Next Article in Journal
Characterization and Comparison of Eye Development and Phototransduction Genes in Deep- and Shallow-Water Shrimp Alvinocaris longirostris and Palaemon carinicauda
Next Article in Special Issue
Diversity and Benefits of Arbuscular Mycorrhizae in Restored Riparian Plantations
Previous Article in Journal
Genetic Variation in Gaultheria nummularioides (Ericaceae: Gaultherieae) from the Sky Islands of the Himalaya-Hengduan Mountains
Previous Article in Special Issue
Ericaceous Plants: A Review for the Bioprospecting of Ericoid Mycorrhizae from Ecuador
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diversity
Volume 14
Issue 8
10.3390/d14080651
diversity-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Discovering the Diversity of Arbuscular Mycorrhizal Fungi Associated with Two Cultivation Practices of Theobroma cacao

by
Angela Pacheco Flores de Valgaz
1,
Jaime Naranjo-Morán
1,2,
Guillermo Reyes Román
1,3,*,
Javier Oviedo-Anchundia
1,
Maria Ratti Torres
1 and
Milton Barcos-Arias
1,4,*
1
Centro de Investigaciones Biotecnológicas del Ecuador (CIBE), Campus Gustavo Galindo, Escuela Superior Politécnica del Litoral (ESPOL), Km 30.5 Vía Perimetral, Guayaquil P.O. Box 09-01-5863, Ecuador
2
Laboratorio de Biotecnología Vegetal, Ingeniería en Biotecnología, Facultad Ciencias de la Vida, Campus María Auxiliadora, Universidad Politécnica Salesiana (UPS), Km 19.5 Vía a la Costa, Guayaquil P.O. Box 09-01-2074, Ecuador
3
Centro Nacional de Acuicultura e Investigaciones Marinas (CENAIM), Escuela Superior Politécnica del Litoral (ESPOL), Guayaquil P.O. Box 09-01-5863, Ecuador
4
Facultad de Ingenierías, Universidad Espíritu Santo (UEES), Samborondón P.O. Box 09-01-952, Ecuador
*
Authors to whom correspondence should be addressed.
Diversity 2022, 14(8), 651; https://doi.org/10.3390/d14080651
Submission received: 20 July 2022 / Revised: 5 August 2022 / Accepted: 9 August 2022 / Published: 12 August 2022
(This article belongs to the Special Issue State-of-the-Art Mycorrhizal Fungi in South America)
Browse Figures
Versions Notes

Abstract

:
In recent years, new data on the diversity of genera and species in the phylum Glomeromycota continue to be added and rearranged. Arbuscular mycorrhizal fungi are key to plant nutrition and agriculture. Studies report different short- and long-term cultivation practices that influence the abundance and diversity of Glomeromycota. To the best of our knowledge, there are no known studies of the fungal communities in the fine aroma cocoa cultivars. In this context, our work aims to discover the diversity of arbuscular mycorrhizae associated with two cocoa cultivation practices (conservative and semi-conservative) through the isolation of spores using microscopy and metabarcoding of the internal transcribed spacer region (ITS). Morphological analysis showed that the density of Glomeromycota spores exhibited significant differences between production systems. Although the metabarcoding analysis showed that diversity indices showed a higher increase in the roots than in the cocoa soil, independently of the cultivation practice. An abundance of 348 and 114 taxa were observed, corresponding to the conservative and semi-conservative practices, respectively. Seven genera were observed for the first time in cocoa crop agroforestry systems, including P. scintillans, R. diaphanus, R. fasciculatus, R. custos, D. disticha, M. perpusilla, and D. bernensis.

Graphical Abstract

1. Introduction

Ecuador is an agricultural country by tradition, with cocoa being one of the main exportation products. [1]. Ecuador is considered the world’s leading producer of fine and aromatic cocoa (Theobroma cacao L.), with a contribution of approximately 63%, followed by Indonesia with 10% [2]. According to the Ministry of Production, Foreign Trade, Investment, and Fisheries, the Ecuadorian cocoa sector exported USD 815.5 million in 2020, and reached USD 266.4 million between January and May 2021; the main destination countries for Ecuadorian cocoa in 2020 included the United States, Indonesia, Malaysia, and the Netherlands [3]. The average size of a cocoa crop is 3 ha, and each cocoa tree reaches a height of 4 to 8 m, except for fine aroma cocoa cultivars, which can reach up to 12 m in height. [4]. The main root of fine aroma cocoa extends up to 2 m deep, and the secondary roots develop in the upper humic layer (between the first 20 cm of depth) and extend horizontally up to 6 m around the main stem, where a wide diversity of mycorrhizal fungi cohabit [5].
Large amounts of nutrients are recycled within cocoa systems through leaf fall and pruning [6]. However, there have been losses due to the gradual depletion of soil nutrients and limits crop yields each intensive harvest. [7]. Due to the growing interest in the meeting of food demand, yield improvement, and stress resistance, governmental efforts have been made to look for alternatives [8].
Countries such as Spain, Mexico, Canada, the United States, and China, among others, have been using mycorrhizal microorganisms to develop biological products applied to commercial crops [9,10,11]. In this regard, the importance of arbuscular mycorrhizal fungi (AMF) has increased in the last decade, with numerous reports of beneficial effects on crops [12,13,14,15]. In recent years, new genera continue to be added to the phylum Glomeromycota, and others already classified have either been reclassified or kept their original classification following much discussion (Table A1). These fungi are associated with 90% of the plant families on earth and sustain terrestrial ecosystems through mutualistic symbiotic associations [16]. Once an interaction is established, AMF modifies the morphology of the root, intracellularly colonizing its cortex using hyphae that generate specialized structures that act as organs of nutrient exchange between the plant cell and host [17]. AMF hyphae can extend beyond depletion zones, increasing the area of mineral uptake and mineral content in the plant, exploring a larger volume of soil than could be achieved by root growth alone [18].
Some studies have reported that different short- and long-term farming systems or practices influence the abundance and diversity of AMFs. [19,20,21]. In recent decades, agricultural practices have been comprehensively evaluated, considering not only crop yield and soil nutrient availability, but also the composition and behavior of the microbiota, so as not to inhibit biological processes or develop dependence on synthetic fertilizers [22].
Agronomic practices in cocoa crops are generally carried out using pesticides and synthetic fertilizers to protect and increase production, respectively [22]. Despite increasing the supply of macronutrients in the soil, the nutritional demands of the crop are not sufficiently met. Therefore, much of the sustainable production of cocoa depends on the ecosystem services that the microbial community provides to the soil, such as soil aggregation, nutrient cycling, and even pathogen suppression [23]. For the usual reasons of plasticity and convergence between unrelated strains, morphological identification is tedious and requires much experience from the observer. Thus, it is not a robust indicator of the relationship between AMF types [24].
The advent of molecular techniques has revealed a much greater diversity of fungi than was known just a few years ago. Molecular identification methods are much needed for AMF studies because AMF morphology provides insufficient information to distinguish the full range of community diversity. [25]. High-throughput DNA sequencing technologies (HTS) have made information on plant-associated fungal communities available, making it possible to find microbial species among hundreds or thousands of species within a network for understanding phenomena at the scale of terrestrial ecosystems [8].
Despite its potential in basic and applied microbiology, few studies have examined AMF networks associated with cocoa crops at the metacommunity scale. Therefore, the present work explored the diversity of AMFs associated with two cocoa cultivation practices, conservative and semi-conservative, through the morphological analysis of spores using microscopy and metabarcoding of the internal transcribed spacer region (ITS). The results suggest taxa with the potential to be used in practices to improve cocoa crop production.

2. Materials and Methods

2.1. Location and Description of Cocoa Crops

Soil and root samples were collected between October and December 2020 in three cantons in Ecuador (Milagro, Vinces, and Calceta) (Figure 1 and Table A2). From each canton, five cocoa trees cultivated using conservative practices and five cultivated using semi-conservative practices were selected. Semi-conservative practice involves the low use of synthetic fertilizers and herbicides (NPK and glufosinate-ammonium, frequency of no more than 4 times per year), supplemented by organic fertilizers and cultural practices. The sample was collected at a depth of 20 cm, in the upper humic layer of each tree. The zones were characterized into agricultural areas of cocoa, orange, and green cultivation, among other plants associated with this agroecosystem. The samples were stored in cold rooms (−20 °C), and then subdivided into two portions: one portion for the isolation of spores and identification of AMF through microscopy, and another portion for DNA extraction and sequencing of the ITS region. The edaphic properties (macro- and microelements, pH, and organic matter parameters) were measured in each of the cocoa crops (Table A3), using the following techniques: potentiometric volumetry, colorimetry, atomic absorption, turbidimetry, and the Walkley-Black method.

2.2. Isolation of Spores and Identification of AMF

For the isolation of the spores, wet sieving and decanting methodologies were used [26], followed by density gradient extraction [27]. The final supernatant was dissolved in water to wash the spores, and the criteria used to determine the density of AMF spores was as follows: low density corresponded to <1 spore/g soil; medium density corresponded to 1–10 spores/g soil, and high density corresponded to >10 spores/g soil [28]. Samples for morphological analysis were placed in Petri dishes and glass slides and observed under a light stereoscope (Zeiss, Jena, TH, Germany).
The identification of the predominant AMF genera was based on the morphological characteristics of the spores, i.e., their color, shape, texture, size, wall characteristics (i.e., number, thickness, color, presence of ornamentation, and Melzer reaction), layers covering the spore, the number of scars present, and the union of the suspensory hyphae to the spore [29]. These characteristics were examined using freely available morphological manuals [30,31,32]. Spore density from each culture system (conservative and semi-conservative practices) was compared using a nonparametric Mann-Whitney test. Homogeneity of variance and normality were evaluated using Bartlett and Shapiro-Wilk tests. The null hypothesis of both groups having an equality of spores was rejected with a p < 0.05. A total of 45 samples per cultivation practice (conservative and semi-conservative) were analyzed for spore count.

2.3. Staining of Colonized Roots

The colonization of AMF was observed using a binocular microscope (40×). the roots were processed according to a modified method by Phillips and Hayman [33], bleached with H2O2, cleaned with KOH (10% w/v, 15 min, 110 °C), and stained with trypan blue in lactic acid (0.02%, 10 min, 110 °C). Structures corresponding to colonization by arbuscular mycorrhizal fungi were examined in 1 cm long sections of roots taken at random.

2.4. Molecular Analysis: DNA Extraction and Sequencing

A total of 36 samples (18 samples from conservative practice and 18 from semi-conservative practice) from roots and soil (6 and 12 samples, respectively) were processed for genomic DNA (gDNA) extraction. Root samples were macerated in liquid nitrogen for homogenization of the fungal loads present. Subsequently, gDNA was extracted using the DNeasy mericon Food Kit (Qiagen, Carlsbad, CA, USA), following the manufacturer’s instructions. In addition, gDNA from soil and spore samples was extracted using the Dneasy Power Soil Pro-Kit (Qiagen, Carlsbad, CA, USA), following the manufacturer’s instructions. A 50 Ul aliquot of Gdna was dissolved in Dnase-free water. The quality and quantity of Gdna were examined on a UV-Vis NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), followed by observation on 1% agarose gel. Amplification of the ITS region was performed with two sets of primers (Table A4). The gDNA was sent to Biosequence (Quito, Ecuador) for the construction and multiplexing of the amplicon library. Paired-end sequencing was carried out with the Illumina MiSeq 300 bp platform (Illumina, San Diego, CA, EEUU). The sequences were stored at the National Center of Biotechnology Information (NCBI) Sequence Read Archive (SRA), under accession number PRJNA859242.

Sequence Analysis

Raw sequence data were demultiplexed with Casava 1.8 [34] and sequences with low quality (Phred quality score (Q) < 30) and short reads were filtered out. Amplicon sequence variants (ASV) were analyzed using Quantitative Insights into Microbial Ecology 2 (QIIME2), version 2021.4 [35]. The reads were imported for removal of redundant sequences, merging, and denoising, according to default DADA2 processing conditions. A table of ASVs was generated and the taxonomy was assigned using the public UNITE database, version 8.3. To obtain a comprehensive description of the fungal communities, alpha diversity metrics were performed (Shannon and ACE indices). The null hypothesis was evaluated through ANOVA and t-tests. Beta diversity was evaluated by measuring the Bray-Curtis dissimilarity index visualized in a principal coordinates analysis (PCoA) for a comparison of the fungal communities present in the two cultivation practices (conservative and semi-conservative), soil, and roots. The null hypothesis was evaluated using a PERMANOVA. The influence of edaphic factors on the distribution patterns of fungal communities in different cultivation practices was analyzed by means of a redundancy analysis (RDA). A Mantel test was performed to check whether there were significant correlations between soil edaphic factors and soil fungal community composition [36]. Linear discriminant effect size analysis (LEfSe) was performed to identify significantly different fungal groups in different cocoa growing practices, soil, and roots. The LDA for the different fungal taxa was adjusted to a p-value < 0.05 and a cutoff of LDA = 4 [37]. All statistical analyses were performed with microeco [38], a package implemented in R software, version 4.2.1. (RTeam, Vienna, WIE, Austria).

3. Results

3.1. Isolation of Spores and Identification of AMF

Spores belonging to AMF taxa were observed in cocoa crops under conservative and semi-conservative cultivation practices. After root staining, microstructures such as hyphae and vesicles were observed (Figure 2), with arbuscules appearing less frequently. Spore density had an average of 431 ± SEM = 131 (total of 19,402 spores), which was observed in the conservative cocoa root samples. On the other hand, an average of 321 ± SEM = 176 (total of 14,453 spores) was observed in the semi-conservative cocoa roots. Significant differences (p = 0.003) were observed between the spore densities present in the two cultivation practices (Figure A1).

3.2. Morphological Analysis of Spores

The morphological analysis of spores identified several genera according to shape, size, diameter range, color, number of visible walls, structure, and presence of hyphal connection. In conservative cocoa crops, the genera Glomus, Acaulospora, Ambispora, Pacispora, and Diversispora represented 88% of the total supply, followed by Scutellospora, Racocetra, Entrophospora, Gigaspora, Intraspora, Paraglomus, and Archaeospora making up the remaining 12%. In the semi-conservative cocoa crops, the genus Glomus represented 50% of total abundance, followed by Acaulospora, Ambispora, Pacispora, Intraspora, Archaeospora, Gigaspora, Paraglomus, Entrophospora, Diversispora, Scutellospora making up the remaining 50%. A total of 12 genera were found in cocoa crops under conservative practice and 11 in the crops under semi-conservative practice. Figure 3 and Figure 4 show descriptions of the genera observed.
Edaphic factors were correlated with mycorrhizal colonization (p < 0.05) in cocoa samples under both cultivation practices. The most important influence was observed with the factors Ca, MO, NH4, and P. Interestingly, Ca, MO, and NH4 showed a positive correlation with colonization, whereas P had a negative correlation. On the other hand, Ca, Cu, and Fe showed the greatest influence on spore density per gram of soil, with Ca content being positively correlated and Cu and Fe being negatively correlated (Figure A2).

3.3. Molecular Analysis

A total of 1019 ASVs were obtained. We identified 7 phyla, 22 classes, 47 orders, and 99 families in all cocoa soil and root samples. The alpha diversity index (Shannon) of soil and roots showed significant differences (p = 0.001) in fungal communities in the cocoa crop samples (Figure 5). However, no differences were observed between conservative and semi-conservative practices (Shannon, p = 0.76). The ACE diversity index showed no differences between cultivation systems (conservative and semi-conservative) and sampling sites (soil and roots) (Figure 5). Following beta diversity analysis, PERMANOVA results showed that the composition of fungal communities was different (p = 0.001) between soil and root samples (Figure 6). There were no significant differences when comparing fungal communities of the conservative versus semi-conservative practices (p = 0.31).
At the phylum level, Ascomycota dominated the cocoa soil and root samples from both cropping systems, representing 74% of relative abundance, followed by Basidiomycota (24%), and the remaining 2% composed of Glomeromycota, Mucoromycota, and Mortierellomycota.
Edaphic factors were not significantly correlated (p > 0.05), with fungal community composition independent of cultivation practice (Table A5). Interestingly, when the explanatory variables were used together with the fungal genera (Figure 7), the results showed that the abundance of Neocosmospora was explained by P, in contrast with the genus Lasiodiplodia. The genus Fusarium was explained by organic matter and NH4, in contrast with the genus Coprinopsis (Figure 7). Lefse showed that the different phylogenetic groups at all taxonomic levels (order, family, and genus) was not significantly distinguished between the cultivation practices (conservative and semi-conservative). However, several taxa were significantly enriched when root samples were compared with soil samples. For example, the genera Lasiodiplodia and Neocosmospora were predominant in cocoa roots, whereas Talaromyces and Antrodia predominated in soils (Figure 8). According to the analysis of guilds using the UNITE database, a total of 18 ASVs corresponding to AMF were found in the cocoa cultivation practices. All 18 ASVs are members of the phylum Glomeromycota. Table 1 shows a higher abundance of arbuscular mycorrhizae in the conservative (11 ASVs) compared with the semi-conservative practices (10 ASVs).
From the samples corresponding to the AMF, the phylum Glomeromycota, class Glomeromycetes, family Glomeraceae, and genera Archaeospora, Diversispora, Dominikia, Glomus, and Septoglomus were identified, with Glomus being the most prevalent, followed by Archaeospora. At the species level, 8 AMFs were identified, with Rhizophagus fasciculatus being the most abundant, followed by Rhizophagus custos and Pacispora scintillans. A strong bias of amplicons toward the genera Rhizophagus and Glomus was observed in the data set obtained (Table 1).

4. Discussion

4.1. Mycorrhizal Morphotypes in Cocoa Cropping Systems

Previous studies have reported that cultural practices in agroecosystems modify AMF community structure and diversity in crops [39]. The wide diversity of genera identified by morphology shows that fine and aroma cocoa is a mycotrophic-dependent crop and can therefore be grown in acidic soils with low fertility [40]. In the present study, classical morphological identification methods and molecular biology methods were used to discover the diversity of fungi present in fine and aroma cocoa cultivation. Although we did not perform a comparison between morphological and molecular approaches, a previous study reports that the detection of taxonomic entities is partially discordant [38]. Our findings demonstrate that AMF were present in both cocoa growing systems. The morphological characteristics of the spores found in the two cocoa-associated systems did not differ much in terms of the number of genera belonging to Glomeromycota. However, the spore density was significantly higher in the conservative cocoa crop.
The conservative practice had one exclusive genus (Racocetra) and another eleven genera shared with the semi-conservative practice. To the best of our knowledge, the genus Racocetra has not been reported on cocoa roots. Species of the genera Acaulospora, Ambispora, Claroideoglomus, Diversispora, Funneliformis, Gigaspora, Glomus, Pacispora, Rhizophagus, Paraglomus, Archaeospora, and Scutellospora, have been previously reported in agroforestry systems and the Andes of Ecuador [13,41]. These findings are consistent with a previous study suggesting that AMF community richness is not influenced by the abiotic environment, but is instead related to the host microbiome and biochemistry [42].

4.2. Arbuscular Mycorrhizal Bioindicators of Anthropogenic Intervention

Dominikia bernensis was first reported in Switzerland in 2014 [43], then in Brazil in 2018 [44], and the North Caucasus in 2021 [45]. A previous study showed that D. bernensis is considered an indicator species for reduced tillering, under the premise that agricultural practices might affect the species to the point of its extinction [46]. However, the present study reports the presence of D. bernensis in cocoa crops under a semi-conservative practice.
Dominikia disticha was reported in the South African maritime dunes in 2015 [47], in the Tunisian Saharan oasis associated with Phoenix dactylifera in 2020 [48], and in the North Caucasus in 2021 [45]. D. disticha has been isolated in ecosystems with high temperatures, high salinity, and low soil fertility. In our study, D. disticha was present in semi-conservative cocoa crop soils; therefore, we hypothesize that the adaptability in adverse environmental conditions of D. disticha could be used to produce biofertilizers. However, functional studies under controlled conditions and in the field are needed to verify its physiological adaptability [48].
Rhizophagus diaphanus has been previously reported in coastal ecosystems of Eastern China [49] and South America [50]. R. diaphanus has been proposed as a biofertilizer based on its mycorrhizal consortia in coffee production, its benefits [51], and its inoculation in seedlings for recovery of degraded soils [52]. The abundance of R. diaphanus in Murundus fields has been reduced by agricultural activity [52,53]. In our study, R. diaphanus was absent in the semi-conservative cocoa crops and slightly present in the conservative cocoa crops, so it could be considered one of the negative effects of agrochemical use. However, further studies are needed to determine the significant differences between these conditions.
Rhizophagus fasciculatus has been reported in South America [50] sharing environments with R. diaphanus, in prevalent abundance in the red sandy soils of India [54], in the vineyards of northwestern Iran [55], pastures associated with Cenchrus clandestinus in Colombia [56], on aerial roots of Araucaria angustifolia in the Atlantic rainforest of Brazil [57], and in the Lacandon rainforest of Chiapas, Mexico [58]. In addition, studies show that R. fasciculatus performs symbiosis and improves uptake [59], even under extreme conditions such as high salinity and water stress [60,61]. In our study, R. fasciculatus was absent in the semi-conservative cocoa systems, and its presence was observed in the soils and roots of the conservative cocoa crops. This fact could be explained by the fact that the use of agrochemicals affects the root colonization of R. fasciculatus [62].
Rhizophagus custos (Rhizoglomus) was reported in high evergreen forest ecosystems associated with the red cedar (Cedrela odorata) in Mexico [63]. Their presence was reported in transitional soils of an ecological preservation zone in Sinaloa, Mexico [64]. R. custos is attributed as a bioremediating agent for the dissipation and elimination of polycyclic aromatic hydrocarbons from the environment [65]. In our study, R. custos was present in both conservative and semiconservative cocoa crops.

4.3. Synergistic Contributions of AMF to Cocoa Crops

The study of the soil microbiome response to different agricultural practices has been documented. At the phylum level, Ascomycota and Basidiomycota have been reported as the dominant phyla and indicators of specific conditions when comparing agricultural treatments in vineyards versus orchards. However, our study found that Ascomycota and Basidiomycota in both cocoa cropping systems did not show variations in relative quantities [66,67].
At the genus level, Glomus aggregatum has been reported as a common colonizer in T. cacao roots [68,69], several crop species [70], and is persistent in cropping systems with agrochemical intervention [68]. A previous study showed that the combination of G. aggregatum and other AMF species increases the bioremediation effect against heavy metal saturation [71], promotes root growth, increases nutrient uptake, improves biomass production, and counteracts damage caused by plant-parasitic nematodes [72]. Pacispora scintillans, previously known as Glomus scintillans [73], has been reported in sugarcane crops of Iran [74], lowland wetland areas of Ethiopia, soils with crop rotation in Morocco [75,76], and organic management systems associated with Chilean Mediterranean vineyards [77]. In our study P. scintillans was present in cocoa crop samples under conservative practices.
The communities of AMF were more diverse and abundant in the conservative cocoa crops, with a total of 348 taxa compared with the 114 taxa corresponding in the semi-conservative crops. Seven taxa were new records for Ecuador and the agroforestry systems of fine and aroma cacao crops: P. scintillans, R. diaphanus, R. fasciculatus, R. custos, D. disticha, M. perpusilla, and D. bernensis. Overall, molecular analysis captured few genera of AMFs in the roots and soil of the cocoa of both cultivation practices. The low prevalence of these taxa coincides with previous studies, in which five genera were identified in cocoa agroforestry systems in central Cameroon; Glomus was the most abundant, whereas Scutellospora and Acaulospora were found in smaller quantities. Gigaspora and Archaospora were found in very small quantities, so were not reported [2]. The low prevalence could be due to the difficulty in capturing the entire AMF community using the primer sets, or the lack of classification in publicly available databases.
According to our molecular analysis, the diversity (alpha and beta) of soil and roots differed significantly, independent of the cultivation practice, and AMF diversity was higher in the conservative cocoa crop. This coincides with a study where the abundance of the AMF community under organic and conventional farming conditions did not show significant variation [78]. Neocosmospora is an important plant endophyte and has been widely reported as a pathogen. However, it is known that some species of Neocosmospora have been commonly found cohabiting with orchids and citrus, and are able to synthesize antimicrobial compounds [79,80,81,82]. In our study, Neocosmospora was considered a biomarker in the roots of Theobroma cacao. Lasiodiplodia has been reported as a pathogen capable of causing necrotic lesions when inoculated into mango fruits and young plants of Annona spp. and Spondias spp. It has also been reported that Lasiodiplodia is able to produce phytohormones such as indole and jasmonic acid analogues, both important regulators of plant growth and development [83,84]. Our results show that Lasiodiplodia was considered a biomarker of cocoa roots.
Following differential abundance analysis, our study suggests that fungal communities have greater differences between fine aroma cocoa roots and soil than between different cultivation practices. Therefore, semi-conservative practices and the impact of low levels of agrochemical use probably cause non-significant negative effects on the quantity of some taxa. However, a small number of AMF taxa were reported absent in the semi-conservative practice, which suggests that these genera were affected.
This study contributes information on the composition and behavior of fungal communities present in the rhizosphere of fine aroma cocoa grown in Ecuador and surrounding regions, to facilitate and complement efforts in identifying best practices. The present study also made efforts to find prospective microorganisms to develop sustainable agroecosystems and reduce the negative impact of agrochemicals on productive soils in Ecuador.

Author Contributions

Conceptualization, A.P.F.d.V. and J.N.-M.; Data curation, A.P.F.d.V., J.N.-M., G.R.R. and J.O.-A.; Formal analysis, A.P.F.d.V.; Funding acquisition, M.B.-A.; Investigation, A.P.F.d.V. and J.O.-A.; Methodology, A.P.F.d.V., J.N.-M. and J.O.-A.; Project administration, M.B.-A.; Resources, M.R.T. and M.B.-A.; Software, A.P.F.d.V. and G.R.R.; Supervision, J.N.-M. and M.B.-A.; Visualization, A.P.F.d.V. and G.R.R.; Writing—Original draft, A.P.F.d.V.; Writing—Review and editing, J.N.-M., G.R.R. and M.B.-A. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The sequences from this study are available in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under accession number PRJNA859242.

Acknowledgments

This research was conducted within the framework of a joint VLIR NETWORK Ecuador postgraduate program. Our sincere thanks are extended to Ricardo Pacheco, Omar Ruiz, Jeffrey Vargas, and Sergio Hernández for their support in the development of this project. The authors also thank the Corporación Ecuatoriana para el Desarrollo de la Investigación y la Academia, (CEDIA) for the funding granted through the CEPRA XIII-2019 project.

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Table
Table A1. Updated taxonomic classification of arbuscular mycorrhizal fungi.
Table A1. Updated taxonomic classification of arbuscular mycorrhizal fungi.
Phylum: Glomeromycota
ClassOrdenFamilyGenera
GlomeromycetesGlomeralesGlomeraceaeGlomus
Funneliformis
Dominikia
Funneliglomus
Kamienskia
Septoglomus
Microdominikia
Microkamienskia
Nanoglomus
Oehlia
Halonatospora
Orientoglomus
Septoglomus
Simiglomus
Sclerocarpum
Silvaspora
Epigeocarpum
Rhizophagus
Sclerocystis
GigasporalesScutellosporaceae *Bulbospora
Scutellospora
Orbispora
Gigasporaceae *Gigaspora
Dentiscutataceae *Dentiscutata
Fuscutata
Quatunica
Intraornatosporaceae *Intraornatospora
Paradentiscutata
Racocetraceae *Racocetra
Cetraspora
DiversisporalesAcaulosporaceaeAcaulospora
Kuklospora
Entrophosporaceae *Entrophospora
Viscospora
Albahypha
Claroideoglomus *
PacisporaceaePacispora
SacculosporaceaeSacculospora
DiversisporaceaeCorymbiglomus
Redeckera
Tricispora
Otospora
Sieverdingia
Desertispora
Diversispora
ParaglomeromycetesParaglomeralesParaglomeraceaeParaglomus
Innospora
PervetustaceaePervetustus
ArchaeosporomycetesArchaeosporalesGeosiphonaceaeGeosiphon
AmbisporaceaeAmbispora
PolonosporaceaePolonospora
ArchaeosporaceaeIntraspora
Palaeospora
Archaeospora
* The classification is still under discussion and ordering. Reference: [47,85,86,87,88].
Table
Table A2. Location and description of cocoa crops.
Table A2. Location and description of cocoa crops.
ProvinceCantonFarmSystemGeographic Coordinates
Los RíosVincesLa AmericanaConservative79°48′14.86″ West Latitude and 1°38′23.84″ Longitude South
EdénSemi-conservative79°49′8.02″ West latitude and 1°38′47.12″ longitude South
ManabíChoneSan José de Olla ViejaConservative0°47′52.46″ Longitude South 80° 5′36.79″ West Latitude
Berto ZambranoSemi-conservative0°47′52.04″ Longitude South 80° 8′3.70″ West Latitude
GuayasMilagroSan JoséConservative2° 7′57.36″ Longitude South 79°29′4.35″ West Latitude
VirginiaSemi-conservative2°06′34.7″ Longitude South 79°29′47.5″ West Latitude
Table
Table A3. Analysis of the physicochemical properties of the soil from cocoa crops under two cultivation practices.
Table A3. Analysis of the physicochemical properties of the soil from cocoa crops under two cultivation practices.
Texture (%) µg/mL
Cultivation
Practice		FarmSandSiltClayOrganic
Matter (%)		pHNH4PCaZnCuFe
ConservativeOlla Vieja2262163.16.5194649383.84.150
ConservativeSan José16562856.4302048473.78.495
ConservativeLa
Americana		2058224.47.9273746329.16.3109
Semi-conservativeVirginia5436103.76.622743143.38.8117
Semi-conservativeBerto
Zambrano		1854284.46.42710044565.56.342
Semi-conservativeEdén3842202.76.11610526497.414.5355
Table
Table A4. Primers used for DNA sequencing of T. cacao samples.
Table A4. Primers used for DNA sequencing of T. cacao samples.
RegionPrimerNucleotide Sequence (5′ to 3′)AmpliconReference
ITSITS86FGTGAATCATCGAATCTTTGAA369 pb[89]
ITS4TCCTCCGCTTATTGATATGC
ITS3GCATCGATGAAGAACGCAGC310 pb[90]
ITS4OFGTACTAGGGGAATCCTTGTT
ITS: Internal Transcribed Spacer.
Table
Table A5. A Mantel test of soil edaphic factors and soil fungal community composition.
Table A5. A Mantel test of soil edaphic factors and soil fungal community composition.
Edaphic FactorsCorrelation Coefficientpp Adjusted
Organic matter−0.03200314233645750.6340.722
pH0.1346933325440770.0960.384
NH4−0.02624672204682010.5860.722
P−0.02271950601867350.7220.722
Ca−0.02189248550363540.5530.722
Zn0.08978570886960290.080.384
Cu−0.02932861706338430.5680.722
Fe−0.05479964227555850.7110.722
Diversity 14 00651 g0a1 550
Figure A1. Spore density present in cocoa roots from the two cropping systems (semi-intervention and no-intervention). Different letters indicate significant differences at p < 0.05 after the nonparametric Mann-Whitney test.
Figure A1. Spore density present in cocoa roots from the two cropping systems (semi-intervention and no-intervention). Different letters indicate significant differences at p < 0.05 after the nonparametric Mann-Whitney test.
Diversity 14 00651 g0a1
Diversity 14 00651 g0a2 550
Figure A2. Scattering matrix, box and whiskers plot, concentration ellipsoid, and least squares line of physicochemical parameters versus colony and spore density.
Figure A2. Scattering matrix, box and whiskers plot, concentration ellipsoid, and least squares line of physicochemical parameters versus colony and spore density.
Diversity 14 00651 g0a2

References

  1. Lourdes, F.; Intriago, M.; Danilo, M.; Zenteno, C.; Ambrosio, J.; Neto, F.; Peña, M.M.; Roberto, W.; Caicedo, B.; Noemí, M.; et al. Cadena de comercialización del cacao nacional en la provincia de Los Ríos, Ecuador. Rev. Cienc. Tecnol. 2018, 11, 63–69. [Google Scholar]
  2. Saravia-Matus, S.L.; Rodríguez, A.G.; Saravia, J.A. Determinants of certified organic cocoa production: Evidence from the province of Guayas, Ecuador. Org. Agric. 2020, 10, 23–34. [Google Scholar] [CrossRef]
  3. Villacis, A.; Alwang, J.; Barrera, V. Cacao value chains and credence attributes: Lessons from Ecuador. J. Agribus. Dev. Emerg. Econ. 2022, 12, 549–566. [Google Scholar] [CrossRef]
  4. Apolo, B. Impact of Agricultural Exports on Agricultural Economic Growth in Ecuador: Case of Banana and Cocoa. J. Econ. Sustain. Dev. 2020, 11, 27–33. [Google Scholar] [CrossRef]
  5. Barro, O. Morfología y clasificación botánica del cacao. Man. Asist. Técn. 1981, 24, 25–42. [Google Scholar]
  6. van Vliet, J.A.; Giller, K.E. Mineral Nutrition of Cocoa: A Review, 1st ed.; Elsevier Inc.: Philadelphia, PA, USA, 2017; Volume 141. [Google Scholar]
  7. Wood, G.A.R.; Lass, R.A. Cocoa, 4th ed.; Longman: London, UK, 2001; pp. 172–174. [Google Scholar]
  8. Sessitsch, A.; Hardoim, P.; Döring, J.; Weilharter, A.; Krause, A.; Woyke, T.; Mitter, B.; Hauberg-Lotte, L.; Friedrich, F.; Rahalkar, M.; et al. Functional Characteristics of an Endophyte Community Colonizing Rice Roots as Revealed by Metagenomic Analysis. Mol. Plant-Microbe Interact. 2012, 25, 28–36. [Google Scholar] [CrossRef] [PubMed]
  9. Kumar, S.; Diksha; Sindhu, S.S.; Kumar, R. Biofertilizers: An ecofriendly technology for nutrient recycling and environmental sustainability. Curr. Res. Microb. Sci. 2022, 3, 100094. [Google Scholar] [CrossRef]
  10. Oviatt, P.; Rillig, M.C. Mycorrhizal technologies for an agriculture of the middle. Plants People Planet 2021, 3, 454–461. [Google Scholar] [CrossRef]
  11. Srivastava, S.; Johny, L.; Adholeya, A. Review of patents for agricultural use of arbuscular mycorrhizal fungi. Mycorrhiza 2021, 31, 127–136. [Google Scholar] [CrossRef]
  12. Báez-Pérez, A.; González-Chávez, M.C.Á.; Etchevers-Barra, J.D.; Prat, C.; Hidalgo-Moreno, C. Glomalina y secuestro de carbono en tepetates cultivados. Agrociencia 2010, 44, 517–529. [Google Scholar]
  13. Moina-Quimi, E.; Oviedo-Anchundia, R.; Nieto-Barciona, S.; Herrera-Samaniego, P.; Barcos-Arias, M. Evaluation of Arbuscular Mycorrhizal Fungi from humid tropical areas of Ecuador. Rev. Bionat. 2018, 3, 531–536. [Google Scholar] [CrossRef]
  14. Medina García, L.R. La agricultura, la salinidad y los hongos micorrízicos arbusculares꞉ Una necesidad, un problema y una alternativa. Cultiv. Trop. 2016, 37, 42–49. [Google Scholar] [CrossRef]
  15. Garzón, L.P. Importancia de las micorrizas arbusculares para un uso sostenible del suelo en la Amazonia colombiana. Luna Azul 2016, 42, 217–234. [Google Scholar] [CrossRef]
  16. Lucía Camargo-Ricalde, S.; Montaño, N.M.; De La Rosa-Mera, C.J.; Adriana, S.; Arias, M. Micorrizas: Una Gran Unión Debajo Del Suelo. Rev. Digit. Univ. 2012, 13, 19. [Google Scholar]
  17. Nakano, A.; Takahashi, K.; Kimura, M. Effect of host shoot clipping on carbon and nitrogen sources for arbuscular mycorrhizal fungi. Mycorrhiza 2001, 10, 287–293. [Google Scholar] [CrossRef]
  18. Aguilera Gómez, L. Micorrizas arbusculares. Cienc. Ergo-Sum 2007, 14, 300–306. [Google Scholar]
  19. Gosling, P.; Ozaki, A.; Jones, J.; Turner, M.; Rayns, F.; Bending, G.D. Agriculture, ecosystems and environment organic management of tilled agricultural soils results in a rapid increase in colonisation potential and spore populations of arbuscular mycorrhizal fungi. Agric. Ecosyst. Environ. 2010, 139, 273–279. [Google Scholar] [CrossRef]
  20. Oehl, F.; Laczko, E.; Bogenrieder, A.; Stahr, K.; Bösch, R.; Van Der Heijden, M.; Sieverding, E. Soil biology and biochemistry soil type and land use intensity determine the composition of arbuscular mycorrhizal fungal communities. Soil Biol. Biochem. 2010, 42, 724–738. [Google Scholar] [CrossRef]
  21. Symanczik, S.; Gisler, M.; Thonar, C.; Schlaeppi, K. Application of mycorrhiza and soil from a permaculture system improved phosphorus acquisition in naranjilla. Front. Plant Sci. 2017, 8, 1263. [Google Scholar] [CrossRef]
  22. López, M.; López de Rojas, I.; España, M.; Izquierdo, A.; Herrera, L. Efecto de la fertilización inorgánica sobre la disponibilidad de nutrimentos en el suelo, nivel nutricional de la planta y hongos micorrícicos arburculares en plantaciones de Theobroma cacao. Agron. Trop. 2007, 57, 31–43. [Google Scholar]
  23. Buyer, J.S.; Baligar, V.C.; He, Z.; Arévalo-Gardini, E. Soil microbial communities under cacao agroforestry and cover crop systems in Peru. Appl. Soil Ecol. 2017, 120, 273–280. [Google Scholar] [CrossRef]
  24. Cué, J.L.; Torres García, A. Valoración agroecológica de las micorrizas vesículo arbúsculares. Science 2010, 327, 167–170. [Google Scholar] [CrossRef]
  25. Watkinson, S.; Boddy, L.; Money, N. The Fungi; Academic Press: Cambridge, MA, USA, 2015. [Google Scholar]
  26. Gerdemann, J.W.; Nicolson, T.H. Spores of mycorrhizal Endogone species extracted from soil by wet sieving and decanting. Trans. Br. Mycol. Soc. 1963, 46, 235–244. [Google Scholar] [CrossRef]
  27. Furlan, V.; Bartschi, H.; Fortin, J.-A. Media for density gradient extraction of endomycorrhizal spores. Trans. Br. Mycol. Soc. 1980, 75, 336–338. [Google Scholar] [CrossRef]
  28. Guerra, B.; Chacon, M. Simbiosis micorrizica arbuscular y acumulación de aluminio en brachiaria decumbens y manihot esculenta. Biotecnol. Sect. Agropecu. Agroind. 2012, 10, 87–98. [Google Scholar]
  29. Peña-Venegas, C.P.; Cardona, G.I.; Arguelles, J.H.; Arcos, A.L. Micorrizas arbusculares del sur de la Amazonia colombiana y su relación con algunos factores fisicoquímicos y biológicos del suelo. Acta Amaz. 2007, 37, 327–336. [Google Scholar] [CrossRef]
  30. De Paepe, A.E.; Sierpowska, J.; Garcia-Gorro, C.; Martinez-Horta, S.; Perez-Perez, J.; Kulisevsky, J.; Rodriguez-Dechicha, N.; Vaquer, I.; Subira, S.; Calopa, M.; et al. Catálogo de cepas de micorrizas arbusculares. J. Chem. Inf. Model. 2019, 53, 1689–1699. [Google Scholar]
  31. Peña, C.; Cardona, G.; Mazorra, A.; Arguellez, J.; Arcos, A. Micorrizas arbusculares de la Amazonia colombiana Catálogo ilustrado; Instituto Amazónico de Investigaciones Científicas SINCHI: Leticia, Colombia, 2006; p. 90. [Google Scholar]
  32. Méndez Cortes, H.; Olalde Portugal, V.; Marmolejo Monsivais, J. Manual para la Identificación de Hongos Micorrízico Arbusculares; Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional: Ciudad de México, Mexico, 2011; p. 503. [Google Scholar]
  33. Phillips, J.M.; Hayman, D.S. Improved procedures for clearing roots and staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assessment of infection. Trans. Br. Mycol. Soc. 1970, 55, 158-IN18. [Google Scholar] [CrossRef]
  34. Garza, D.G. Tutorial básico en español de Qiime2. 2020; 1–21. [Google Scholar] [CrossRef]
  35. Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Author Correction: Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef]
  36. Mantel, N. The detection of disease clustering and a generalized regression approach. Cancer Res. 1967, 27, 12. [Google Scholar] [CrossRef]
  37. Segata, N.; Izard, J.; Waldron, L.; Gevers, D.; Miropolsky, L.; Garrett, W.S.; Huttenhower, C. Metagenomic biomarker discovery and explanation. Genome Biol. 2011, 12, 18. [Google Scholar] [CrossRef] [PubMed]
  38. Liu, C.; Cui, Y.; Li, X.; Yao, M. Microeco: An R package for data mining in microbial community ecology. FEMS Microbiol. Ecol. 2021, 97, fiaa255. [Google Scholar] [CrossRef] [PubMed]
  39. Thanni, B.; Merckx, R.; De Bauw, P.; Boeraeve, M.; Peeters, G.; Hauser, S.; Honnay, O. Spatial variability and environmental drivers of cassava—Arbuscular mycorrhiza fungi (AMF) associations across Southern Nigeria. Mycorrhiza 2022, 32, 1–13. [Google Scholar] [CrossRef]
  40. Tuesta-Pinedo, Á.L.; Trigozo-Bartra, E.; Cayotopa-Torres, J.J.; Arévalo-Gardini, E.; Arévalo-Hernández, C.O.; Zúñiga-Cernadez, L.B.; Leon-Ttacca, B. Optimización de la fertilización orgánica e inorgánica del cacao (Theobroma Cacao L.) con la inclusión de Trichoderma endófito y Micorrizas arbusculares. Rev. Tecnol. Marcha 2017, 30, 67. [Google Scholar] [CrossRef]
  41. Loján, P.; Senés-Guerrero, C.; Suárez, J.P.; Kromann, P.; Schüßler, A.; Declerck, S. Potato field-inoculation in Ecuador with Rhizophagus irregularis: No impact on growth performance and associated arbuscular mycorrhizal fungal communities. Symbiosis 2017, 73, 45–56. [Google Scholar] [CrossRef]
  42. Goldmann, K.; Boeddinghaus, R.S.; Klemmer, S.; Regan, K.M.; Heintz-Buschart, A.; Fischer, M.; Prati, D.; Piepho, H.P.; Berner, D.; Marhan, S.; et al. Unraveling spatiotemporal variability of arbuscular mycorrhizal fungi in a temperate grassland plot. Environ. Microbiol. 2020, 22, 873–888. [Google Scholar] [CrossRef]
  43. Oehl, F.; Silva, G.; Palenzuela, J. Dominikia bernensis, a new arbuscular mycorrhizal fungus from a Swiss no-till farming site, and D. aurea, D. compressa and D. indica, three new combinations in Dominikia. Nova Hedwig. 2014, 101, 65–76. [Google Scholar] [CrossRef]
  44. Vieira, L.C.; da Silva, D.K.A.; da Silva, I.R.; Gonçalves, C.M.; de Assis, D.M.A.; Oehl, F.; da Silva, G.A. Ecological aspects of arbuscular mycorrhizal fungal communities in different habitat types of a Brazilian mountainous area. Ecol. Res. 2019, 34, 182–192. [Google Scholar] [CrossRef]
  45. Yurkov, A.; Kryukov, A.; Mikhaylova, Y.; Zhurbenko, P. Illumina-based identification of arbuscular mycorrhizal fungi from Karachay-Cherkessia soils for development of bio-fertilizers. E3S Web Conf. 2021, 285, 03001. [Google Scholar] [CrossRef]
  46. Baltruschat, H.; Santos, V.M.; da Silva, D.K.A.; Schellenberg, I.; Deubel, A.; Sieverding, E.; Oehl, F. Unexpectedly high diversity of arbuscular mycorrhizal fungi in fertile Chernozem croplands in Central Europe. Catena 2019, 182, 104135. [Google Scholar] [CrossRef]
  47. Błaszkowski, J.; Chwat, G.; Góralska, A.; Ryszka, P.; Kovács, G.M. Two new genera, Dominikia and Kamienskia, and D. disticha sp. nov. in Glomeromycota. Nov. Hedwig. 2015, 100, 225–238. [Google Scholar] [CrossRef]
  48. Chebaane, A.; Symanczik, S.; Oehl, F.; Azri, R.; Gargouri, M.; Mäder, P.; Mliki, A.; Fki, L. Arbuscular mycorrhizal fungi associated with Phoenix dactylifera L. grown in Tunisian Sahara oases of different salinity levels. Symbiosis 2020, 81, 173–186. [Google Scholar] [CrossRef]
  49. Wang, J.; Ma, S.; Wang, G.G.; Xu, L.; Fu, Z.; Song, J.; Zhang, J. Arbuscular mycorrhizal fungi communities associated with wild plants in a coastal ecosystem. J. For. Res. 2021, 32, 683–695. [Google Scholar] [CrossRef]
  50. Cofré, M.N.; Soteras, F.; Iglesias, M.d.R.; Velázquez, S.; Abarca, C.; Risio, L.; Ontivero, E.; Cabello, M.N.; Domínguez, L.S.; Lugo, M.A. Biodiversity of arbuscular mycorrhizal fungi in South America: A review. In Mycorrhizal Fungi in South America, 1st ed.; Pagano, M., Lugo, M., Eds.; Springer: New York, NY, USA, 2019; Volume 1, pp. 154–196. [Google Scholar]
  51. Hernández-Acosta, E.; Trejo-Aguilar, D.; Rivera-Fernández, A.; Ferrera-Cerrato, R. Arbuscular mycorrhiza as a biofertilizer in production of coffee. Terra Latinoam. 2020, 38, 613–628. [Google Scholar] [CrossRef]
  52. Coutinho, E.S.; Barbosa, M.; Beiroz, W.; Mescolotti, D.L.C.; Bonfim, J.A.; Louro Berbara, R.L.; Fernandes, G.W. Soil constraints for arbuscular mycorrhizal fungi spore community in degraded sites of rupestrian grassland: Implications for restoration. Eur. J. Soil Biol. 2019, 90, 51–57. [Google Scholar] [CrossRef]
  53. Assis, P.C.R.; Saggin Júnior, O.J.; Paulino, H.B.; Stürmer, S.L.; Siqueira, J.O.; Carneiro, M.A.C. Fungos micorrízicos arbusculares em campos de murundus após a conversão para sistemas agrícolas no cerrado. Rev. Bras. Ciênc. Do Solo 2014, 38, 1703–1711. [Google Scholar] [CrossRef]
  54. Channabasava, A.; Lakshman, H.C.; Muthukumar, T. Fly ash mycorrhizoremediation through Paspalum scrobiculatum L., inoculated with Rhizophagus fasciculatus. Comptes Rendus—Biol. 2015, 338, 29–39. [Google Scholar] [CrossRef]
  55. Danesh, Y.R.; Kariman, K.; Keskin, N.; Najafi, S. Characterization of arbuscular mycorrhizal fungal communities associated withvineyards in northwestern Iran. Turk. J. Agric. For. 2022, 46, 271–279. [Google Scholar] [CrossRef]
  56. Ortiz-Acevedo, A.; Medina-Sierra, M.; Echeverri-Gómez, J. Identificación de algunas cepas de hongos micorrícicos asociados al kikuyo (Cenchrus clandestinus (Hochst ex Chiov) Morrone) y su efecto en algunas variables agronómicas. Livest. Res. Rural Dev. 2017, 29, 88. [Google Scholar]
  57. Moreira, M.; Zucchi, M.I.; Gomes, J.E.; Tsai, S.M.; Alves-Pereira, A.; Cardoso, E.J.B.N. Araucaria angustifolia Aboveground Roots Presented High Arbuscular Mycorrhizal Fungal Colonization and Diversity in the Brazilian Atlantic Forest. Pedosphere 2016, 26, 561–566. [Google Scholar] [CrossRef]
  58. Álvarez Sánchez, J.; Sánchez Gallen, I.; Hernández Cuevas, L.; Hernández Oro, L.; Meli, P. Diversidad, abundancia y variación estacional en la comunidad de hongos micorrizógenos arbusculares en la selva Lacandona, Chiapas, México. Sci. Fungorum 2017, 45, 37–51. [Google Scholar] [CrossRef]
  59. Mandal, S.; Evelin, H.; Giri, B.; Singh, V.P.; Kapoor, R. Arbuscular mycorrhiza enhances the production of stevioside and rebaudioside-A in Stevia rebaudiana via nutritional and non-nutritional mechanisms. Appl. Soil Ecol. 2013, 72, 187–194. [Google Scholar] [CrossRef]
  60. Diagne, N.; Ndour, M.; Djighaly, P.I.; Ngom, D.; Ngom, M.C.N.; Ndong, G.; Svistoonoff, S.; Cherif-Silini, H. Effect of Plant Growth Promoting Rhizobacteria (PGPR) and Arbuscular Mycorrhizal Fungi (AMF) on Salt Stress Tolerance of Casuarina obesa (Miq.). Front. Sustain. Food Syst. 2020, 4, 1–8. [Google Scholar] [CrossRef]
  61. Essahibi, A.; Benhiba, L.; Babram, M.A.; Ghoulam, C.; Qaddoury, A. Influence of arbuscular mycorrhizal fungi on the functional mechanisms associated with drought tolerance in carob (Ceratonia siliqua L.). Trees—Struct. Funct. 2018, 32, 87–97. [Google Scholar] [CrossRef]
  62. Channabasava, A.; Lakshman, H.C.; Jorquera, M.A. Effect of fungicides on association of arbuscular mycorrhiza fungus Rhizophagus fasciculatus and growth of Proso millet (Panicum miliaceum L.). J. Soil Sci. Plant Nutr. 2015, 15, 35–45. [Google Scholar] [CrossRef]
  63. Chimal-Sánchez, E.; Montaño, N.M.; Camargo-Ricalde, S.L.; García-Sánchez, R.; Hernández-Cuevas, L.V. Nuevos registros de hongos micorrizógenos arbusculares para México. Rev. Mex. Biodivers. 2016, 87, 242–247. [Google Scholar] [CrossRef]
  64. Cervantes-Gámez, R.G.; Peñuelas-Rubio, O.; Araujo-Benard, N.; Fierro-Coronado, R.A.; Trejo-Aguilar, D.; Maldonado-Mendoza, I.E.; Cordero-Ramírez, J.D. Diversidad de hongos micorrízicos arbusculares asociados a plantas voluntarias de maíz en suelos de transición: Ecosistema natural—Uso agrícola. Sci. Fungorum 2021, 51, e1330. [Google Scholar] [CrossRef]
  65. Aranda, E.; Scervino, J.M.; Godoy, P.; Reina, R.; Ocampo, J.A.; Wittich, R.M.; García-Romera, I. Role of arbuscular mycorrhizal fungus Rhizophagus custos in the dissipation of PAHs under root-organ culture conditions. Environ. Pollut. 2013, 181, 182–189. [Google Scholar] [CrossRef] [PubMed]
  66. Haichar, F.e.Z.; Cernava, T.; Liu, J.; Timm, C.M. Editorial: Novel Insights Into the Response of the Plant Microbiome to Abiotic Factors. Front. Plant Sci. 2021, 12, 607874. [Google Scholar] [CrossRef] [PubMed]
  67. Köberl, M.; Wagner, P.; Müller, H.; Matzer, R.; Unterfrauner, H.; Cernava, T.; Berg, G. Unraveling the Complexity of Soil Microbiomes in a Large-Scale Study Subjected to Different Agricultural Management in Styria. Front. Microbiol. 2020, 11, 1052. [Google Scholar] [CrossRef]
  68. Franke-Snyder, M.; Douds, D.D.; Galvez, L.; Phillips, J.G.; Wagoner, P.; Drinkwater, L.; Morton, J.B. Diversity of communities of arbuscular mycorrhizal (AM) fungi present in conventional versus low-input agricultural sites in eastern Pennsylvania, USA. Appl. Soil Ecol. 2001, 16, 35–48. [Google Scholar] [CrossRef]
  69. Bogoriense, H.; Division, B.; Centre, C.S.; Raya, J. The Distribution of Glomeromycota in Cacao Rhizosphere in Indonesia. Reinwardtia 2008, 12, 347–356. [Google Scholar]
  70. Boyetchko, S.M.; Tewari, J.P. Occurrence of vesicular-arbuscular mycorrhizal fungi in Alberta, Canada. Z. Für Naturforsch.—Sect. C J. Biosci. 1993, 48, 923–929. [Google Scholar] [CrossRef]
  71. Carreón-Abud, Y.; Beltrán-Nambo, M.A.; Martinez Trujillo, M. Efecto protector de los hongos micorrízicos arbusculares en plantas de jitomate (Solanum lycopersicum) expuestas a Cr (VI). Rev. Int. Bot. Exp. 2013, 82, 127–134. [Google Scholar]
  72. Gañan, L.; Benavides, M.M.B.; Asakawa, N. Efecto de la micorrización sobre el crecimiento de plántulas de plátano en sustrato con y sin la presencia de nematodos fitoparásitos. Acta Agron. 2011, 60, 297–305. [Google Scholar]
  73. Oehl, F.; Sieverding, E. Pacispora, a new vesicular arbuscular mycorrhizal fungal genus in the glomeromycetes. J. Appl. Bot. 2004, 78, 72–82. [Google Scholar]
  74. Rokni, N.; Goltapeh, M.E. Alizadeh Some new recorded species of arbuscular mycorrhizal fungi associated with sugarcane crop in Iran. J. Agric. Technol. 2010, 6, 67–78. [Google Scholar]
  75. Belay, Z.; Vestberg, M.; Assefa, F. Diversity and abundance of arbuscular mycorrhizal fungi across different land use types in a humid low land área of Ethiopia. Afr. J. Microbiol. Res. 2015, 18, 47–69. [Google Scholar]
  76. Khadija, B.; Yolande, D.; Khadija, B.; Najib, S.; Mostafa, K. Impact of crop rotation on mycorrhizal fungi in irrigated soils of the Doukkala (Morocco). Int. J. Environ. Agric. Res. 2015, 1, 48–55. [Google Scholar]
  77. Silva, P.; Aguilar, A.; Dibán, M.; Mujica, M. Mycorrhizas in the South American Mediterranean-type ecosystem: Chilean matorral. In Mycorrhizal Fungi in South America, 1st ed.; Pagano, M., Lugo, M., Eds.; Springer: New York, NY, USA, 2019; Volume 1, pp. 193–202. [Google Scholar]
  78. Kozjek, K.; Kundel, D.; Kushwaha, S.K.; Olsson, P.A.; Ahrén, D.; Fliessbach, A.; Birkhofer, K.; Hedlund, K. Long-term agricultural management impacts arbuscular mycorrhizal fungi more than short-term experimental drought. Appl. Soil Ecol. 2021, 168, 104140. [Google Scholar] [CrossRef]
  79. Guarnaccia, V.; Van Niekerk, J.; Crous, P.W.; Sandoval-Denis, M. Neocosmospora spp. associated with dry root rot of citrus in South Africa. Phytopathol. Mediterr. 2021, 60, 79–100. [Google Scholar] [CrossRef]
  80. Sandoval-Denis, M.; Lombard, L.; Crous, P.W. Back to the Roots: A Reappraisal of Neocosmospora; Naturalis Biodiversity Center: Leiden, The Netherlands, 2019; Volume 43, ISBN 2006743457. [Google Scholar]
  81. Zheng, F.; Xu, G.; Zheng, F.Q.; Ding, X.F.; Xie, C.P. Neocosmospora rubicola causing stem rot of Pitaya (Hylocereus costaricensis) in China. Plant Dis. 2018, 102, 2653. [Google Scholar] [CrossRef]
  82. Khuseib Hamed Al-Rashdi, F.; Al-Sadi, A.M.; Al-Riyamy, B.Z.; Maharachchikumbura, S.S.N.; Khalfan Al-Ruqaishi, H.; Velazhahan, R. Alternaria alternata and Neocosmospora sp. from the medicinal plant Euphorbia larica exhibit antagonistic activity against Fusarium sp., a plant pathogenic fungus. All Life 2020, 13, 223–232. [Google Scholar] [CrossRef]
  83. Salvatore, M.M.; Alves, A.; Andolfi, A. Secondary metabolites of lasiodiplodia theobromae: Distribution, chemical diversity, bioactivity, and implications of their occurrence. Toxins 2020, 12, 457. [Google Scholar] [CrossRef]
  84. Coutinho, I.B.L.; Freire, F.C.O.; Lima, C.S.; Lima, J.S.; Gonçalves, F.J.T.; Machado, A.R.; Silva, A.M.S.; Cardoso, J.E. Diversity of genus Lasiodiplodia associated with perennial tropical fruit plants in northeastern Brazil. Plant Pathol. 2017, 66, 90–104. [Google Scholar] [CrossRef]
  85. Błaszkowski, J.; Niezgoda, P.; Meller, E.; Milczarski, P.; Zubek, S.; Malicka, M.; Uszok, S.; Casieri, L.; Goto, B.T.; Magurno, F. New taxa in Glomeromycota: Polonosporaceae fam. nov., Polonospora gen. nov., and P. polonica comb. nov. Mycol. Prog. 2021, 20, 941–951. [Google Scholar] [CrossRef]
  86. Anand, K.; Pandey, G.K.; Kaur, T.; Pericak, O.; Olson, C.; Mohan, R.; Yadav, A.; Devi, R.; Kour, D.; Rai, A.K.; et al. Arbuscular mycorrhizal fungi as a potential biofertilizers for agricultural sustainability. J. Appl. Biol. Biotechnol. 2022, 10, 90–107. [Google Scholar] [CrossRef]
  87. Sieverding, E.; Da Silva, G.A.; Berndt, R.; Oehl, F. Rhizoglomus, a new genus of the Glomeraceae. Mycotaxon 2014, 129, 373–386. [Google Scholar] [CrossRef]
  88. Błaszkowski, J.; Jobim, K.; Niezgoda, P.; Meller, E.; Malinowski, R.; Milczarski, P.; Zubek, S.; Magurno, F.; Casieri, L.; Bierza, W.; et al. New Glomeromycotan Taxa, Dominikia glomerocarpica sp. nov. and Epigeocarpum crypticum gen. nov. et sp. nov. From Brazil, and Silvaspora gen. nov. From New Caledonia. Front. Microbiol. 2021, 12, 1–21. [Google Scholar] [CrossRef] [PubMed]
  89. Qin, J.; Zhang, W.; Zhang, S.B.; Wang, J.H. Similar mycorrhizal fungal communities associated with epiphytic and lithophytic orchids of Coelogyne corymbosa. Plant Divers. 2020, 42, 362–369. [Google Scholar] [CrossRef]
  90. Esposito, F.; Jacquemyn, H.; Waud, M.; Tyteca, D. Mycorrhizal fungal diversity and community composition in two closely related Platanthera (orchidaceae) species. PLoS ONE 2016, 11, e0164108. [Google Scholar] [CrossRef]
Diversity 14 00651 g001 550
Figure 1. Geographical location of cocoa crops distributed in three provinces and cantons. The provinces (Los Ríos, Manabí, and Guayas) are represented in yellow, pink, and light blue, respectively, whereas the cantons are shown in lighter tones.
Figure 1. Geographical location of cocoa crops distributed in three provinces and cantons. The provinces (Los Ríos, Manabí, and Guayas) are represented in yellow, pink, and light blue, respectively, whereas the cantons are shown in lighter tones.
Diversity 14 00651 g001
Diversity 14 00651 g002 550
Figure 2. Characteristic cellular structures of arbuscular mycorrhizal fungi stained with trypan blue solution. (a) Roots colonized by hyphae (black arrow) and (b) roots colonized by arbuscules (black arrow) and (c) vesicles (black arrow). Similar structures were observed in samples from both cultivation practices.
Figure 2. Characteristic cellular structures of arbuscular mycorrhizal fungi stained with trypan blue solution. (a) Roots colonized by hyphae (black arrow) and (b) roots colonized by arbuscules (black arrow) and (c) vesicles (black arrow). Similar structures were observed in samples from both cultivation practices.
Diversity 14 00651 g002
Diversity 14 00651 g003 550
Figure 3. Genera of arbuscular mycorrhizal fungi in cocoa crops under conservative cultivation practices, identified according to spore morphological analysis: (a–c) Glomus, (d,e) Scutellospora, (f–i) Acaulospora, (j–l) Pacispora, (m–o) Ambispora, (p) Racocetra, (q,r) Diversispora, (s) Entrophospora, (t) Gigaspora, (u) Intraspora, (v) Paraglomus, and (w) Archaeospora.
Figure 3. Genera of arbuscular mycorrhizal fungi in cocoa crops under conservative cultivation practices, identified according to spore morphological analysis: (a–c) Glomus, (d,e) Scutellospora, (f–i) Acaulospora, (j–l) Pacispora, (m–o) Ambispora, (p) Racocetra, (q,r) Diversispora, (s) Entrophospora, (t) Gigaspora, (u) Intraspora, (v) Paraglomus, and (w) Archaeospora.
Diversity 14 00651 g003
Diversity 14 00651 g004 550
Figure 4. Genera of arbuscular mycorrhizal fungi in cocoa crops under semi-conservative cultivation practice identified after a morphological analysis of spores: (a,b) Acaulospora, (c–e) Ambispora, (f) Intraspora, (g,h) Archaeospora, (i) Gigaspora, (j–l) Glomus, (m–o) Pacispora, (p,q) Paraglomus, (r–t) Entrophospora, (u,v) Diversispora, and (w) Scutellospora.
Figure 4. Genera of arbuscular mycorrhizal fungi in cocoa crops under semi-conservative cultivation practice identified after a morphological analysis of spores: (a,b) Acaulospora, (c–e) Ambispora, (f) Intraspora, (g,h) Archaeospora, (i) Gigaspora, (j–l) Glomus, (m–o) Pacispora, (p,q) Paraglomus, (r–t) Entrophospora, (u,v) Diversispora, and (w) Scutellospora.
Diversity 14 00651 g004
Diversity 14 00651 g005 550
Figure 5. Alpha diversity of fungal communities present in conservative and semi-conservative cocoa crops. (a) Shannon index (b) ACE index. *** represents significant values with p < 0.05, ns = not significant. The circles represent fine and aroma cocoa roots while the triangles represent soil samples.
Figure 5. Alpha diversity of fungal communities present in conservative and semi-conservative cocoa crops. (a) Shannon index (b) ACE index. *** represents significant values with p < 0.05, ns = not significant. The circles represent fine and aroma cocoa roots while the triangles represent soil samples.
Diversity 14 00651 g005
Diversity 14 00651 g006 550
Figure 6. Principal coordinate analysis of the Bray-Curtis dissimilarity index comparing samples from (a) soil and roots with (b) cocoa cultivation practices (conservative and semi-conservative).
Figure 6. Principal coordinate analysis of the Bray-Curtis dissimilarity index comparing samples from (a) soil and roots with (b) cocoa cultivation practices (conservative and semi-conservative).
Diversity 14 00651 g006
Diversity 14 00651 g007 550
Figure 7. RDA diagram showing the relationship between edaphic properties and fungal community composition in Theobroma cacao under different cultivation practices (conservative and semi-conservative).
Figure 7. RDA diagram showing the relationship between edaphic properties and fungal community composition in Theobroma cacao under different cultivation practices (conservative and semi-conservative).
Diversity 14 00651 g007
Diversity 14 00651 g008 550
Figure 8. Lefse analysis of cocoa soil and roots. LDA shows different fungal taxa differentially significant at p < 0.05 (LDA cutoff = 4).
Figure 8. Lefse analysis of cocoa soil and roots. LDA shows different fungal taxa differentially significant at p < 0.05 (LDA cutoff = 4).
Diversity 14 00651 g008
Table
Table 1. Abundance of ASV belonging to arbuscular mycorrhizal fungi detected in conservative and semi-conservative cocoa samples. The taxa were classified by the UNITE database.
Table 1. Abundance of ASV belonging to arbuscular mycorrhizal fungi detected in conservative and semi-conservative cocoa samples. The taxa were classified by the UNITE database.
SystemClassification
Semi-ConservativeConservativeTaxonomy
03PhylumGlomeromycota
1115ClassGlomeromycetes
01OrderDiversisporales
20OrderGlomerales
29125FamilyGlomeraceae
150GenusArchaeospora spp.
20GenusDiversispora spp.
30GenusDominikia spp.
410GenusGlomus sp.
03GenusSeptoglomus spp.
10SpeciesDominikia bernensis
80SpeciesDominikia disticha
22SpeciesGlomus aggregatum
08SpeciesKamienskia perpusilla
010SpeciesPacispora scintillans
076SpeciesRhizophagus custos
02SpeciesRhizophagus diaphanus
0103SpeciesRhizophagus fasciculatus
114348Total
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Pacheco Flores de Valgaz, A.; Naranjo-Morán, J.; Reyes Román, G.; Oviedo-Anchundia, J.; Ratti Torres, M.; Barcos-Arias, M. Discovering the Diversity of Arbuscular Mycorrhizal Fungi Associated with Two Cultivation Practices of Theobroma cacao. Diversity 2022, 14, 651. https://doi.org/10.3390/d14080651

AMA Style

Pacheco Flores de Valgaz A, Naranjo-Morán J, Reyes Román G, Oviedo-Anchundia J, Ratti Torres M, Barcos-Arias M. Discovering the Diversity of Arbuscular Mycorrhizal Fungi Associated with Two Cultivation Practices of Theobroma cacao. Diversity. 2022; 14(8):651. https://doi.org/10.3390/d14080651

Chicago/Turabian Style

Pacheco Flores de Valgaz, Angela, Jaime Naranjo-Morán, Guillermo Reyes Román, Javier Oviedo-Anchundia, Maria Ratti Torres, and Milton Barcos-Arias. 2022. "Discovering the Diversity of Arbuscular Mycorrhizal Fungi Associated with Two Cultivation Practices of Theobroma cacao" Diversity 14, no. 8: 651. https://doi.org/10.3390/d14080651

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop