Crambe insularis sp. nov. (Crambeidae: Poecilosclerida) a New Crambeid from the Eastern Tropical North Pacific: Morphological, Molecular and Ontogenetic Approach

Abstract

Specimens of Poecilosclerida taxa, collected from an insular coral community on the Pacific coast of Mexico, were identified as members of the family Crambeidae Lévi, 1963. They were associated with larvae and rhagon phases by using morphological characters, the nucleotide relationship and genetic divergence of three independent loci, two mitochondrial (COI and 16S rDNA) and one ribosomal (28S rDNA C3–C5). Crambe insularis sp. nov. differs from the general skeletal architecture in the genus Crambe Vosmaer, 1880, by its reduced spiculation defined by the presence of ectosomal and choanosomal monactinal megascleres, and the absence of microscleres. Bayesian and Maximum–Likelihood analyses of three loci supported the clustering of larvae, rhagon and adult sponge, all closely related to Mediterranean Crambe crambe (type species of the genus Crambe), and with South American Crambe species (C. chilensis, C. maldonadoi and C. amarilla) as sister species. The larva of C. insularis sp. nov. corresponded to the typical parenchymella larvae poecilosclerid species but with the presence of subtylostyles and styles. Ontogenetic process about the larval and rhagon of this new crambeid are provided. The morphological characters and molecular affinities of Crambe insularis sp. nov. are similar to Monanchora genus, and the implications are further discussed. This is the first taxonomic and molecular study with an integrative approach that includes other diagnostic features such as larval and rhagon development for the description of new species in Porifera.

1. Introduction

The family Crambeidae Lévi, 1963 is characterized by the presence of a complex skeleton with a full complement of spicules: ectosomal and choanosomal monactinal megascleres also as complementary microscleres, and if present, the inclusion of a wide variety of acanthostyles, unguiferate–anchorate or monodentate chelae, sigmas, spined microrhabds, microxeas and astro- or sphaeroclone desmas [1,2]. Currently, four genera are considered valid: Discorhabdella Dendy, 1924, Litochela Burton, 1929, Crambe Vosmaer, 1880 and Monanchora Carter, 1883 [3]. Specifically, the genera Crambe and Monanchora share a similar external morphology, skeletal architecture, two categories of megascleres [4], and a wide repertoire of secondary metabolites, i.e., crambescidins [5,6]; but, only Crambe present hypersilicified microscleres (e.g., asterose desmas) [7,8,9] which is a diagnostic characteristic that allocate species in either of these two genera [1]. However, the taxonomical and diagnostic features may vary widely and the microscleres (desmas, isochelae, and microxeas) may or may not be present in response to silica concentration in the water column, such as previously observed for Crambe crambe and Crambe acuta, which shows an intraspecific skeletal variability [10,11,12,13].

Currently, the genus Crambe is integrated by eleven species distributed along the Indian [9,11,14], Atlantic [15,16,17,18] and Pacific Ocean [8,19]; but only nine are recognized as valid [8,9,11,19,20]. The Pacific region is widely regarded as the primary centre of diversity for Crambe [19], with the Temperate South America province being particularly significant. This is due to the recent identification of three Crambe species in this area that possess a full complement of spicules, including astro/sphaeroclones desmas and additional microscleres: C. chilensis Esteves, Lôbo-Hajdu & Hajdu, 2007, C. amarilla Esteves, Lôbo-Hajdu & Hajdu, 2007, and C. maldonadoi Esteves, Lôbo-Hajdu & Hajdu, 2007. Furthermore, the Tropical Eastern Pacific is home to an endemic species of Crambe, Crambe panamensis Maldonado, Carmona, van Soest & Pomponi, 2001 [8]. Despite the fact that these species have a limited distribution and that suitable locations such as oceanic islands and archipelagos along Eastern Tropical North Pacific have yet to be fully explored, no species of the Crambe have been recorded in the rocky and coral reefs of the Mexican Pacific despite extensive efforts to study sponge diversity in this area [21,22,23,24,25]. This study represents the first record of a new species of a Crambe Vosmaer, 1880 with no development of microscleres and distributed in a remote oceanic island from the Mexican Pacific coast. In addition to the taxonomical characterization of adult phase, the larva metamorphosis, and details of the rhagon morphology are also included. Additionally, the systematic position of this new species was assessed within the Poecilosclerida Order using molecular data of three independent loci (COI, 16S and 28S) in an integrative approach.

2. Materials and Methods

2.1. Sampling

Adults and larvae collection: specimens described herein were manually collected by SCUBA diving in a coral community of Isabel Island, Mexico; 21°52′30″ N, 105°54′54″ W (Figure 1), between, July–December 2010 and July–December 2011. These specimens were photographed in situ using an underwater camera (GoPro) before collection and later fixed in ethanol 96% at room temperature and transported to the laboratory for morphological and molecular characterization. Larvae in full planktonic conditions were collected with three horizontal hauls performed at noon using two 22 cm diameter plankton nets with an 80 µm mesh size. The nets were towed manually and driven nearby the coral community in a depth range of 1–7 m. The total water volume filtered during each haul was ~4.5 m³, and then transferred to sealed plastic containers (3 L), and filtered with a 100 μm mesh net, and kept in Petri dishes with filtered seawater for observation under a dissecting microscope (Stemi 508–Zeiss^®, Oberkochen, Germany) to check for the presence of sponge larvae. All collected larvae were individually documented, considering the external morphology, size and swimming movements. Some larvae maintained in observation, were settled within 12 h and post-settlement stages (rhagon) were monitored by 72 h and photo–documented using a Canon Elph PowerShot 180 camera (Canon Inc., Tokyo, Japan).

2.2. Morphological Description

Spicule and skeleton preparation for light and electron microscopy (SEM) of adults were prepared following the techniques described by Boury–Esnault and Rützler [26]. Additionally, spicules of adults and larvae were obtained by dissolving a small piece of each specimen and complete larvae in 1% nitric acid, after which the residue was three–times rinsed with distiller water, and once with 96% ethanol. The spicules were air–dried on microscopic slides and fixed with mounting medium (Entellan^TM). Twenty–five spicules of each specimen were randomly chosen and measured using a Canon EOS Rebel T8i camera mounted on a Zeiss Stemi 508 stereomicroscope. The minimum, maximum, and mean values for each spicule category were calculated. Holotypes and paratypes were deposited in the “Colección de Esponjas del Pacífico Mexicano” (LEB–ICML–UNAM).

2.3. Molecular Identification

Whole genomic DNA was extracted from adult tissue and larvae, and rhagon specimens that were ethanol-preserved, using PROMEGA Wizard® Genomic DNA Purification Kit. A partial sequence of the cytochrome c oxidase subunit 1 gene (COI, ~650 bp) was amplified using degenerate primers: LCOI490 5-′GGTCAACAAATCATAAAGAYATYGG-3′ and HCOI21908 5′-TAAACTTCAGGGTGACCAAARAAYCA-3′ [27]. The thermocycling protocol PCR conditions were as follows: one cycle at 94 °C for 5 min; 35 cycles at 94 °C for 1 min; 48 °C for 1 min, 72 °C for 1 min, and a final one cycle at 72 °C for 5 min, rendering a product of ~650 bp. One set of primers was synthetized to amplify the gen 28S rRNA region D3–D5 (~990 bp), using the primers NL3R 5′-TTTACCGGACATTCAACCCT-3′ NL4F 5′-GACCCGAAAGATGGTGAACTA′ [28]. Thermocycler conditions were as follows: one cycle at 94 °C × 5 min initial denaturation; 35 cycles at 94 °C × 1 min; 50 °C × 1 min, 72 °C × 1 min, and a final extension of one cycle at 72 °C × 5 min. Finally, a fragment of ~630 bp of the mitochondrial 16S rRNA gene was amplified with primers diplo-rnl-f1 TCGACTGTTTACCAAAAACATAGC and diplo-rnlr1 AATTCAACATCGAGGTSGGAAAC [29]. The thermocycler conditions were as follows: one cycle at 94 °C × 5 min initial denaturation; 35 cycles at 94 °C × 1 min; 50 °C × 1 min, 72 °C × 1 min, and a final extension of one cycle at 72 °C × 5 min. Each amplification reaction master mix contained 6.1 μL nuclease-free H₂O, 1.8 μL MgCl₂, 0.70 μL dNTPs, 2.5 μL 10× PCR buffer, 0.15 μL of primer forward and reverse, 0.10 μL Taq polymerase (Promega), and 1 μL of a 1:100 dilution of the DNA template. PCR products were visualized on 2%-TAE (Tris-acetate-EDTA) agarose gel electrophoresis, and all positive amplicons were purified using the Wizard SV Gel and PCR Clean–Up System (Promega). PCR clean products of 100 ng µL^–1 and 25 µL were sequenced in both directions (forward and reverse) by external service at Macrogen Inc., Seoul, Korea. Forward and reverse sequences were manually edited using the Geneious Prime 2022.2., to obtain consensus sequences for each sample. Sequences were submitted to GenBank^® from NCBI (National Center for Biotechnology Information), with the following accession numbers: OQ788445 (Larva), COI: OQ788444 (Rhagon), OQ788446 (Adult); 28S: OQ789402 (Larva), OQ789400 (Rhagon), OQ789401 (Adult) 16S: OQ789394 (Larva), OQ789395 (Rhagon), OQ789393 (Adult).

2.4. Sequence Alignment and Phylogenetic Analysis

Sequences from GenBank^® of species belonging to the Order Poecilosclerida were downloaded and aligned with the sequences of the new species using MEGA v. X [30]. GTR + G (COI), Kimura 2 parameter + G + I (28S) and Tamura 3 parameter + G + I (16S), were the best fitting evolutionary substitution model for each selected region of the three datasets according to the JModelTest 2.0 Software [31]. Maximum Likelihood (ML) analyses were executed using the MEGA v. X with 1000 bootstrap replicates [30]. Bayesian Inference was estimated using Mr. Bayes 3.2.1 [32], with two Markov Chain Monte Carlo (MCMC) simulations of over 400,000 generations carried out with sampling every 1000 generations. The appropriate burnin value was determined by examining the standard deviation of split frequencies dropped below 0.01. A 50% majority rule consensus tree was constructed from all generations sampled after the burnin and after discarding 25% of the original samples. Sequences of Polymastida, Suberitida, Axinellida and Trachycladida Orders were used as outgroups to root the tree. The trees from Mr. Bayes (BI) and those from MEGA (ML) are shown in posterior probability (PP) and bootstrap proportions (BP) in the node of each tree, respectively. Finally, genetic distances with Kimura’s two parameter model (K2P) among congeneric species of Crambe and mean intergeneric genetic distances among genera (Crambe vs Monanchora) were obtained using MEGA v. X [30].

3. Results

3.1. Taxonomic Descriptions

SYSTEMATICS

Class DEMOSPONGIAE

Subclass HETEROSCLEROMORPHA

Order Poecilosclerida

Family Crambeidae Lévi 1963

 

Genus Crambe Vosmaer 1880

Diagnosis

Thin, encrusting, or thicker tubercular sponges; surface translucent, slightly hispid, occasionally conulose, detachable, with clear veinal channel pattern in life. Sponges are characterized by a complex skeleton with a full complement of spicules: ectosomal styles–subtylostyles (occasionally strongyles), which may fan out into a tangential layer; choanosomal stylote with plumose organization, interlocking with desmas (often absent) forming a semi–rigid basal skeleton. Complementary microscleres are pseudastrose desmoid spicules (often absent) anchorate isochelae, spined microxeas [1].

 

Type species Crambe crambe (Schmidt, 1862).

Diagnosis

Thinly encrusting Crambe, red–orange. Surface microscopically hispid, with evident radiating and scattered whitish subdermal channels. Skeleton plumose, with ectosomal (subtylo) styles thick up to 200 µm long and choanosomal styles/tylotes fusiform up to 245 μm long. Microscleres are completely absent [1].

 

Crambe insularis sp. nov.

Type material

Holotype: LEB–ICML–UNAM (3187), 24/04/2007, Las Monas (Isla Isabel, Nayarit) 5 m (21°50′59″ N, 105°52′46″ W). Paratypes: LEB–ICML–UNAM (3188), Las Monas (Isla Isabel, Nayarit) 5 m (21°50′59″ N, 105°52′46″ W). Paratypes: LEB–ICML–UNAM (3189), Las Monas (Isla Isabel, Nayarit) 5 m (21°50′59″ N, 105°52′46″ W).

 

Description

External morphology: encrusting to cushion-shaped sponge 5–15 cm long and 8–23 mm thick on rocks (Figure 2A) and shell oysters (Figure 2B). Color in vivo bright red or orange; pale in preservation. Surface hispid, consistency fleshy, and easy to tear. Subdermal channels are red–translucent and converge radially towards the oscula 0.6–1.2 mm diameter that are slightly raised, an evident from the rest of the body, scattered over the ectosome. (Figure 2C). Ostia 60–90 µm in diameter, visible only under optical magnification, and distributed over the sponge surface (Figure 2D).

Skeleton: the ectosomal skeleton was epithelium–like with a 40–60 µm thick layer composed of brushes of subtylostyles and single spicules dispersed with no apparent organization (Figure 3A). The choanosomal skeleton has a plumose organization arranged as multispicular tracts interconnected by uni-, bi or paucispicular tracts (30 µm) (Figure 3B) resulting in irregular meshes (40–60 µm).

Spicules. Megascleres (Figure 3C): ectosomal (subtylo) styles were thick, slightly curved near the base (with or without telescopic apices), with a sharp point: 155–264 × 2.5–7.5 μm. Choanosomal styles or modified to tylotes fusiform, straight, or curved and sharp pointed: 178–325 × 5.0–10.5 μm (

Table 1. Morphometric measurements of spicules of Crambe insularis sp. nov. Values: minimum—(mean)—maximum in micrometers (µm) (length × width); n = 25.

Material Examined	Choanosomal Styles/Tylotes	Ectosomal Subtylostyles
Holotype LEB–ICML–(3187)	200–(241.4)–275 × 5.0–(6.8)–10	155–(190.1)–225 × 2.5–(2.9)–5
Paratype LEB–ICML–(3188)	178–(245.5)–325 × 5.0–(9.4)–10.5	175–(221.6)–264 × 3.5–(6.5)–6
Paratype LEB–ICML–(3189)	198–(231.5)–287 × 5.0–(6.9)–9.8	169–(210.6)–256 × 3.6–(5.7)–7.5

). Microscleres were completely absent.

Ecology

Crambe insularis sp. nov. is very common in coral communities from Isabel Island and its distribution apparently is restricted to this island territory. Specimens can be found in caves or shady places encrusting rocky zones and overgrowing oyster shell. Its bathymetric distribution range 4 m to 13 m deep.

Distribution. Recorded known only from type locality, Isabel Island, eastern tropical North Pacific.

Etymology

Named insularis refers to the island territory where the new specie was collected.

Remarks: Crambe insularis sp. nov. is characterized by the occurrence of only ectosomal subtylostyles, choanosomal styles/tylotes, but the complete absence of microscleres.

In the south–east Pacific, there are four species of Crambe bearing a full complement of spicules composed by megascleres: ectosomal and choanosomal (sub)(tylo) styles and a wide variety of microscleres; anchorate isochelae, sphaeroclones as asterose desmas and spined microxeas [8,19]. Morphologically, C. insularis sp. nov. differs from C. chilensis, C. maldonadoi and C. amarilla, in its smaller choanosomal styles, and lack of anchorate isochelae, asterose/sphaeroclones desmas and spined microxeas, which are absent in the new species here described (

Table 2. Morphometric characters of the valid species in the genus Crambe. Measurements of spicules size range (length × width or diameter in desma) are given in micrometers (µm).

Species	Locality	Ectosomal (Sub) (Tylo) Styles		Choanosomal (Acantho) (Tylo) Styles		Desmas	Anchorate Isochelea	Additional Microscleres	Skeletal Arrangement	References
Crambe insularis sp. nov.	Pacific coast of Mexico	211–411	5.5–6.8	275–483	12–16	Absent	Absent	Absent	Plumose	[*]
C. crambe Schmidt, 1862	Mediterranean Sea	316–281	7	423–539	11–17	Poorly developed Astroclone or Sphaeroclone	Unguiferate with reduced shortened three-toothed I: 28–43 II: 8–11	Absent	Plumose	[1,13]
C. erecta Pulitzer-Finali, 1993	Adriatic Sea	230–340	6–9	350–500	14–38	Astroclone 120–180	Anchorate I: 33 II:16–19	Absent	Plumose	[1,8,12,37]
C. paramensis Maldonado, Carmona, van Soest & Pomponi, 2001	Pacific coast of Panama	117–208	2.5–3.5	180–300	6.5–12	Astroclone 26–65	Spatulate Three/five-toothed 20–22	Absent	Hymedesmioid	[1,8]
C. acuata Lévi, 1958	Red Sea and Aldabra southern Madagascar	180–220	2–7	120–175	8–10	Astroclone 15–75	Three/five-toothed I: 20–22 II: 8–10	Spined microxeas 16–90, rare raphides	–	[11,15]
C. acuata Lévi, 1958	South Atlantic, East coasts of Africa	267.7	10.5	315	10.75	Astro/sphaeroclone 105	Anchorate 35	Spined microxeas, rare raphides	–	[15,16]
C. chilensis Esteves et al.,2007	South–east Pacific, coast of Chile	186–387	4–14	245–833	10–42	Astroclone (4–7 arms) 50–232	Spatuliferous– five–toothed 21–37	Spined microxeas. 30–67	Hymedesmioid	[19]
C. amarilla Esteves et al.,2007	South–east Pacific, coast of Chile	189–402	4–10	315–877	9–24	Astroclone (6 arms) 43–178	Unguiferate/Spatuliferous five–toothed 21–33	Rare or even absent spined microxeas 45–58, Raphides	Hymedesmioid	[19]
C. maldonadoi Esteves et al.,2007	South–east Pacific, coast of Chile	400–785	4–15	255–769	12–34	Sphaeroclone (5–6 arms) 94–211	Spatuliferous–three/five–toothed 22–31	Spined microxeas 22–43	Hymedesmioid	[19]
C. tailliezi Vacelet & Boury–Esnault, 1982	Western Mediterranean	Microspiny point 205–330	2.5–4	350–460	6–8	Astro/sphaeroclone 25–120	Unguiferate three toothed 23–26	Spined microxeas 7.8–15.6 Desmoi	–	[38]
C. tuberosa Maldonado & Benito, 1991	Mediterranean Alboran Island	87–104	4.6–5.8	Tuberose tyle I: 500–700 II: 150–300	I: 20–30 II: 5–10	Sphaeroclone (4–7 arms) 94–134	Five–toothed isoanchorae 27–30	Special asters	Hymedesmioid	[18]

Present paper [*]; Not reported (–).

). Crambe panamensis Maldonado, Carmona, van Soest & Pomponi, 2001 is the closest species to C. insularis sp. nov. in possessing similar size–categories spicules of the choanosomal tylostyles (275–483 μm × 12–16 μm). However, beside the wide variety of growth stages of astroclone desmas and anchorated isochelae, which are totally absent in Crambe insularis sp. nov., the Panamanian species has smaller ectosomal subtylostyles with a well–marked tyle and point with feeble spines [8]. The new species has morphological and skeletal features similar to some members of the genus Monanchora, but it lacks the sigmoid chelea and anchorate isochelae, which are the most important diagnostic characters in Monanchora species from the Eastern and Central Pacific [33,34,35,36].

3.2. Molecular Phylogenetic Analyses and Pairwise Genetics Distance Inferences

The genetic distance (K2P) calculated from ribosomal (28S) and mitochondrial (COI and 16S) genes within congeneric species of Crambe and among intergeneric species of Monanchora are resumed in

Table 3. Pairwise genetic distance (K2P) matrix among selected Crambe species using mitochondrial (COI and 16S) and nuclear (28S rRNA) genes. Values of genetic distances (K2P) are in bold (lower left diagonal) and standard error estimated(s) (upper right diagonal).

		28s
		1	2	3	4	5	6	7
1	Crambe insularis sp. nov.	–	0.004	0.005	0.004	0.004	0.005	0.005
2	Crambe amarilla	0.017	–	0.000	0.000	0.004	0.005	0.004
3	Crambe maldonadoi	0.017	0.000	–	0.000	0.005	0.005	0.004
4	Crambe chilensis	0.017	0.000	0.000	–	0.004	0.005	0.004
5	Crambe crambe	0.014	0.012	0.012	0.012	–	0.004	0.005
6	Monanchora arbuscula	0.022	0.025	0.025	0.025	0.017	–	0.004
7	Monanchora clathrata	0.024	0.020	0.020	0.020	0.018	0.006	–
		16S
		1	2	3	4	5	6	7
1	Crambe insularis sp. nov.	–	0.021	0.021	0.021	0.003	0.007	0.006
2	Crambe amarilla	0.156	–	0.000	0.002	0.022	0.023	0.022
3	Crambe maldonadoi	0.156	0.000	–	0.002	0.022	0.023	0.022
4	Crambe chilensis	0.159	0.002	0.002	–	0.022	0.023	0.023
5	Crambe crambe	0.006	0.160	0.160	0.163	–	0.007	0.005
6	Monanchora arbuscula	0.027	0.172	0.172	0.175	0.026	–	0.007
7	Monanchora coccinea	0.015	0.166	0.166	0.169	0.013	0.020	–
		COI
		1	2	3	4	5	6	7	8
1	Crambe insularis sp. nov.	–	0.003	0.005	0.008	0.007	0.007	0.006	0.007
2	Crambe crambe	0.005	–	0.004	0.008	0.007	0.006	0.005	0.007
3	Crambe sp.	0.016	0.011	–	0.008	0.006	0.006	0.005	0.006
4	Monanchora sp.	0.043	0.037	0.036	–	0.004	0.004	0.008	0.005
5	Monanchora uningulata	0.032	0.027	0.026	0.013	–	0.000	0.007	0.004
6	Monanchora clathrata	0.032	0.027	0.025	0.012	0.000	–	0.007	0.004
7	Monanchora arbuscula	0.025	0.020	0.018	0.047	0.036	0.036	–	0.007
8	Monanchora quuadrangulata	0.034	0.029	0.024	0.021	0.011	0.011	0.035	–

. The lowest interspecies genetic distances values computed of 28S sequences of Crambe were observed between Crambe insularis sp. nov. and Crambe crambe (0.014 ± 0.004) from the Western Mediterranean. On the other hand, C. insularis sp. nov. showed major distances (0.017 ± 0.004) from all South American Crambe species (C. chilensis, C. maldonadoi and C. amarilla), which were genetically identical among them (0.000 ± 0.000). The same pattern was recorded with interspecies genetic distances values computed of 16S sequences, C. insularis sp. nov. is genetically closer to Crambe crambe (0.006 ± 0.003), but the new species showed a greater genetic distance with respect to all South American Crambe species (C. chilensis, C. maldonadoi and C. amarilla) which were almost genetically identical among them (0.002 ± 0.002) with this molecular marker.

Interspecies KP2 genetic distances (Table 3) using COI sequences proved that C. insularis sp. nov. is genetically closer to Mediterranean Crambe crambe (0.005 ± 0.003) and distant to species of the genus Monanchora (0.025–0.043 ± 0.006–0.0.08). Comparing between two genera, the pairwise genetic distances average among species of Crambe and Monanchora were statistically different for the 28S gen (K2P_Crambe = 0.0158 ± 0.001, KP2_Monanchora = 0.0197 ± 0.002; t = 3.419, p = 0.005) and COI (K2P_Crambe = 0.006 ± 0.005, KP2_Monanchora = 0.0304 ± 0.004; t = 9.669, p < 0.001), but no statistical differences between Crambe and Monanchora using 16S gene was found (K2P_Crambe = 0.080 ± 0.085, K2P_Monanchora = 0.026 ± 0.001; t = 1.502 p = 0.021).

The systematics position of Crambe insularis sp. nov. within the Poecilosclerida Order was determined using three independent loci: one nuclear (28S rRNA D3–D5) and two mitochondrial (COI mDNA, 16S rRNA). All phylogenetic reconstructions with both BI and ML methods are congruent with moderate to high resolution for a family-level relationship, retrieved sequences of Crambe + Monanchora (Family Crambeidae) in a well-supported monophyletic clade (Figure 4, Figure 5 and Figure 6).

The molecular phylogeny of the 28S rRNA (D3–D5) was constructed using 48 sequences (909 selected sites; 759 sites were conservative, 150 variables and of which 120 were parsimony informative). In addition, the phylogenetic-based BI and ML analyses on this locus (Figure 4) place Crambe insularis sp. nov. in a well-supported monophyletic clade with species belonging to the genera Crambe and Monanchora (family Crambeidae). The monophyletic clade is subdivided in three well-supported subclades: the first contains all the sequences of South American Crambe species (C. chilensis, C. maldonadoi and C. amarilla) the Mediterranean C. crambe and Crambe insularis sp. nov.; the second with the sequences of Monanchora species (Monanchora clathrata, M. unguiculata and Monanchora sp.) and the third only sequences of M. arbuscula. The molecular analysis with the 28S data set retrieved Crambe as monophyletic and Monanchora as polyphyletic.

Phylogenetic reconstructions resulting from BI and ML analyses of COI mDNA were constructed with 58 sequences (647 selected sites; 372 sites were conservative, 257 variables and 255 were parsimony informative). The topology based on this gene (Figure 5), place Crambe insularis sp. nov. in a well-supported monophyletic clade with other members of Crambeidae: the first subclade contains three species of Monanchora: M. clathrata, Monanchora sp., M. unguiculata and two specimens of M. quadrangulata; the second with sequences of Crambe insularis sp. nov. that fell in a polytomy with two specimens of type species of Crambe crambe, a third subclade with sequences of M. arbuscula, and a fourth subclade a single specimen of Crambe sp. The phylogenetic analyses of CO1 data, retrieved Crambe + Monanchora as polyphyletic and Crambe insularis sp. nov. and Crambe crambe as sister species.

Finally, the molecular phylogeny using the 16S rRNA was constructed with 42 sequences (531 selected sites; 278 sites were conservative, 253 variables, and 230 were parsimony informative). Similarly, the phylogenetic hypothesis of BI and ML analyses of 16S retrieve to Crambe and Monanchora (Family Crambeidae) in a well-supported monophyletic clade that is subdivided in two principal subclades: the first contains sequences of Crambe insularis sp. nov. that fell in a polytomy with the Mediterranean type species Crambe crambe and a sister group with sequences of Monanchora species: M. coccinea and M. arbuscula. The second contains only sequences of South American Crambe species: C. chilensis, C. maldonadoi and C. amarilla. The molecular analysis with 16S rRNA data set retrieved Monanchora as monophyletic and Crambe as polyphyletic (Figure 6).

3.3. External Morphology of the Larva

Parenchymella larvae elongated or oval and slightly flattened in anterior to posterior direction; color burnt orange or red. The size ranges 240–763 μm length to 160–365 μm width. This larva shows a clear polarity, and the body is evenly covered with small cilia of equal length (~25 μm), except for the anterior pole, which is bulbous, bare, and densely granulate (Figure 7A). Active swimming of the larva could be detected in counter-clockwise spirals or corkscrew patterns, and it may sink, stay still, or move rapidly or slowly on the bottom of the dish (Supplementary material). During the observation, some morphological changes occur in the larva body, such as temporal protraction anterior or posterior pole retraction without apparent cause. In digested–acid larvae, several megascleres were found in the posterior pole of the larvae; styles/subtylostyles were thick, fusiform, straight, and sharply pointed: 28.73–145.19 × 3.56–6.28 µm, and tylostyles straight or slightly curved: 59.42–156.64 × 1.02–2.44 µm.

3.4. Rhagon Phase

Some larvae in overnight observation (16 h after collection) ceased their horizontal counter-clockwise spiral movement and remained vertical and stationary, rotating slowly around their axis anti-clockwise over the base Petri dishes. In subsequent hours (16–18 h), all larvae were finally attached via the anterior pole and settled into the bottom and the corner of the Petri dish. Initially (18 h after settlement), the settled larvae (pre-rhagon) were almost flattened, forming a homogeneous cell patch of burnt orange color of 0.5–0.8 µm in diameter (Figure 7B). One day after settlement, pre-rhagon was wholly flattened and, an evident cellular regionalization could be observed in tow zones: a thick inner conglomerate with a high cellular density that is surrounded by a thin translucent marginal zone with rounded edges and low cell density (Figure 7C). After two days, cell proliferation and evident development of the aquiferous system elements (formation of choanocytes chambers) were observed in their central part (Figure 7D). The complete metamorphosis was recorded three days after larval settlement, with the marked development of a central osculum and a functional aquiferous system (Figure 7E). The mature rhagon had a syconoid morphology, with radial organization and apical–basal polarity. It was 0.8–1 mm wide with a single large central finger–shaped osculum and 6–8 lobulated neighboring choanocytes chambers of 125–190 μm length (Figure 7F). Its surface is pink-translucent and probably formed by pinacocytes. A faint water circulation was observed inside the lobulated choanocytes chamber and across the central osculum.

4. Discussion

The description of a new species of Crambe Vosmaer, 1880 is highly relevant at different levels. First, the increase in the richness of Crambe species, with a total of five species distributed along the Pacific Ocean, and a total of ten with worldwide distribution; more important for the Eastern Tropical Pacific is the Northern record and the only one for the region of Mexican Pacific. Crambe insularis sp. nov. possess an external morphology and skeletal architecture similar to the rest Crambe spp., i.e., live–color, hispid surface with distinctly swollen veins in life and a plumose skeleton structure composed by ectosomal and choanosomal monactines that suggests its appropriate placement in Crambeidae Leví, 1963 [1,4,8,11,19].

Morphologically, Crambe insularis sp. nov. does not possess a full complement of spicules that characterize all Crambe species [1], and instead, it only bears two shapes of megascleres (styles/tylotes and subtylostyles) and no microscleres (i.e., desmas, isochelae and microxeas). Nevertheless, the external features and the plumose skeletal arrangement of C. insularis sp. nov. is similar to other members of the genera Crambe and Monanchora [1,9]. The new species of Crambe described herein show some similarities with the type species Crambe crambe Schmidt, 1862 such as thin subtylostyles dispersed with no special organization in the ectosome and choanosomal styles/anisostrongyles, with a plumose arrangement formed by multispicular tracts, with the exception that some specimens of C. crambe have interlocking microscleres that are scarce or even absent in some natural populations [1,12,13].

The new species share virtually the same external morphology and some skeletal elements with similar size-range with its congeneric Panamanian species Crambe panamensis. However, C. panamensis has tylostyles with a well–marked tyle in combination with very scarce anchorated isochelae in the choanosome, besides a well-developed basal substratum conformed by abundant interlocked astroclone desmas [8,12], which are absent in C. insularis sp. nov. Contrastingly, the Panamanian species has smaller ectosomal subtylostyles, as well as the absence of choanosomal styles, which are characteristics of the new species. The distribution pattern locates both species in the Tropical Eastern Pacific (TEP) region, however, C. panamensis distribution is limited to the Panama Bight Ecoregion, in the central TEP while C. insularis sp. nov. has been exclusively found in a single island locality Mexican Tropical Pacific, which is the North–limit of the TEP [39].

Additionally, the skeletal reduction observed in all current specimens studied, clearly distinguishes Crambe insularis sp. nov. from the rest of the East Pacific Crambe species (C. chilensis, C. amarilla, C. maldonadoi and C. panamensis), as also all Mediterranean species (C. crambe, C. tuberosa and C. tailliezi) which bearing (depending on the species) well-developed astro/sphaeroclones desmas, anchorate isochelae and the occasional occurrence of sigmoid elements and spined microxeas in a variable abundance [1,8,18,19,37,38].

From a morphological perspective, the taxonomy of poecilosclerid sponges is based on categories-type and size of microscleres [1,4]. However, the presence/absence of these spicular complements have been reported as a hyper–variable character in the whole family Crambeidae [1,11,12,15,17]. This phenotypic skeletal inhibition is a response to the local environmental conditions, where a silica depletion in the water column may promote skeletal inhibition, suppressing the production of hypersilicified desmas and affecting both the size and shape of other supplementary spicules [13]. The fact that the skeleton composition may change in response to local conditions, instead of a species-specific character, has been the main promoter of misidentification in the family Crambeidae [36]. In this regard, the lack of a full complement of spicules as characterized for C. insularis sp. nov., led to the fact that the traditional taxonomy based on the comparison of skeleton organization and spicular elements resulted in an incorrect and therefore unreliable diagnosis, evidencing the relevance of the use of integrative taxonomy.

The inclusion of C. insularis sp. nov. in Poecilosclerida was supported principally by pairwise genetic distances and molecular analysis of three independent loci: two mitochondrial (COI mDNA, 16S rRNA) and one nuclear (28S rRNA D3–D5). All phylogenetic analysis supports that Crambe insularis sp. nov. is closely related to the type species Crambe crambe and other sister species belonging to Crambe and Monachora. The genetic analysis supports our morphological identification and its inclusion within Crambeidae, despite not sharing the full complement of spicules characteristics of the genus Crambe [1,7,12]. Additionally, the molecular data allowed us to establish the proximity of Crambe and Monachora as both genera are retrieved in robust clades with high bootstrap support and posterior probability as a sister group inside Crambeidae. This family was recovered as a basal and strong monophyletic clade with other families (i.e., Isodictydiae, Mycalidae, Hymedesmiiae, Iotrochotidae Tedaniidae), which belongs to the Order Poecilosclerida. Previously, the monophyly of Crambeidae was recovered using independent nuclear (28S and 18S), mitochondrial (COI and 16S), and housekeeping genes [36,40,41,42]. Nevertheless, there are no records of sequences of nuclear and mitochondrial genes of Litochela and Discorhabdella species, which are essential groups to solve internal relationships among Crambe and Monanchora in Crambeidae.

Regarding the relationship between members of Crambe, the topologies indicated no consensus between mitochondrial (16S and COI) and nuclear (28S) phylogenies. The BI and ML analysis with the nuclear gen (28S) recovered to C. insularis sp. nov. + Mediterranean and South American Crambe species in a well-supported monophyletic clade whereas, the mitochondrial genes (16S and COI) recovered to Crambe species as paraphyletic (Figure 5 and Figure 6). The inconsistency between topologies as result of a phylogenetic reconstruction has been previously reported [36] and may be a consequence of the use of different matrices with diverse taxonomic composition (OUTs) which could be showing an incomplete family view or different sister group relationships between Crambeidae.

However, these differences should not be taken lightly, since interestingly, the phylogenetic reconstruction with three deferens loci (16S, COI and 28S) (Figure 4, Figure 5 and Figure 6), showed that C. insularis sp. nov. is closely related to Mediterranean species Crambe crambe, which seems to be more reasonable, as not only both species are genetically closer (Table 3) but share morphological characteristics rather than to congeneric species from the South American Pacific coast. Contrastingly, previous molecular phylogenies using 28S [43], COI [42] and 16S [36] genes have been retrieved to Crambe crambe in a clade with others Atlantic species of Monachora (M. arbuscula, M. coccinea), but still there is no a clear pattern of the monophyly of crambeid genera neither the internal relationships between Crambe and Monanchora until molecular data of Litochela and Discorhabdella species become available.

Finally, the present analyses clarified the relative position of a new species of Crambe that lacks microscleres, within the family Crambeidae (Poecilosclerida) using independent molecular data sets. Crambe insularis sp. nov. represents the fifth species of genus recognized in the Pacific Ocean and the first endemic Crambe in the Mexican Pacific coast. This may indicate that the diversity of crambeids is, to date, underestimated. The distribution limits of Crambe spp. have already been recorded to the South and Central Pacific Ocean [8,19], and with the present report, their distribution expanded southwards to the South-eastern tropical Pacific. More importantly, it emphasizes the ability of the Crambe genus to modify its skeletal structures genetically as a response to local environmental conditions [13], considering the different scenarios of climate change, this is an adaptive advantage, and it could be expected that other species of the same genus could modify their type of skeleton. Indeed, this is the first taxonomic and molecular study with an integrative approach that includes other diagnostic features for the description of new species in the phylum Porifera, e.g., larval and rhagon, with this being an approximation that must be considered for all organisms that have a phenotypic plasticity such as those found in Crambe.

Parenchymella Larva

The general morphology of the larva of Crambe insularis sp. nov. corresponded to the typical parenchymella larva with anterior-posterior polarity similar to other closely related poecilosclerid species described previously [44], e.g., Crambe crambe [45] or Hamiguera hamigera [46]. Anatomically, external morphological differences among the larvae of C. insularis sp. nov. and their sister species C. crambe were observed, although both parenchymella larvae presented an evident anatomic polarity, all larvae of C. insularis sp. nov. described in this study have the posterior pole evenly ciliated, and the anterior pole is bare. These, however, do not occur in the four subtypes larvae described of the Poecilosclerida [44]. In Crambe crambe for example, large larvae dissected from brooding individuals had an anterior pole uniformly ciliated with a bare posterior zone; in contrast, the larvae in early developmental stages are completely flagellated [45]. Indeed, the larvae of C. insularis sp. nov. are smaller than those described by Uriz et al. [45], who reported larval size of 1200 µm in length and 600 µm wide, which are larger than those reported for other poecilosclerid members [46,47].

Additionally, two different spicule types (styles and tyles) were found in the posterior region of the larvae, 2–3 orders of magnitude smaller than those present in the skeleton of the adult stage. The larvae of C. insularis sp. nov. analysed in this study were collected in planktonic conditions in an advanced stage of maturation. Contrastingly, in immature larvae dissected from brooding individuals of C. crambe, spicules were not found; however, in the ultrastructure analysis, some sclerocytes with an axial filament were detected in the posterior pole of the larvae [45]. The last observation suggested that the lack of spicular elements in the early larval phase can be attributed to larval immaturity. The presence of spicules in the planktonic larvae of C. insularis sp. nov., suggests that the production and quantity of elements may be critical during the dispersal phase or in the terminal stages of larvae to facilitate the settlement process. Maldonado et al. [48] suggested that the contents and increased spicular elements in late-stage larvae may increase the larval density and favour its vertical sinking towards the bottom.