lachesana rufiventris and Lachesana salam sp. nov.
Etymology. The words “salam” in Arabic and “shalom” in Hebrew mean peace. The species epithet “salam” is intended to describe the authors’ hopes for peace in the region.
Distribution: ISRAEL: Galilee (Keziv Nature Reserve, Rosh Pinna), Golan? (HUJ M 1994). SYRIA: Golan?
Diagnosis. Males of Lachesana salam sp. nov. can be easily recognized by the combination of presence of two dense setae-tufts at the anterior part of the endites (Figure 25A), long and filiform cheliceral fangs (Figure 25B,C), and palpal RTA that is curved with a ventral pointed tip (Figure 23). See below a key to the males of Lachesana species that occur in Israel.
Differential Diagnosis. Lachesana salam sp. nov. resembles L. rufiventris (Simon, 1873) [93], L. blackwalli (O. Pickard-Cambridge, 1872) [94], L. graeca Thaler and Knoflach, 2004 [92], and L. perseus Zamani & Marusik, 2021 [95], but males can be easily distinguished by the shape of the male palpal RTA that is curved with a ventrally pointing tip in L. salam sp. nov., whereas the RTA is not curved with a hook-like tip pointing dorsally in L. rufiventris (Figure 22 and Figure 23), and is short with deep concavity on retrolateral side with a tip extend backward in L. blackwalli (Levy 1990: Figures 10 and 11 [50]), and is short with apex extend upward in L. graeca (Thaler and Knoflach, 2004: Figures 15 and 23 [92]), and is abruptly bent basally with gently curved tip in L. perseus (Zamani & Marusik, 2021: Figure 3F–J [95]); and by the presence of two dense setae tufts at the anterior part of the endite, covering the whole length of the endite in L. salam sp. nov. (Figure 25A), compared to L. perseus where the lower setae tuft is only on the endite margin, while in L. graeca the two dense setae tufts are in anterior and middle of the endite (Thaler and Knoflach, 2004: Figure 11 [92]), and in L. rufiventris (Figure 25E), and in L. blackwalli there is only one dense setae tuft anteriorly (Thaler and Knoflach, 2004: Figure 12 [92]); and by the chliceral fangs in L. salam sp. nov. that are long with conical-shaped base and a filiform thin sharp apical part, that is curved twice, forming a whip-like fang twice the length of the fang base (Figure 25B,C), while the fangs in L. rufiventris, L. blackwalli, L. graeca, and L. perseus are shorter and recurved, forming an angle (Figure 25F,G; Thaler and Knoflach, 2004: Figures 17 and 18 [92]). The labium is wide in L. salam sp. nov. and is about half the length of the endite, which is similar to L. rufiventris (Figure 25A,E); both species have narrower clypeus and the eyes are mostly the same in size (Figure 22B,F).
Description. Male holotype (HUJ- Ar 21618). Body and coloration: large and robust zodariid spiders, 9–13 mm body length, smooth brownish carapace, longer than wide (Figure 22A). Eyes: same sized, small median round eyes with narrow clypeus 0.35–0.50 under AME, 0.15–0.25 under ALE (Figure 22B), eye measurements shown in Table 2, holotype and paratype average eye diameters and distance between median eyes. Opisthosoma is clothed with short setae, dorsally with median rectangular black-band and black-branching pattern (Figure 22C). Opisthosoma ventral side is reddish-brown with smooth small setae and long dense setae near the book-lung openings and around the spinnerets. Legs: yellow brownish, covered with scattered setae, and spines which vary in number and arrangement, tarsus with three claws. Table 3 shows the number of spines in the holotype and their arrangement. As in all Lachesana species, the second leg is the shortest and the fourth leg is the longest. Table 4 shows the measurements of the holotype/paratype average length of the segments of the legs. Male pedipalp: Bulbar parts similar to those of other congeners, RTA (retrolateral tibial apophysis) with a deep notch at the base, a distinct mesal hump, and a sclerotized, widened upper part bearing a rounded depression, tip of apophysis stretches apically into a long tapering extension curved inward (ventrally) (Figure 23A,C, Figure 24A–D and Figure 26A,B). Labium and endite: labium is rectangle to conical shaped, about half length of endite, endite is conical shaped with tip end where two dense setae tufts are located (Figure 25A). Chelicerae: covered with long scattered setae posteriorly, dense long black brush-like thin setae anteriorly, modified long fangs with a conical-shaped base, curved in two different directions forming a whip-like shape, 1–2 promarginal teeth are found in the inner side of the chelicerae (Figure 25B–D).
Comments: No adult females found, only one subadult female.
Key to the males of Lachesana species that occur in Israel.
1.1. Lachesana males with RTA tip straight or bent dorsally, one pair of dense hair-tufts on the anterior margin of the endites, and chelicera fang with tip similar in length or shorter from the base of the fang …………………………………………………………2
1.2. Lachesana males with RTA tip bent ventrally (Figure 23A,C), two pairs of dense hair-tufts on the endites (Figure 25A), and chelicera fang with filiform tip more than twice longer than the base of the fang (Figure 25B,C) ……………… Lachesana salam sp. nov.
2.1. Lachesana males with RTA tip short (approx. one-third of the width of the entire anterior part of the apophysis) and straight (Levy 1990: Figure 10 and Figure 11 [50]) ……………L. blackwalli
2.2. Lachesana males with RTA tip long (approx. one-half of the width of the entire anterior part of the apophysis and with tip bent dorsally (Figure 23B) ……………………L. rufiventris

4. Discussion

The aim of this study was to test the effect of the sharp solar radiation and vegetation cover contrasts of the two slopes (in the ECII site) on arachnid assemblage composition. Our results support the ad hoc hypotheses that seasonality, slope, and microhabitat are all significantly affecting the arachnid assemblage composition (Figure 5, Figure 7, Figure 12, Figure 13, Figure 14 and Figure 15). Our study confirms previous studies that have found higher species richness in open areas, when compared to forests in the Mediterranean region [32,36,96]. Both seasonality and microhabitat were shown to affect arachnid (and on other arthropods) assemblage composition in Mediterranean regions as well as other regions [29,35,97,98]. However, owing to our consecutive sampling over two years and specific habitat characteristics for each trap (under tree, under shrub, open grassland), we could refine the effects of seasonality and microhabitat, and find new information on seasonality and habitat use that has yet to be published.
While many studies of interactions between arachnids and plant species composition and cover percentage in the Mediterranean region focus on comparing different management conditions, i.e., natural vs. human-altered habitats such as forest clearings and grazing [36,96], our study tests microhabitat differences within a natural habitat. We found separation in microhabitat use by Zelotes species (the spider family Gnaphosidae), which may be evidence for microhabitat separation as a mechanism of speciation [99,100]. Zelotes balcanicus, a species with a Palearctic/Mediterranean distribution [80], was collected solely from traps under tree canopies, while the endemic local species Zelotes meronensis was mostly collected from pitfalls under shrubs, and Zelotes scrutatus, a species with wide distribution (Africa to Central Asia, Canary Islands) [80], was collected solely from pitfall traps installed under shrubs in garrigue habitat of the SFS.
In addition, many studies test the effects of habitat characteristics over geographical gradients stretching along dozens or hundreds of km, or the height/temperature gradient across a mountain ridge. Those studies are important, but usually cannot separate between the geographical locality and the abiotic and biotic conditions in each study site [30,31,32,36]. Our study design of two contrasting slopes in a microgeographic site is unique and enabled us to uncover the effect of solar radiation on arachnid assemblage, a notion that has yet to be tested for arachnids, to our knowledge. Many studies that investigate arachnid diversity have been conducted during the spring and summer, when peak activity density are known to be high [30,31,32,36,96]. Although few studies have been conducted year-round [26,27,34], such studies require greater effort to reward by means of abundance, and are also important for our understanding of the overall biodiversity in a single site. Moreover, study frameworks like this usually uncover many important biotic patterns and processes on a macroscale. For example, we found differences in microhabitat use in the spider family Theraphosidae, which had higher activity density in December, a month that is usually not preferred for sampling, with Chaetopelma concolor, found almost solely in traps installed under trees, and the species Ischnocolus meron, found almost solely in traps under shrubs in garrigue habitat. Indeed, we had lower catches in the winter months (January and February 2020), which is probably due to the heavy rains during December 2019–January 2020 that swept or flooded some of the pitfall traps, and lesser activity density due to lower temperatures. It is also suggested by our data that catches in newly installed pitfall traps are low; this observation can be explained by the disturbance caused by the pitfall initial installation. Yet, we can state that previous methodological recommendations, that “short-term sampling programs, intended to give a reasonable picture of spider communities in Portugal and in the Iberian Peninsula (and possibly extending to all the Mediterranean), should be conducted during May or June” [26], could result, at least in the East Mediterranean, in skewed assemblage composition, missing Theraphosidae and Agelenidae, and some of the most abundant species in our study, which peaked in ECII in December and October (respectively). It should be noted that this methodological issue is also relevant to global climate change detection, since August and October, being part of the hottest and driest season in the East Mediterranean, may be more important for species monitoring than spring and early summer. The distribution of the most abundant spider species within ECII, scorpions and sun-spiders, resemble their global distribution and strengthen the notion, presented above for common trees and shrubs, that the EC model with its contrasting slopes, encapsulates the phytogeographical and zoogeographical junction of Europe, Asia, and Africa. This is also demonstrated in the differences observed in species belonging to the genus Zelotes of the family Gnaphosidae. We suggest the possible application of the EC model and our results to future research on the effects of climate change.
As a largely enigmatic group of animals, many aspects regarding sun-spiders (Solifugae) basic biology are unknown. Few studies have focused on the life cycle of Solifugae, e.g., [101,102], however, in our comprehensive two-year study we illuminate important implications for the developmental stages of our single identified species, Paragaleodes fulvipes. The current known distribution of the members of the solifuge family, Galeodidae, are distributed throughout northern Africa and Asia, except for the Indo-Pacific islands. The described diversity of Galeodidae includes 200 species and 9 genera [81], making this group one of the most diverse solifuge families. Within the region of Israel and Palestine, Galeodidae is represented by 16 species and 3 genera [81], but almost no ecological data are available for this order. Our observation of males appearing earlier in the year than females has been documented in other solifuge species [101,103,104], which may suggest that this is a consistent pattern for solifuge species, at least in the Northern Hemisphere. Due to the lack of information concerning postembryonic development, we are unable to determine which stage each individual immature belonged to. However, several studies have noted that first to fourth instars generally have six malleoli, whereas the later stage have ten [101,102,105]; thus, we believe that our representatives align with these observations. This information is crucial for the identification of solifuges species, and can benefit from the identification of nonadults in a study like ours.

5. Conclusions

Collection of any new data on arachnids, especially in a well-preserved nature reserve, is an essential step toward long-term monitoring. Our study setup of ECII with two slopes contrasting in solar radiation has additional importance. The two slopes with minimal distance between them enable a microhabitat-resolution laboratory for changes in species level. We found overlap in arachnid species between slopes to be 37.8%. Comparing our findings to findings from the same site but from a different taxonomic group and different sampling period (1999–2001), this percentage is slightly higher from the overlap found between ant species at the different slopes—25.8% [16], and three times higher than plant species overlap between slopes—11.6% [14]. However, overlap of species occurrence between slopes in the same sampling period (2019–2021) was found to be 46% in ants and 13% in plants (Finkel et al., in preparation). This limited overlap between slopes (below 50%) may indicate that the EC model with its temperature gradient within a small area, while other variables besides humidity and temperature are controlled (in comparison to studies encompassing many sites, each with its own variables, including human interference in many possible modes), may also represent the global biogeographical distribution. We suggest that our study can be used as a baseline for habitat use by species, and their local distribution. Future long-term monitoring may detect changes in species abundance compared to our findings, such as disappearance or appearance of species, as a response to climate change, or between habitats within the SFS. We therefore suggest that the EC setup could be used as a research method, condensing large distributional distances into a small space, and that ECII should be established as a climate change field laboratory.
To conclude, we suggest that our research method—a consecutive sampling effort of all arachnid taxa, in diverse microhabitats, located within a nature reserve in the East Mediterranean biodiversity hotspot—should be taken as a benchmark for future research focused on the understanding of biodiversity and ecology of arachnids. A global effort aimed at better understanding the anthropogenic direct effects (cultivation, urbanization, etc.) and indirect effects (such as global warming) on biodiversity should refer to a “natural” baseline, which research conducted in natural reserves may produce.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/d16090540/s1, Table S1: Rank abundance of arachnid orders by slopes and valley; Table S2: List of the taxa found in this study with their abundances by slopes and valley; Table S3: List of all Solifugae collected and described in this study, including their age and sex, specific slope, row number, and trap information; Table S4: Complete dataset of Keziv Arachnid pitfall traps.

Author Contributions

Conceptualization, M.F. and E.G.-R.; methodology, M.F. and E.G.-R.; validation, E.G.-R., M.F., Z.G. and E.G.; formal analysis, E.G.-R. and E.G.; investigation, M.F., A.B.-A., G.S., I.A.S., Z.G., R.H., E.G., T.S. and E.G.-R.; resources, M.F. and E.G.-R.; data curation, M.F., I.A.S., Z.G., R.H., E.G., T.S. and E.G.-R.; writing—original draft preparation, E.G.-R., Z.G., R.H., E.G., T.S. and M.F.; writing—review and editing, all authors; visualization, I.A.S., Z.G., E.G., T.S., M.F. and E.G.-R.; supervision, M.F. and E.G.-R.; project administration, M.F. and E.G.-R. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding but was supported by infrastructure at Tefen High School and the National Natural History Collections, The Hebrew University of Jerusalem. T.S. was supported by the strategic research fund of the University of Veterinary Medicine Budapest (Grant No. SRF-002).

Institutional Review Board Statement

Not applicable, as the study was conducted on non-CITES arthropods, under a permit of the Israel Nature and Parks Authority.

Data Availability Statement

The complete dataset of Keziv Arachnid pitfall traps will be available upon acceptance as a Supplementary Table.

Acknowledgments

The authors wish to thank “Tefen High School Biodiversity Research Project”. Tefen High School is located in the Western Upper Galilee, Israel. The multiyear research project is aimed at monitoring and gaining a better understanding of the flora and invertebrate fauna biodiversity in the Upper Galilee nature reserves. Under the supervision of Meir Finkel and in collaboration with Israel top researchers in those fields, pupils work and prepare their high school theses. This study was conducted under Israel Nature and Parks Authority (INPA) permits number 2019/42320 and 2020/42545 to Meir Finkel. We thank Israel Nature and Parks Authority for their permission to work in Keziv Nature Reserve. We wish to thank Mira Cohen (HUJ) for assistance in DNA extraction and COI sequencing, Valeria Arabesky (HUJ) for assistance in sorting, and Shlomi Aharon (HUJ) for helping identify some pholcid and agelenid spiders. Amir Weinstein and Rony Livne kindly provided several photos of live arachnids. Pierre Oger kindly provided photos of the habitus and genitalia of H. latifasciatum, with their determination by Wanda Wesołowska. We wish to thank the three anonymous reviewers and the editors for their useful comments that improved this publication.

Conflicts of Interest

The authors declare no conflicts of interest.

Appendix A

Figure A1. Schematic representation of the microhabitat (under tree, shrub, or in the open patch) of pitfall traps in the study. On the left of each row in the scheme, the slope and the number the “station” is written. Each cell represents a pitfall trap. Green cells represent pitfall traps installed under trees, orange cells represent pitfall traps installed under shrubs, and yellow cells represent pitfall traps installed in the open patches.
Figure A1. Schematic representation of the microhabitat (under tree, shrub, or in the open patch) of pitfall traps in the study. On the left of each row in the scheme, the slope and the number the “station” is written. Each cell represents a pitfall trap. Green cells represent pitfall traps installed under trees, orange cells represent pitfall traps installed under shrubs, and yellow cells represent pitfall traps installed in the open patches.
Diversity 16 00540 g0a1
Figure A2. Violin plot of individual by trap and microhabitat in the SFS slope: grassland in open patches: pale grey; shrubs: light grey; under tree canopy: dark grey.
Figure A2. Violin plot of individual by trap and microhabitat in the SFS slope: grassland in open patches: pale grey; shrubs: light grey; under tree canopy: dark grey.
Diversity 16 00540 g0a2
Figure A3. Theraphosidae species habitat use. Chaetopelma concolor: all individuals except for those trapped in row 1 (3 individuals) and row 2 (1 individual) were trapped under trees. Ischnocolus meron: out of 16 individuals, 13 were trapped in garrigue (rows 2 + 3) and only 3 under trees (rows 4 + 7). Numbers on the right indicate the row number, numbers on the rows indicates number of individuals.
Figure A3. Theraphosidae species habitat use. Chaetopelma concolor: all individuals except for those trapped in row 1 (3 individuals) and row 2 (1 individual) were trapped under trees. Ischnocolus meron: out of 16 individuals, 13 were trapped in garrigue (rows 2 + 3) and only 3 under trees (rows 4 + 7). Numbers on the right indicate the row number, numbers on the rows indicates number of individuals.
Diversity 16 00540 g0a3
Figure A4. Species of the ground-spider genus Zelotes habitat use. Zelotes balcanicus was collected solely from traps under tree canopies; Zelotes meronensis was mostly collected from pitfalls under shrubs, and Zelotes scrutatus was collected solely from pitfall traps installed under shrubs in garrigue habitat of the SFS.). Numbers on the right indicate the row number, numbers on the rows indicates number of individuals.
Figure A4. Species of the ground-spider genus Zelotes habitat use. Zelotes balcanicus was collected solely from traps under tree canopies; Zelotes meronensis was mostly collected from pitfalls under shrubs, and Zelotes scrutatus was collected solely from pitfall traps installed under shrubs in garrigue habitat of the SFS.). Numbers on the right indicate the row number, numbers on the rows indicates number of individuals.
Diversity 16 00540 g0a4
Figure A5. Partitioned COI tree.
Figure A5. Partitioned COI tree.
Diversity 16 00540 g0a5
Figure A6. Unpartitioned COI tree.
Figure A6. Unpartitioned COI tree.
Diversity 16 00540 g0a6
Table A1. Lachesana salam sp. nov. COI sequence.
Table A1. Lachesana salam sp. nov. COI sequence.
Specimen CodeSpeciesSexYear
Collected
LocalityGenBank Accession
Keziv 1419LachesanasalamMale2020Nahal Keziv, Galilee, IsraelPQ300647
>seq96__20967_G01_7591858.ab1
NNNNNNGNTNGNNNCCTGATATAGCTTTTCCTCGAATGAATAATTTAAGATTTTGAT-
TATTGCCTCCTTCTTTGTTGTTGTTATTCATTTCTTCTATAGTAGAAATAGGAGTTGGAGCAGGATGAACAATCTA
TCCTCCATTAGCTTCTTTAATAGGTCATTCTGGTGAATCTGTCGATTTTGC-
TATTTTTTCGCTTCATTTAGCAGGTGCTTCTTCTATTTTAGGCTCTGTAAATTTTA
TTTCAACTATTATTAATATACGTTCTTATGGAATAAGAATGGAAAAAGTTCCTTTGTTT-
GTTTGGTCTGTCTTAGTAACAACTGTATTGTTATTATTGTCTTTACCTGTATTAGCAGGTGCTATTACTATATTATTA
ACAGATCGAAATTTTAATACTTCATTTTTTGATCCGGCTGGAGGAGGAGATCCAATTTT-
GTTTCAACATCTATTTTNCNNNNNTTGAAAACCCTGAAN

References

  1. Willis, K.J.; Whittaker, R.J. Species Diversity: Scale Matters. Science 2002, 295, 1245–1248. [Google Scholar] [CrossRef] [Scilit]
  2. Trivellone, V.; Bougeard, S.; Giavi, S.; Krebs, P.; Balseiro, D.; Dray, S.; Moretti, M. Factors Shaping Community Assemblages and Species Co-Occurrence of Different Trophic Levels. Ecol. Evol. 2017, 7, 4745–4754. [Google Scholar] [CrossRef] [Scilit]
  3. Pulliam, H.R. On the Relationship between Niche and Distribution. Ecol. Lett. 2000, 3, 349–361. [Google Scholar] [CrossRef] [Scilit]
  4. Zobel, M. The Relative of Species Pools in Determining Plant Species Richness: An Alternative Explanation of Species Coexistence? Trends Ecol. Evol. 1997, 12, 266–269. [Google Scholar] [CrossRef] [Scilit]
  5. Zobel, M.; Otto, R.; Laanisto, L.; Naranjo-Cigala, A.; Pärtel, M.; Fernández-Palacios, J.M. The Formation of Species Pools: Historical Habitat Abundance Affects Current Local Diversity: Species Pool Formation and Current Diversity. Glob. Ecol. Biogeogr. 2011, 20, 251–259. [Google Scholar] [CrossRef] [Scilit]
  6. Martín-Devasa, R.; Jiménez-Valverde, A.; Leprieur, F.; Baselga, A.; Gómez-Rodríguez, C. Dispersal Limitation Shapes Distance-decay Patterns of European Spiders at the Continental Scale. Glob. Ecol. Biogeogr. 2024, 33, e13810. [Google Scholar] [CrossRef] [Scilit]
  7. Jiménez-Valverde, A.; Lobo, J.M. Determinants of Local Spider (Araneidae and Thomisidae) Species Richness on a Regional Scale: Climate and Altitude vs. Habitat Structure. Ecol. Entomol. 2007, 32, 113–122. [Google Scholar] [CrossRef] [Scilit]
  8. Shreve, F. Conditions Indirectly Affecting Vertical Distribution on Desert Mountains. Ecology 1922, 3, 269. [Google Scholar] [CrossRef] [Scilit]
  9. Nevo, E.; Travleev, A.P.; Belova, N.A.; Tsatskin, A.; Pavlíček, T.; Kulik, A.F.; Tsvetkova, N.N.; Yemshanov, D.C. Edaphic Interslope and Valley Bottom Differences at “Evolution Canyon”, Lower Nahal Oren, Mount Carmel, Israel. Catena 1998, 33, 241–254. [Google Scholar] [CrossRef] [Scilit]
  10. Pavlícek, T.; Sharon, D.; Kravchenko, V.; Saaroni, H.; Nevoa, E. Microclimatic Interslope Differences Underlying Biodiversity Contrasts in “Evolution Canyon”, Mt. Carmel, Israel. Isr. J. Earth Sci. 2003, 52, 1–9. [Google Scholar] [CrossRef] [Scilit]
  11. Nevo, E. Asian, African and European Biota Meet at ‘Evolution Canyon’ Israel: Local Tests of Global Biodiversity and Genetic Diversity Patterns. Proc. R. Soc. Lond. B 1995, 262, 149–155. [Google Scholar] [CrossRef] [Scilit]
  12. Nevo, E. Evolution in Action across Phylogeny Caused by Microclimatic Stresses at “Evolution Canyon”. Theor. Popul. Biol. 1997, 52, 231–243. [Google Scholar] [CrossRef] [Scilit]
  13. Nevo, E. Evolution of Genome–Phenome Diversity under Environmental Stress. Proc. Natl. Acad. Sci. USA 2001, 98, 6233–6240. [Google Scholar] [CrossRef] [Scilit]
  14. Finkel, M.; Fragman, O.; Nevo, E. Biodiversity and Interslope Divergence of Vascular Plants Caused by Sharp Microclimatic Differences at “Evolution Canyon II”, Lower Nahal Keziv, Upper Galilee, Israel. Isr. J. Plant Sci. 2001, 49, 285–296. [Google Scholar] [CrossRef] [Scilit]
  15. Finkel, M.; Chikatunov, V.; Nevo, E. Coleoptera of Evolution Canyon II: Lower Nahal Keziv, Western Upper Galilee, Israel; Series Faunistica; Pensoft: Sofia, Bulgaria; Moscow, Russia, 2002. [Google Scholar]
  16. Finkel, M.; Ofer, J.; Beharav, A.; Nevo, E. Species Interslope Divergence of Ants Caused by Sharp Microclimatic Stresses at ‘Evolution Canyon’ II, Lower Nahal Keziv, Western Upper Galilee, Israel. Isr. J. Entomol. 2015, 44–45, 63–73. [Google Scholar]
  17. Grishkan, I.; Nevo, E.; Wasser, S.P.; Beharav, A. Adaptive Spatiotemporal Distribution of Soil Microfungi in ‘Evolution Canyon’ II, Lower Nahal Keziv, Western Upper Galilee, Israel: Soil Fungi Distribution in ‘Evolution Canyon’ II, Israel. Biol. J. Linn. Soc. 2003, 78, 527–539. [Google Scholar] [CrossRef] [Scilit]
  18. Nevo, E. “Evolution Canyon,” a Potential Microscale Monitor of Global Warming across Life. Proc. Natl. Acad. Sci. USA 2012, 109, 2960–2965. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Por, F.D. An Outline of the Zoogeography of the Levant1. Zool. Scr. 1975, 4, 5–20. [Google Scholar] [CrossRef] [Scilit]
  20. Yom-Tov, Y.; Tchernov, E. The Zoogeography of Israel: The Distribution and Abundance at a Zoogeographical Crossroad; Monographiae Biologicae; Springer: Dordrecht, The Netherlands, 1988. [Google Scholar]
  21. Greenstone, M.H. Determinants of Web Spider Species Diversity: Vegetation Structural Diversity vs. Prey Availability. Oecologia 1984, 62, 299–304. [Google Scholar] [CrossRef] [Scilit]
  22. Halaj, J.; Ross, D.; Moldenke, A. Habitat Structure and Prey Availabilty as Predictors of the Abundance Community Organization of Spiders in Western Oregon Forest Canopies. J. Arachnol. 1998, 26, 203–220. [Google Scholar]
  23. Košulič, O.; Michalko, R.; Hula, V. Impact of Canopy Openness on Spider Communities: Implications for Conservation Management of Formerly Coppiced Oak Forests. PLoS ONE 2016, 11, e0148585. [Google Scholar] [CrossRef] [Scilit]
  24. Siemann, E.; Tilman, D.; Haarstad, J.; Ritchie, M. Experimental Tests of the Dependence of Arthropod Diversity on Plant Diversity. Am. Nat. 1998, 152, 738–750. [Google Scholar] [CrossRef]
  25. Spears, L.R.; MacMahon, J.A. An Experimental Study of Spiders in a Shrub-Steppe Ecosystem: The Effects of Prey Availability and Shrub Architecture. J. Arachnol. 2012, 40, 218–227. [Google Scholar] [CrossRef] [Scilit]
  26. Cardoso, P.; Silva, I.; De Oliveira, N.G.; Serrano, A.R.M. Seasonality of Spiders (Araneae) in Mediterranean Ecosystems and Its Implications in the Optimum Sampling Period. Ecol. Entomol. 2007, 32, 516–526. [Google Scholar] [CrossRef] [Scilit]
  27. Chatzaki, M.; Trichas, A.; Markakis, G.; Mylonas, M. Seasonal Activity of the Ground Spider Fauna in a Mediterranean Ecosystem (Mt Youchtas, Crete, Greece). In Proceedings of the 17th European Colloquium of Arachnology, Edinburgh, UK, 14–18 July 1997; British Arachnological Society, Burnham Beeches: Buckinghamshire, UK, 1998. [Google Scholar]
  28. Ganem, Z.; Ferrante, M.; Lubin, Y.; Armiach Steinpress, I.; Gish, M.; Sharon, R.; Harari, A.R.; Keasar, T.; Gavish-Regev, E. Effects of Natural Habitat and Season on Cursorial Spider Assemblages in Mediterranean Vineyards. Insects 2023, 14, 782. [Google Scholar] [CrossRef] [Scilit]
  29. Gavish-Regev, E.; Lubin, Y.; Coll, M. Migration Patterns and Functional Groups of Spiders in a Desert Agroecosystem. Ecol. Entomol. 2008, 33, 202–212. [Google Scholar] [CrossRef] [Scilit]
  30. Malumbres-Olarte, J.; Crespo, L.C.; Domènech, M.; Cardoso, P.; Moya-Laraño, J.; Ribera, C.; Arnedo, M.A. How Iberian Are We? Mediterranean Climate Determines Structure and Endemicity of Spider Communities in Iberian Oak Forests. Biodivers. Conserv. 2020, 29, 3973–3996. [Google Scholar] [CrossRef] [Scilit]
  31. Pitta, E.; Zografou, K.; Poursanidis, D.; Chatzaki, M. Effects of Climate on Spider Beta Diversity across Different Mediterranean Habitat Types. Biodivers. Conserv. 2019, 28, 3971–3988. [Google Scholar] [CrossRef] [Scilit]
  32. Zografou, K.; Adamidis, G.C.; Komnenov, M.; Kati, V.; Sotirakopoulos, P.; Pitta, E.; Chatzaki, M. Diversity of Spiders and Orthopterans Respond to Intra-Seasonal and Spatial Environmental Changes. J. Insect Conserv. 2017, 21, 531–543. [Google Scholar] [CrossRef] [Scilit]
  33. Pozsgai, G.; Lhoumeau, S.; Amorim, I.R.; Boieiro, M.; Cardoso, P.; Costa, R.; Ferreira, M.T.; Leite, A.; Malumbres-Olarte, J.; Oyarzabal, G.; et al. The BALA Project: A Pioneering Monitoring of Azorean Forest Invertebrates over Two Decades (1999–2022). Sci. Data 2024, 11, 368. [Google Scholar] [CrossRef] [Scilit]
  34. Armiach, I.; Bernstein, I.; Tang, Y.; Dayan, T.; Gavish-Regev, E. Activity-Density Data Reveal Community Structure of Lycosidae at a Mediterranean Shrubland. Aramit 2016, 52, 16–24. [Google Scholar] [CrossRef] [Scilit]
  35. Lubin, Y.; Ferrante, M.; Musli, I.; Lövei, G.L. Diversity of Ground-Active Spiders in Negev Desert Habitats, Israel. J. Arid. Environ. 2020, 183, 104252. [Google Scholar] [CrossRef] [Scilit]
  36. Lubin, Y.; Angel, N.; Assaf, N. Ground Spider Communities in Experimentally Disturbed Mediterranean Woodland Habitats. Aramit 2011, 40, 85–93. [Google Scholar] [CrossRef] [Scilit]
  37. Whitehouse, M.E.A.; Shochat, E.; Shachak, M.; Lubin, Y. The Influence of Scale and Patchiness on Spider Diversity in a Semi-Arid Environment. Ecography 2002, 25, 395–404. [Google Scholar] [CrossRef] [Scilit]
  38. Sneh, A.; Bartov, Y.; Weissbrod, T.; Rosensaft, M. Geological Map of Israel 1998. Available online: https://www.gov.il/he/pages/israel-map-1-200k (accessed on 20 August 2024).
  39. Israel Meteorological Service Website. Available online: https://ims.gov.il/he/data_gov (accessed on 20 August 2024).
  40. Sharon, D. Areal Pattern of Rainfall in a Small Watershed as Affected by Wind and Other Meteorological Conditions. In Results of Research on Experimental Basins; International Association of Hydrology Sciences Publication, 1970; pp. 3–11. Available online: https://eurekamag.com/research/018/258/018258119.php (accessed on 20 August 2024).
  41. Sharon, D. The Distribution of Hydrologically Effective Rainfall Incident on Sloping Ground. J. Hydrol. 1980, 46, 165–188. [Google Scholar] [CrossRef] [Scilit]
  42. Sharon, D.; Adar, E.; Lieberman, G. Observations on the Differential Hydrological and/or Erosional Response of Opposite-Lying Slopes, as Related to Incident Rainfall. Isr. J. Earth Sci. 1983, 32, 71–74. [Google Scholar]
  43. Sharon, D.; Arazi, A. The Distribution of Wind-Driven Rainfall in a Small Valley: An Empirical Basis for Numerical Model Verification. J. Hydrol. 1997, 201, 21–48. [Google Scholar] [CrossRef] [Scilit]
  44. Cottle, H.J. Vegetation on North and South Slopes of Mountains in Southwestern Texas. Ecology 1932, 13, 121–134. [Google Scholar] [CrossRef] [Scilit]
  45. Stephenson, S.L. Exposure-Induced Differences in the Vegetation, Soils, and Microclimate of North- and South-Facing Slopes in Southwestern Virginia. Va. J. Sci. 1982, 33, 36–50. [Google Scholar]
  46. Palamarev, E. Paleobotanical Evidences of the Tertiary History and Origin of the Mediterranean Sclerophyll Dendroflora. Pl Syst Evol. 1989, 162, 93–107. [Google Scholar] [CrossRef] [Scilit]
  47. Levy, G. Crab-Spiders of Six Genera from Israel (Araneae: Thomisidae). Isr. J. Zool. 1973, 22, 107–141. [Google Scholar] [CrossRef]
  48. Levy, G. Araneae: Thomisidae; Fauna Palaestina Arachnida; The Israel Academy of Sciences and Humanities: Jerusalem, Israel, 1985; ISBN 978-965-208-058-5. [Google Scholar]
  49. Levy, G. The Family of Huntsman Spiders in Israel with Annotations on Species of the Middle East (Araneae: Sparassidae). J. Zool. 1989, 217, 127–176. [Google Scholar] [CrossRef] [Scilit]
  50. Levy, G. Spiders of the Genus Lachesana and a New Storenoid Genus from Israel (Araneae: Zodariidae). Zool. J. Linn. Soc. 1990, 98, 327–362. [Google Scholar] [CrossRef] [Scilit]
  51. Levy, G. The Spider Genera Palaestina, Trygetus, Zodarion and Ranops (Araneae, Zodariidae) in Israel with Annotations on Species of the Middle East. Isr. J. Zool. 1992, 38, 67–110. [Google Scholar]
  52. Levy, G. Revision of the Spider Subfamily Gnaphosinae in Israel (Araneae: Gnaphosidae). J. Nat. Hist. 1995, 29, 919–981. [Google Scholar] [CrossRef] [Scilit]
  53. Levy, G. The Agelenid Funnel-Weaver Family and the Spider Genus Cedicus in Israel (Araneae, Agelenidae and Cybaeidae). Zool. Scr. 1996, 25, 85–122. [Google Scholar] [CrossRef] [Scilit]
  54. Levy, G. Araneae Theridiidae; The Israel Academy of Sciences and Humanities: Jerusalem, Israel, 1998; ISBN 978-965-208-013-4. [Google Scholar]
  55. Levy, G. New Thomisid and Philodromid Spiders (Araneae) from Southern Israel. Bull. Br. Arachnol. Soc. 1999, 11, 185–190. [Google Scholar]
  56. Levy, G. Spiders of the Genera Anagraphis and Talanites (Araneae, Gnaphosidae) from Israel. Isr. J. Zool. 1999, 45, 215–223. [Google Scholar] [CrossRef]
  57. Levy, G. Spiders of Six Uncommon Drassodine Genera (Araneae: Gnaphosidae) from Israel. Isr. J. Zool. 1999, 45, 427–452. [Google Scholar] [CrossRef]
  58. Levy, G. Spiders of the Families Anyphaenidae, Hahniidae, Ctenidae, Zoridae, and Hersiliidae (Araneae) from Israel. Isr. J. Zool. 2003, 49, 1–31. [Google Scholar] [CrossRef] [Scilit]
  59. Levy, G. Spiders of the Genera Drassodes and Haplodrassus (Araneae, Gnaphosidae) from Israel. Isr. J. Zool. 2004, 50, 1–37. [Google Scholar] [CrossRef] [Scilit]
  60. Levy, G. Calommata (Atypidae) and New Spider Species (Araneae) from Israel. Zootaxa 2007, 1551, 1–30. [Google Scholar] [CrossRef] [Scilit]
  61. Levy, G. New Ground-Spider Genera and Species with Annexed Checklist of the Gnaphosidae (Araneae) of Israel. Zootaxa 2009, 2066, 1–49. [Google Scholar] [CrossRef] [Scilit]
  62. Magalhaes, I.L.F.; Aharon, S.; Ganem, Z.; Gavish-Regev, E. A New Semi-Cryptic Filistata from Caves in the Levant with Comments on the Limits of Filistata Insidiatrix (Forsskål, 1775) (Arachnida: Araneae: Filistatidae). EJT 2022, 831, 149–174. [Google Scholar] [CrossRef] [Scilit]
  63. Nentwig, W.; Blick, T.; Bosmans, R.; Gloor, D.; Hänggi, A.; Kropf, C. Spiders of Europe. Version 08.2023. Available online: https://araneae.nmbe.ch/ (accessed on 11 August 2023).
  64. Roberts, M. Collins Field Guide to the Spiders of Britain and Northern Europe; Harper Collins: London, UK, 1996. [Google Scholar]
  65. Tanasevitch, A. On Linyphiid Spiders (Araneae) from the Eastern and Central Mediterranean Kept at the Museum d’histoire Naturelle, Geneva. Rev. Suisse Zool. 2011, 118, 49–91. [Google Scholar] [CrossRef] [Scilit]
  66. Levy, G.; Amitai, P. Scorpiones; Fauna Palaestina; Israel Academy of Sciences and Humanities: Jerusalem, Israel, 1980; ISBN 978-965-208-016-5. [Google Scholar]
  67. Yahalomi, O.; Zvik, Y.; Tsoar, A.; Gavish-Regev, E. The Scorpions of Israel Field Guide, 1st ed.; Israel Nature Protection Authority: Jerusalem, Israel, 2018. [Google Scholar]
  68. Levy, G.; Shulov, A. The Solifuga of Israel. Isr. J. Zool. 1964, 13, 102–120. [Google Scholar] [CrossRef]
  69. Warburg, S.; Aharon, S.; Armiach Steinpress, I.; Sharma, P.P.; Harms, D.; Gavish-Regev, E. Pseudoscorpions of Israel: Annotated Checklist and Key, With New Records of Two Families (Arachnida: Pseudoscorpiones). Taxonomy 2023, 3, 466–495. [Google Scholar] [CrossRef] [Scilit]
  70. ter Braak, C.; Smilauer, P. Canoco Reference Manual and User’s Guide: Software for Ordination (Version 5.10); Microcomputer Power: Ithaca, NY, USA, 2018. [Google Scholar]
  71. ter Braak, C.; Smilauer, P. Canoco—Software for Ordination 2020.
  72. Lepš, J.; Šmilauer, P. Multivariate Analysis of Ecological Data Using CANOCO, 1st ed.; Cambridge University Press: Cambridge, UK, 2003; ISBN 978-0-521-81409-6. [Google Scholar]
  73. Jesussek, M.; Volk-Jesussek, H. Statisty. Available online: https://statisty.app/ (accessed on 20 August 2024).
  74. Magalhaes, I.L.F. Spreadsheets to Expedite Taxonomic Publications by Automatic Generation of Morphological Descriptions and Specimen Lists. Zootaxa 2019, 4624, 147–150. [Google Scholar] [CrossRef] [Scilit]
  75. Logunov, D.V. Taxonomic-faunistic notes on the jumping spiders of the Mediterranean (Aranei: Salticidae). Arthropoda Sel. 2015, 24, 33–85. [Google Scholar] [CrossRef] [Scilit]
  76. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA Primers for Amplification of Mitochondrial Cytochrome c Oxidase Subunit I from Diverse Metazoan Invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
  77. Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast Model Selection for Accurate Phylogenetic Estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [Scilit]
  78. Minh, B.Q.; Schmidt, H.A.; Chernomor, O.; Schrempf, D.; Woodhams, M.D.; Von Haeseler, A.; Lanfear, R. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Mol. Biol. Evol. 2020, 37, 1530–1534. [Google Scholar] [CrossRef] [Scilit]
  79. Hoang, D.T.; Chernomor, O.; von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Mol. Biol. Evol. 2018, 35, 518–522. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  80. World Spider Catalog Version 25. Available online: http://wsc.nmbe.ch (accessed on 25 June 2024).
  81. Natural History Museum Bern World Solifugae Catalog. Available online: http://wac.nmbe.ch (accessed on 25 June 2024).
  82. Cardoso, P.; Pekár, S.; Jocqué, R.; Coddington, J.A. Global Patterns of Guild Composition and Functional Diversity of Spiders. PLoS ONE 2011, 6, e21710. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  83. Prószyński, J. Atlas Rysunków Diagnostycznych Mniej Znanych Salticidae 2; Zeszyty Naukowe Wyższej Szkoly Rolniczo-Pedagogicznej: Siedlcach, Poland, 1987. [Google Scholar]
  84. Prószyński, J. Salticidae (Araneae) of the Levant. Ann. Zool. Warszawa 2003, 53, 1–180. [Google Scholar]
  85. Simon, E. Monographie Des Espèces Européennes de La Famille Des Attides (Attidae Sundewall.—Saltigradae Latreille). Ann. Société Entomol. Fr. 1868, 4, 11–72. [Google Scholar]
  86. Metzner, H. Jumping Spiders (Arachnida: Araneae: Salticidae) of the World. Available online: https://www.jumping-spiders.com (accessed on 29 June 2024).
  87. Metzner, H. Die Springspinnen (Araneae, Salticidae) Griechenlands. Andrias 1999, 14, 1–279. [Google Scholar]
  88. Lecigne, S. A New Species of Sintula (Linyphiidae), Redescription of Brigittea Iinocens (Dictynidae) and Eight Spider Species Newly Recorded for Turkey (Araneae). Arachnol. Mitteilungen Arachnol. Lett. 2021, 62, 11–34. [Google Scholar] [CrossRef] [Scilit]
  89. Prószyński, J. On Mostly New Species of Salticidae (Aranei) from Levant. Arthropoda Sel. 1999, 8, 231–262. [Google Scholar]
  90. Oger, P. Les Araignées de Belgique et de France. Available online: https://arachno.piwigo.com/ (accessed on 20 August 2024).
  91. Bosmans, R.; Gavalas, I. The Spiders (Araneae) of the Tiny Greek Island Iraklia (Kiklades), with the Descriptions of 5 New Harpactea Species (Araneae: Dysderidae), 3 Species New to Europe and 8 New to Greece. Parnass. Arch. 2023, 11 (Suppl. 1), 1–91. [Google Scholar]
  92. Thaler, K.; Knoflach, B. A New Lachesana Species from Greece and Additional Records from the Near East (Arachnida, Araneae, Zodariidae). Bull. Br. Arachnol. Soc. 2004, 13, 41–46. [Google Scholar]
  93. Simon, E. Histoire Naturelle des Araignées; Roret: Paris, France, 1892. [Google Scholar]
  94. Pickard-Cambridge, O. General List of the Spiders of Palestine and Syria, with Descriptions of Numerous New Species, and Characters of Two New Genera. Proc. Zool. Soc. Lond. 1872, 40, 183–354. [Google Scholar] [CrossRef] [Scilit]
  95. Zamani, A.; Marusik, Y.M. Revision of the Spider Family Zodariidae (Arachnida, Araneae) in Iran and Turkmenistan, with Seventeen New Species. ZooKeys 2021, 1035, 145–193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  96. Barriga, J.C.; Lassaletta, L.; Moreno, A.G. Ground-Living Spider Assemblages from Mediterranean Habitats under Different Management Conditions. J. Arachnol. 2010, 38, 258–269. [Google Scholar] [CrossRef] [Scilit]
  97. Lin, S.; Vasseur, L.; You, M.-S. Seasonal Variability in Spider Assemblages in Traditional and Transgenic Rice Fields. Environ. Entomol. 2016, 45, 537–546. [Google Scholar] [CrossRef] [Scilit]
  98. Zapata, W.; Vergara-Moreno, D.; Carrillo-Pallares, M.; Segovia-Paccini, A.; Navas, S.G.R.; Malumbres-Olarte, J. Seasonal Diversity of Spider Assemblages (Araneae: Arachnida) in the “Guillermo Piñeres” Botanical Garden, Turbaco–Colombia. Neotrop. Biodivers. 2023, 9, 17–28. [Google Scholar] [CrossRef] [Scilit]
  99. Gillespie, R.G.; Bennett, G.M.; De Meester, L.; Feder, J.L.; Fleischer, R.C.; Harmon, L.J.; Hendry, A.P.; Knope, M.L.; Mallet, J.; Martin, C.; et al. Comparing Adaptive Radiations Across Space, Time, and Taxa. J. Hered. 2020, 111, 1–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  100. Rolán-Alvarez, E. Sympatric Speciation as a By-Product of Ecological Adaptation in the Galician Littorina Saxatilis Hybrid Zone. J. Molluscan Stud. 2007, 73, 1–10. [Google Scholar] [CrossRef] [Scilit]
  101. Muma, M.H. The Life Cycle of Eremobates durangonus (Arachnida: Solpugida). Fla. Entomol. 1966, 49, 233–242. [Google Scholar] [CrossRef] [Scilit]
  102. Junqua, C. Recherches Biologiques et Histophysiologiques Sur Un Solifuge Saharien Othoes Saharae Panouse. In Me’moires du Muse´um National d’Histoire Naturelle, Se´ries A; Muséum national d’Histoire naturelle: Paris, France, 1966; pp. 1–124. [Google Scholar]
  103. Punzo, F. Natural History and Life Cycle of the Solifuge Eremobates marathoni Muma & Brookhart (Solifugae, Eremobatidae). Bull. Br. Arachnol. Soc. 1998, 11, 111–118. [Google Scholar]
  104. Jones, R.R.; Batista-Perales, D.L.; Garcia, E.L. Home on the Range: A Pilot Study on Solifuge (Solifugae: Eremobatidae) Site Fidelity at Rocky Mountain Arsenal National Wildlife Refuge. J. Arachnol. 2022, 50, 47–50. [Google Scholar] [CrossRef] [Scilit]
  105. Hrušková-Martišová, M.; Pekár, S.; Bilde, T. Coercive Copulation in Two Sexually Cannibalistic Camel-spider Species (Arachnida: Solifugae). J. Zool. 2010, 282, 91–99. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Map of the Eastern Mediterranean Region (left) and Israel and Palestine with the study locality “Evolution Canyon” II (right).
Figure 1. Map of the Eastern Mediterranean Region (left) and Israel and Palestine with the study locality “Evolution Canyon” II (right).
Diversity 16 00540 g001
Figure 2. (A) A mirror-image of a cross-section of the “Evolution Canyon” II microsite in Nahal Keziv, Western Upper Galilee, Israel, as photographed in 1999 (Pic. Meir Finkel). For convenience, NFS appears on the left, which is the south side of the canyon. (B) An air photograph of ECII (from Israel official maps website govmap.il: https://www.govmap.gov.il/?c=204000,595000&z=0, accessed on 1 August 2022). The NFS and SFS rows (sampling stations) are color coded in blue and orange, respectively, and the valley is coded in green.
Figure 2. (A) A mirror-image of a cross-section of the “Evolution Canyon” II microsite in Nahal Keziv, Western Upper Galilee, Israel, as photographed in 1999 (Pic. Meir Finkel). For convenience, NFS appears on the left, which is the south side of the canyon. (B) An air photograph of ECII (from Israel official maps website govmap.il: https://www.govmap.gov.il/?c=204000,595000&z=0, accessed on 1 August 2022). The NFS and SFS rows (sampling stations) are color coded in blue and orange, respectively, and the valley is coded in green.
Diversity 16 00540 g002
Figure 3. Rank abundance of Araneae and Opiliones collected in this study by slope and valley. NFS: black, VB: grey, SFS: white. Solifugae and Scorpiones were mainly collected from the SFS, while only three individuals of Pseudoscorpiones were collected, and therefore excluded from this graph, but see text.
Figure 3. Rank abundance of Araneae and Opiliones collected in this study by slope and valley. NFS: black, VB: grey, SFS: white. Solifugae and Scorpiones were mainly collected from the SFS, while only three individuals of Pseudoscorpiones were collected, and therefore excluded from this graph, but see text.
Diversity 16 00540 g003
Figure 4. Rank abundance of 34 species (with 10 or more individuals) out of the 111 arachnids (species, morphospecies, and higher taxa that were not identified to genus or species) collected in this study by slope and valley. NFS: black, VB: grey, SFS: white.
Figure 4. Rank abundance of 34 species (with 10 or more individuals) out of the 111 arachnids (species, morphospecies, and higher taxa that were not identified to genus or species) collected in this study by slope and valley. NFS: black, VB: grey, SFS: white.
Diversity 16 00540 g004
Figure 5. Violin plot of individuals by trap and slope, with significantly more individuals in the SFS. SFS: pale grey, shrubs: light grey, under tree canopy: dark grey. See Table 1 for the statistics.
Figure 5. Violin plot of individuals by trap and slope, with significantly more individuals in the SFS. SFS: pale grey, shrubs: light grey, under tree canopy: dark grey. See Table 1 for the statistics.
Diversity 16 00540 g005
Figure 6. Arachnid species found in this study: (AE) the five most abundant spider species; (F) harvestmen; (G,H) the two most abundant scorpion species. (A) Pax islamita (Simon, 1873) (Zodariidae, female); (B) Chaetopelma concolor (Simon, 1873) (Theraphosidae, female); (C) Hogna graeca (Roewer, 1951) (Lycosidae, female); (D) Prochora lycosiformis (O. Pickard-Cambridge, 1872) (Miturgidae, male); (E) Loxosceles rufescens (Dufour, 1820) (Sicariidae, male); (F) Dicranolasma hoberlandti Šilhavý, 1956 (Dicranolasmatidae); (G) Hottentotta judaicus (Simon, 1872) (Buthidae); (H) Scorpio fuscus (Ehrenberg, 1829) (Scorpionidae). Photographs by Amir Weinstein (A,F); Igor Armiach Steinpress (BD); Zeana Ganem (E), and Rony Livne (G,H). As images were taken in nature, no scale bars are presented, and the animals are presented not in scale.
Figure 6. Arachnid species found in this study: (AE) the five most abundant spider species; (F) harvestmen; (G,H) the two most abundant scorpion species. (A) Pax islamita (Simon, 1873) (Zodariidae, female); (B) Chaetopelma concolor (Simon, 1873) (Theraphosidae, female); (C) Hogna graeca (Roewer, 1951) (Lycosidae, female); (D) Prochora lycosiformis (O. Pickard-Cambridge, 1872) (Miturgidae, male); (E) Loxosceles rufescens (Dufour, 1820) (Sicariidae, male); (F) Dicranolasma hoberlandti Šilhavý, 1956 (Dicranolasmatidae); (G) Hottentotta judaicus (Simon, 1872) (Buthidae); (H) Scorpio fuscus (Ehrenberg, 1829) (Scorpionidae). Photographs by Amir Weinstein (A,F); Igor Armiach Steinpress (BD); Zeana Ganem (E), and Rony Livne (G,H). As images were taken in nature, no scale bars are presented, and the animals are presented not in scale.
Diversity 16 00540 g006aDiversity 16 00540 g006b
Figure 7. Arachnid abundance (left axis, columns) and species richness (right axis, black dots) by sampling rows (“sampling stations”). Abundance column: NFS: black, VB: grey, SFS: white.
Figure 7. Arachnid abundance (left axis, columns) and species richness (right axis, black dots) by sampling rows (“sampling stations”). Abundance column: NFS: black, VB: grey, SFS: white.
Diversity 16 00540 g007
Figure 8. Venn diagram of the number of arachnid species found in slopes and valley, and the species overlap between them. NFS: dark grey, VB: light grey, SFS: white.
Figure 8. Venn diagram of the number of arachnid species found in slopes and valley, and the species overlap between them. NFS: dark grey, VB: light grey, SFS: white.
Diversity 16 00540 g008
Figure 9. Total number of individuals collected during the two-year sampling. (A) Araneae; (B) the most dominant web-builders (Agelenidae-dark grey, Theraphosidae-white) and ambush-hunter spider families (Salticidae-light grey, Sicariidae-black,); (C) the most dominant ground-dwelling spiders (Dysderidae-dark grey, Gnaphosidae-white with grey lines, Lycosidae-light grey, Miturgidae-black, and Zodariidae-white); (D) other arachnid orders: Opiliones, Scorpiones, and Solifugae (Pseudoscorpiones were not included as only three individuals were collected). Guilds are after Cardoso et al. 2011 [82].
Figure 9. Total number of individuals collected during the two-year sampling. (A) Araneae; (B) the most dominant web-builders (Agelenidae-dark grey, Theraphosidae-white) and ambush-hunter spider families (Salticidae-light grey, Sicariidae-black,); (C) the most dominant ground-dwelling spiders (Dysderidae-dark grey, Gnaphosidae-white with grey lines, Lycosidae-light grey, Miturgidae-black, and Zodariidae-white); (D) other arachnid orders: Opiliones, Scorpiones, and Solifugae (Pseudoscorpiones were not included as only three individuals were collected). Guilds are after Cardoso et al. 2011 [82].
Diversity 16 00540 g009
Figure 10. Paragaleodes fulvipes Birula, 1905, adult male and female reproductive morphology. (A) Retrolateral view of male chelicerae. (B) Ventral view of female genital operculum. Both scale bars refer to 1 mm.
Figure 10. Paragaleodes fulvipes Birula, 1905, adult male and female reproductive morphology. (A) Retrolateral view of male chelicerae. (B) Ventral view of female genital operculum. Both scale bars refer to 1 mm.
Diversity 16 00540 g010
Figure 11. Retrolateral views of Paragaleodes fulvipes Birula, 1905, chelicerae at varying life stages. (A) Early instar chelicera lacking submedial teeth on both the moveable finger and fixed finger. (B) Later juvenile with one submedial tooth on moveable finger. (C) Late-stage juvenile with two submedial teeth on moveable finger. (D) Adult female chelicerae with three submedial teeth on moveable finger. All scale bars refer to 1 mm.
Figure 11. Retrolateral views of Paragaleodes fulvipes Birula, 1905, chelicerae at varying life stages. (A) Early instar chelicera lacking submedial teeth on both the moveable finger and fixed finger. (B) Later juvenile with one submedial tooth on moveable finger. (C) Late-stage juvenile with two submedial teeth on moveable finger. (D) Adult female chelicerae with three submedial teeth on moveable finger. All scale bars refer to 1 mm.
Diversity 16 00540 g011
Figure 12. Species response curves for the most dominant species by plant-cover percentage.
Figure 12. Species response curves for the most dominant species by plant-cover percentage.
Diversity 16 00540 g012
Figure 13. Species response curves for species in the genus Zelotes. Abundance of the species that were affected significantly by plant-cover percentage.
Figure 13. Species response curves for species in the genus Zelotes. Abundance of the species that were affected significantly by plant-cover percentage.
Diversity 16 00540 g013
Figure 14. Tri-plot ordination diagram for the five arachnid orders, seven samples, and the significant variable (only the SFS was significant, but as this is a categorical variable, the NFS is also presented in the graph). Arachnid orders are visualized as small empty triangulates, samples (rows 1–7) are visualized as circles with their size relative to the richness in the sample, and colored as NFS: black, VB: grey, SFS: white.
Figure 14. Tri-plot ordination diagram for the five arachnid orders, seven samples, and the significant variable (only the SFS was significant, but as this is a categorical variable, the NFS is also presented in the graph). Arachnid orders are visualized as small empty triangulates, samples (rows 1–7) are visualized as circles with their size relative to the richness in the sample, and colored as NFS: black, VB: grey, SFS: white.
Diversity 16 00540 g014
Figure 15. Tri-plot ordination diagram for all 111 arachnid species, seven samples, and the significant variables (plant-cover percentages and slope (only NFS was significant, but as this is a categorical variable, the SFS is also presented in the graph)). Species are visualized as arrowed lines, samples (rows 1–7) are visualized as circles with their size relative to the species richness in the sample, and colored as NFS: black, VB: grey, SFS: white. Only species with eight or more individuals are plotted with their name (40 species), if only one species of a genus is represented in the ordination, it appears with genus name only, if more than one species of a genus, a full name is presented. Species with less than 10 individuals are plotted as arrows without name. Orders and family arrows are color coded: Spider families: Anyphaenidae, Cithaeronidae, Filistatidae, Gallieniellidae (cf.), Hersiliidae, Palpimanidae, Pholcidae, and Segestriidae: black (small arrow); Agelenidae, Cybaeidae, Linyphiidae and Theridiidae: dark blue; Ganaphosidae: dark orange; Dysderidae: pink; Cheiracanthiidae, Clubionidae, Liocranidae, Philodromidae, Sparassidae, Thomisidae, and Trachelidae: light purple; Lycosidae, Miturgidae, Pisauridae, and Zoropsidae: brown; Salticidae: dark purple; Scytodidae and Sicariidae: red; Theraphosidae and Idiopidae: grey; Zodariidae: dark green; Opiliones: light green; Scorpiones and Solifugae: black (large arrow); Pseudoscorpiones: light orange.
Figure 15. Tri-plot ordination diagram for all 111 arachnid species, seven samples, and the significant variables (plant-cover percentages and slope (only NFS was significant, but as this is a categorical variable, the SFS is also presented in the graph)). Species are visualized as arrowed lines, samples (rows 1–7) are visualized as circles with their size relative to the species richness in the sample, and colored as NFS: black, VB: grey, SFS: white. Only species with eight or more individuals are plotted with their name (40 species), if only one species of a genus is represented in the ordination, it appears with genus name only, if more than one species of a genus, a full name is presented. Species with less than 10 individuals are plotted as arrows without name. Orders and family arrows are color coded: Spider families: Anyphaenidae, Cithaeronidae, Filistatidae, Gallieniellidae (cf.), Hersiliidae, Palpimanidae, Pholcidae, and Segestriidae: black (small arrow); Agelenidae, Cybaeidae, Linyphiidae and Theridiidae: dark blue; Ganaphosidae: dark orange; Dysderidae: pink; Cheiracanthiidae, Clubionidae, Liocranidae, Philodromidae, Sparassidae, Thomisidae, and Trachelidae: light purple; Lycosidae, Miturgidae, Pisauridae, and Zoropsidae: brown; Salticidae: dark purple; Scytodidae and Sicariidae: red; Theraphosidae and Idiopidae: grey; Zodariidae: dark green; Opiliones: light green; Scorpiones and Solifugae: black (large arrow); Pseudoscorpiones: light orange.
Diversity 16 00540 g015
Figure 16. Habitus of Habrocestum nahalit sp. nov. and H. latifasciatum. (A) Dorsal view of H. nahalit sp. nov. (B,C) H. latifasciatum from Türkiye (photo by Pierre Oger, determination by Wanda Wesołowska). (B) Dorsal view of H. latifasciatum. (C) Lateral view of H. latifasciatum. Scale bar is 1 mm.
Figure 16. Habitus of Habrocestum nahalit sp. nov. and H. latifasciatum. (A) Dorsal view of H. nahalit sp. nov. (B,C) H. latifasciatum from Türkiye (photo by Pierre Oger, determination by Wanda Wesołowska). (B) Dorsal view of H. latifasciatum. (C) Lateral view of H. latifasciatum. Scale bar is 1 mm.
Diversity 16 00540 g016
Figure 17. Palps of Habrocestum nahalit sp. nov. and H. latifasciatum. (AC) H. nahalit sp. nov., male palp; (A) prolateral view; (B) ventral view; (C) retrolateral view. (DF) H. latifasciatum from Türkiye (all photos by Pierre Oger, determination by Wanda Wesołowska); (D) prolateral view; (E) ventral view; (F) retrolateral view. Abbreviations: aL—apical lobe, opT—opaque part of the tegulum, pL—proximal lobe. Scale bar is 0.2 mm.
Figure 17. Palps of Habrocestum nahalit sp. nov. and H. latifasciatum. (AC) H. nahalit sp. nov., male palp; (A) prolateral view; (B) ventral view; (C) retrolateral view. (DF) H. latifasciatum from Türkiye (all photos by Pierre Oger, determination by Wanda Wesołowska); (D) prolateral view; (E) ventral view; (F) retrolateral view. Abbreviations: aL—apical lobe, opT—opaque part of the tegulum, pL—proximal lobe. Scale bar is 0.2 mm.
Diversity 16 00540 g017
Figure 18. Female epigynae of Habrocestum nahalit sp. nov. (HUJ- Ar 21674) and H. latifasciatum. (A,D). H. latifasciatum from Türkiye (all photos by Pierre Oger, determination by Wanda Wesołowska). (A) Female epigynum, ventral view; (D) female vulva, dorsal view. (B,C,E,F) H. nahalit sp. nov. (B) Female epigynum, ventral view; (C) cleared epigynum, ventral view; (E) female vulva, ventral view; (F) female vulva, dorsal view. Abbreviations used: pR—pocket for RTA.
Figure 18. Female epigynae of Habrocestum nahalit sp. nov. (HUJ- Ar 21674) and H. latifasciatum. (A,D). H. latifasciatum from Türkiye (all photos by Pierre Oger, determination by Wanda Wesołowska). (A) Female epigynum, ventral view; (D) female vulva, dorsal view. (B,C,E,F) H. nahalit sp. nov. (B) Female epigynum, ventral view; (C) cleared epigynum, ventral view; (E) female vulva, ventral view; (F) female vulva, dorsal view. Abbreviations used: pR—pocket for RTA.
Diversity 16 00540 g018
Figure 19. Antrior part of the female epigynum of Habrocestum nahalit sp. nov. (HUJ- Ar 421673). (A) Female epigynum, ventral view; (B) female vulva, ventral view. (C) Female vulva, dorsal view; (D) cleared vulva, dorsal view.
Figure 19. Antrior part of the female epigynum of Habrocestum nahalit sp. nov. (HUJ- Ar 421673). (A) Female epigynum, ventral view; (B) female vulva, ventral view. (C) Female vulva, dorsal view; (D) cleared vulva, dorsal view.
Diversity 16 00540 g019
Figure 20. Intraspecific variation in the male palp of Habrocestum nahalit sp. nov. (AD) Holotype palp, from Nahal Keziv: (A) prolateral view; (B) ventral–prolateral view; (C) ventral view; (D) lateral view. (EH) Paratype’s palp from Mt. Karmel: (E) prolateral view; (F) ventral–prolateral view; (G) ventral view; (H) lateral view. Scale bar is 0.2 mm.
Figure 20. Intraspecific variation in the male palp of Habrocestum nahalit sp. nov. (AD) Holotype palp, from Nahal Keziv: (A) prolateral view; (B) ventral–prolateral view; (C) ventral view; (D) lateral view. (EH) Paratype’s palp from Mt. Karmel: (E) prolateral view; (F) ventral–prolateral view; (G) ventral view; (H) lateral view. Scale bar is 0.2 mm.
Diversity 16 00540 g020
Figure 21. Taxonomic drawings of Habrocestum nahalit sp. nov. (AC) Holotype palp, from Nahal Keziv: (A) prolateral view; (B) ventral view; (C) retrolateral view. (D) Paratype’s epigyne, ventral view. (E) Vulva, dorsal view. Scale bar is 0.2 mm.
Figure 21. Taxonomic drawings of Habrocestum nahalit sp. nov. (AC) Holotype palp, from Nahal Keziv: (A) prolateral view; (B) ventral view; (C) retrolateral view. (D) Paratype’s epigyne, ventral view. (E) Vulva, dorsal view. Scale bar is 0.2 mm.
Diversity 16 00540 g021
Figure 22. Lachesana salam sp. nov., habitus (HUJ- Ar 21618) (AC) Holotype ♂. (A) Dorsal view. (B) Frontal view of the eyes. (C) Abdomen dorsal view. Lachesana rufiventris (Simon, 1873), habitus (HUJ- Ar 12991). (DF) ♂. (D) Dorsal view. (E) Abdomen dorsal view. (F). Frontal view of the eyes. Scale lines = 0.5 mm (B,F).
Figure 22. Lachesana salam sp. nov., habitus (HUJ- Ar 21618) (AC) Holotype ♂. (A) Dorsal view. (B) Frontal view of the eyes. (C) Abdomen dorsal view. Lachesana rufiventris (Simon, 1873), habitus (HUJ- Ar 12991). (DF) ♂. (D) Dorsal view. (E) Abdomen dorsal view. (F). Frontal view of the eyes. Scale lines = 0.5 mm (B,F).
Diversity 16 00540 g022
Figure 23. Lachesana male palpal RTA (left). (A,C) Lachesana salam sp. nov., retrolateral view. (B) Lachesana rufiventris (Simon, 1873), retrolateral view. (C) Lachesana salam sp. nov., RTA retrolateral view. Scale lines = 0.5 mm (A,B), 0.1 mm (C). Abbreviations: RTA—retrolateral tibial apophysis; RTAh—handle retrolateral tibial apophysis; Vm—ventral margin of deep concavity.
Figure 23. Lachesana male palpal RTA (left). (A,C) Lachesana salam sp. nov., retrolateral view. (B) Lachesana rufiventris (Simon, 1873), retrolateral view. (C) Lachesana salam sp. nov., RTA retrolateral view. Scale lines = 0.5 mm (A,B), 0.1 mm (C). Abbreviations: RTA—retrolateral tibial apophysis; RTAh—handle retrolateral tibial apophysis; Vm—ventral margin of deep concavity.
Diversity 16 00540 g023
Figure 24. Lachesana male palp (left). (AD) Lachesana salam sp. nov. ♂(HUJ- Ar 21619). (A) Retrolateral view. (B) Mesal view. (C) Ventral view. (D) Dorsal view. (EH) Lachesana rufiventris (Simon, 1873) ♂(HUJ- Ar 12991). (E) Retrolateral view. (F) Mesal view. (G) Ventral view. (H) Dorsal view. Scale lines = 1 mm.
Figure 24. Lachesana male palp (left). (AD) Lachesana salam sp. nov. ♂(HUJ- Ar 21619). (A) Retrolateral view. (B) Mesal view. (C) Ventral view. (D) Dorsal view. (EH) Lachesana rufiventris (Simon, 1873) ♂(HUJ- Ar 12991). (E) Retrolateral view. (F) Mesal view. (G) Ventral view. (H) Dorsal view. Scale lines = 1 mm.
Diversity 16 00540 g024
Figure 25. Endites and Chelicera. (AD) Lachesana salam sp. nov ♂(HUJ- Ar 21620). (A) Endites ventral view. (B,C) Chelicerae posterior view. (D) Fang and teth of left chelicera, posterior view. (E,F) Lachesana rufiventris (Simon, 1873)♂(HUJ- Ar 12991) (AD). (E) Endites, ventral view. (F,G) Chelicerae posterior view. (H) Fang and teeth of left chelicera, posterior view. Scale lines = 1 mm (AC,EG), 0.1 mm (D,H).
Figure 25. Endites and Chelicera. (AD) Lachesana salam sp. nov ♂(HUJ- Ar 21620). (A) Endites ventral view. (B,C) Chelicerae posterior view. (D) Fang and teth of left chelicera, posterior view. (E,F) Lachesana rufiventris (Simon, 1873)♂(HUJ- Ar 12991) (AD). (E) Endites, ventral view. (F,G) Chelicerae posterior view. (H) Fang and teeth of left chelicera, posterior view. Scale lines = 1 mm (AC,EG), 0.1 mm (D,H).
Diversity 16 00540 g025
Figure 26. Taxonomic drawings of Lachesana salam sp. nov. Male palp, from Nahal Keziv. (A) Ventral view; (B) RTA.
Figure 26. Taxonomic drawings of Lachesana salam sp. nov. Male palp, from Nahal Keziv. (A) Ventral view; (B) RTA.
Diversity 16 00540 g026
Table 1. Number (minimum, maximum, median, and mean) of individuals collected in this study by slope and habitat.
Table 1. Number (minimum, maximum, median, and mean) of individuals collected in this study by slope and habitat.
HabitatNumber of TrapsNumber of Individuals
Minimum MaximumMedianMean
SFS304853535
VB1013623032.3
NFS304341212.5
SFS: Under tree canopy74503634
SFS: Under shrub99453231.67
SFS: Grassland in open patches149853537.64
Table 2. Eye measurements of holotype/paratypes (average) L. salam sp. nov.
Table 2. Eye measurements of holotype/paratypes (average) L. salam sp. nov.
Holo/ParaAMEALEPMEPLEAME-AMEAME-PMEPME-PME
HOLO0.180.170.180.130.090.160.16
PARA0.170.16180.140.080.110.13
Table 3. Holotype L. salam sp. nov leg spination; d—dorsal, r-l—right–left, la—lateral, ve—ventral.
Table 3. Holotype L. salam sp. nov leg spination; d—dorsal, r-l—right–left, la—lateral, ve—ventral.
legFemurPatellaTibiaMetatarsusTarsusTotal
I4d, 2-2 (r-l) la1 (r) la1 (r) la, 10ve8ve11ve39
II4d, 4-4 (r-l) la1 (r) la2 (r) la, 8ve1 (r) la, 9ve9ve42
III4d, 3-2 (r-l) la1d, 2-1 (r-l) la3d, 3-2 (r-l) la, 6ve1d, 4-3 (r-l) la, 13ve2 (r) la, 10ve60
IV4d, 3-2(r-l) la1d, 2-1 (r-l) la3d, 3-2 (r-l) la, 10ve1d, 4-3 (r-l) la, 13ve11ve63
Table 4. Leg length measurements of holotype/paratypes (average) L. salam sp. nov.
Table 4. Leg length measurements of holotype/paratypes (average) L. salam sp. nov.
legFemurPatellaTibiaMetatarsusTarsusTotal
I4.32/4.061.79/1.783.3/3.043.29/3.162.3/2.0915.00/14.13
II4.04/3.621.81/1.742.77/2.693.00/3.232.10/2.0413.72/13.32
III3.87/3.611.78/1.642.15/2.184.17/3.832.44/2.1214.41/13.38
IV4.52/4.381.83/1.892.88/2.985.56/5.472.7/2.5817.49/17.30
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Finkel, M.; Ben-Asher, A.; Shmula, G.; Armiach Steinpress, I.; Ganem, Z.; Hammouri, R.; Garcia, E.; Szűts, T.; Gavish-Regev, E. Arachnid Assemblage Composition Diverge between South- and North-Facing Slopes in a Levantine Microgeographic Site. Diversity 2024, 16, 540. https://doi.org/10.3390/d16090540

AMA Style

Finkel M, Ben-Asher A, Shmula G, Armiach Steinpress I, Ganem Z, Hammouri R, Garcia E, Szűts T, Gavish-Regev E. Arachnid Assemblage Composition Diverge between South- and North-Facing Slopes in a Levantine Microgeographic Site. Diversity. 2024; 16(9):540. https://doi.org/10.3390/d16090540

Chicago/Turabian Style

Finkel, Meir, Amit Ben-Asher, Gur Shmula, Igor Armiach Steinpress, Zeana Ganem, Rami Hammouri, Erika Garcia, Tamás Szűts, and Efrat Gavish-Regev. 2024. "Arachnid Assemblage Composition Diverge between South- and North-Facing Slopes in a Levantine Microgeographic Site" Diversity 16, no. 9: 540. https://doi.org/10.3390/d16090540

APA Style

Finkel, M., Ben-Asher, A., Shmula, G., Armiach Steinpress, I., Ganem, Z., Hammouri, R., Garcia, E., Szűts, T., & Gavish-Regev, E. (2024). Arachnid Assemblage Composition Diverge between South- and North-Facing Slopes in a Levantine Microgeographic Site. Diversity, 16(9), 540. https://doi.org/10.3390/d16090540

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop