Next Article in Journal
A Proposal for the Lectotype Designation of Ishige foliacea (Phaeophyceae, Ishigeaceae) Using DNA Barcoding
Next Article in Special Issue
Phylogenomic, Biogeographic, and Evolutionary Research Trends in Arachnology
Previous Article in Journal
Reproductive Ecology of Distylous Shoreside Polygonum criopolitanum Hance
Previous Article in Special Issue
In Silico Assessment of Probe-Capturing Strategies and Effectiveness in the Spider Sub-Lineage Araneoidea (Order: Araneae)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Island–to–Island Vicariance, Founder–Events and within–Area Speciation: The Biogeographic History of the Antillattus Clade (Salticidae: Euophryini)

by
Franklyn Cala-Riquelme
1,2,*,
Patrick Wiencek
3,
Eduardo Florez-Daza
2,
Greta J. Binford
4 and
Ingi Agnarsson
3,5,*
1
Institute for Biodiversity Science & Sustainability, California Academy of Sciences, 55 Music Concourse Drive, San Francisco, CA 94118, USA
2
Grupo de Estudios de Arácnidos y Miriápodos, Instituto de Ciencias Naturales, Universidad Nacional de Colombia, Bogotá 111321, Colombia
3
Department of Biology, College of Arts and Sciences, University of Vermont, 109 Carrigan Drive, Burlington, VT 05401, USA
4
Department of Biology, 615 S Palatine Hill Rd. Lewis and Clark College, Portland, OR 97219, USA
5
Faculty of Life and Environmental Sciences, University of Iceland, Sturlugata 7, 102 Reykjavik, Iceland
*
Authors to whom correspondence should be addressed.
Diversity 2022, 14(3), 224; https://doi.org/10.3390/d14030224
Submission received: 20 November 2021 / Revised: 9 March 2022 / Accepted: 14 March 2022 / Published: 18 March 2022

Abstract

The Caribbean Archipelago is a biodiversity hotspot that plays a key role in developing our understanding of how dispersal ability affects species formation. In island systems, species with intermediate dispersal abilities tend to exhibit greater diversity, as may be the case for many of the salticid lineages of the insular Caribbean. Here, we use molecular phylogenetic analyses to infer patterns of relationships and biogeographic history of the Caribbean endemic Antillattus clade (Antillattus, Truncattus, and Petemethis). We test if the timing of origin of the Antillatus clade in the Greater Antilles is congruent with GAARlandia and infer patterns of diversification within the Antillattus clade among Cuba, Hispaniola, and Puerto Rico. Specifically, we evaluate the relative roles of dispersal over land connections, and overwater dispersal events in diversification within the Greater Antilles. Time tree analysis and model-based inference of ancestral ranges estimated the ancestor of the Antillattus clade to be c. 25 Mya, and the best model suggests dispersal via GAARlandia from northern South America to Hispaniola. Hispaniola seems to be the nucleus from which ancestral populations dispersed into Cuba and Puerto Rico via land connections prior to the opening of the Mona Passage and the Windward Passage. Divergences between taxa of the Antillattus clade from Cuban, Hispaniolan, and Puerto Rican populations appear to have originated by vicariance, founder-events and within-island speciation, while multiple dispersal events (founder-events) between Cuba and Hispaniola during the Middle Miocene and the Late Miocene best explain diversity patterns in the genera Antillattus and Truncattus.

1. Introduction

Since Darwin and Wallace, evolutionary biologists have been fascinated by the extraordinary diversity and richness of islands. Biogeography has been reinvigorated through the use of molecular methods to test divergence hypotheses [1,2,3,4] and matured through the successful reconciliation of theories that previously were treated as mutually exclusive: long-distance dispersal and vicariance. This progress has been aided by the growth of sophistication in testing long distance dispersal hypotheses—best supported when vicariance explanations are rejected by geological history (e.g., Matos–Maraví et al. [5])—and the development of models such as the intermediate dispersal hypothesis [6,7,8,9,10,11,12,13].
The Greater Antilles (Cuba, Hispaniola, Puerto Rico, and Jamaica) are one of the planet’s recognized biodiversity hotspots [2,14]. The area is an excellent arena to test biogeographical hypotheses due to its complex geology (including, e.g., land bridge or Wallacean fragment islands, volcanic or Darwinian islands, and uplifted coral shelves), geography (including complex topography and diverse climates), and old age [2,11,15,16,17,18,19,20,21,22,23,24,25,26,27]. The uplift of the core Greater Antilles, arising from the earlier ‘proto–Antilles ridge, began during the Middle Eocene (c. 48–37 Mya) and reached its maximum land area at the Eocene–Oligocene (c. 40–30 Mya) boundary [17,28,29,30,31,32,33,34,35]. Since that time, the Greater Antilles have remained above water with variation in island area and inter-island connections changing with sea level. For example, Hispaniola was physically connected to Puerto Rico and Cuba until the formation of the Mona Passage (late Oligocene to early Miocene, c. 30–23 Ma) and the Windward Passage (early-to-middle Miocene, c. 17–15 Ma), respectively [17,35,36,37,38].
The origin of the present-day terrestrial biota of the Greater Antilles has been hypothesized to extend back to the emergence of the proto-Antilles (c. 65 Mya), predicting the survival of relict lineages through periods of oceanic submergence of island fragments [28,32,39,40,41]. However, for most organisms, their origin more likely traces back to the permanent emergence of the Greater Antilles (c. 40 Mya) and could have involved both long-distance over-water dispersal events [42,43,44] (as occurred in Solenodons [45], Urocoptid snails [46], Calliphorid flies [47], and various spiders [26,48,49,50,51,52]) and vicariance. The oldest putative vicariance events are linked to the hypothesized existence of GAARlandia (GAAR = Greater Antilles Aves Ridge) a land bridge relatively briefly (c. 35 to 32 Mya) connecting the Greater Antilles and continental South America during the Eocene–Oligocene transition [32,33,44,53,54]. Though it remains under active debate [27], this hypothesis has received support in studies across a variety of taxa (e.g., freshwater fishes [55], lizards [16], bats [56], mammals [42,45], plants [57], and spiders [4,58]). However, a recent meta-analysis suggested that GAARlandia does not help explain the colonization of various land vertebrate lineages [27]. Regardless, both historical connections among islands leading to vicariant interchange of organisms, and long-distance dispersal are recognized as critically important components that must be considered together for a complete account of island biogeography [1,7,8,9,43,48,49,52,59].
In the last decades there has been a growing interest in studies on invertebrates [5,24,52,60,61,62,63,64,65,66,67] including arachnids [4,18,22,23,26,48,49,50,58,68]. These studies have found mixed support for vicariance [22,69,70] and dispersal [4,16,18,45,48,50,51]; often a combination of the two [5].
The geographic distribution of spiders in the euophryine Antillattus clade of the family Salticidae make them an interesting model for testing hypotheses of Caribbean dispersal corridors [68]. Salticids are a diverse, globally distributed group of spiders (c. 6392 total species) [71] known as “jumping spiders’’ due to their semi-hydraulic locomotion system [72,73,74]. Within Salticidae, euophryines are a relatively young group (c. 33–30 Mya) [69]. Phylogenetic reconstruction shows that much like other salticid lineages [75,76,77], New and Old-World euophryines are grouped into separate clades, indicating that most euophryine diversification occurred intra-continentally [68]. In their landmark revisionary work on euophryines, Zhang and Maddison [68] highlighted the Antillattus clade as one of several salticid lineages that has diversified within the Caribbean. Members of the Antillattus clade (Antillattus Bryant [78], Truncattus Zhang and Maddison [79], and Petemathis Prószyński and Deeleman–Reinhold [68,80,81]) are small to medium-sized spiders of the Greater Antilles (Cuba, Hispaniola, and Puerto Rico) (Figure 1, Figure 2 and Figure 3). During the morning, these spiders can be found in understory habitats and dense forests, and typically walk or jump between leaves, branches, and trunks. In the sunset and at night, they are found in their shelters, e.g., leaves, and under the bark).
The Antillattus clade is relatively late-diverging with an estimated origin in the Caribbean by dispersal in the Miocene [c. 22.34–19.74 Mya], a scenario that implies ancestors dispersed over the Greater Antilles via land connections prior to the opening of the Mona Passage and the Windward Passage [68]. Members of the Antillattus clade appear to have relatively low dispersal potential based on their biology and absence from Jamaica and the isolated volcanic islands of the Lesser Antilles—none of which formed a part of the hypothetical GAARlandia land bridge (Cuba, Hispaniola, Puerto Rico). We predict that the Mona Passage and Windward Passage may have been integral to the dispersal of the Antillattus clade among the Greater Antilles. Here, we evaluate the non-GAARlandia (overwater dispersal) and GAARlandia hypotheses to infer the timing and ancestral colonization route of Caribbean euophryines; analyze the relationship of the Antillatus clade to other Greater Antilles euophryines (Popcornella, Corticattus, and the Agobardus clade); and infer the details of diversification within the Antillatus clade. We use time-calibrated phylogenies to see if divergence times of taxa on Cuba, Hispaniola, and Puerto Rico correspond to estimated dates of the land connections (Mona Passage and Windward Passage), or if they are better explained by overwater dispersal. Finally, we apply biogeographical stochastic mapping (BSM) to estimate how the frequency of dispersal and vicariance events of the clade resulted in the present-day distribution and diversity.

2. Materials and Methods

Study Group and Taxon Sample

Antillattus clade intergeneric relationships and their outgroup structure are poorly known (see Zhang and Maddison [81]), while the broader phylogenetic placement of the Antillattus clade is better established (see Zhang and Maddison [68,81]). The Antillattus clade was instated as a clade separate from the insular Caribbean Anasaitis-Corythalia clade and closely related to the genera Popcornella, Corticattus and the Agobardus clade based on molecular and morphological studies (Zhang and Maddison [68]). These studies also resulted in the transfer of insular Caribbean species of Pensacola and Cobanus, and some species of Agobardus from Cuba, to the genus Antillattus (Zhang and Maddison [68]). Here, for phylogenetic inference, we included as outgroups the continental Pensacola-Mexigonus clade, and Sidusa clade, the Greater Antilles genera Popcornella, Corticattus, and the Agobardus clade (Agobardus, Compsodecta and Bythocrotus).
The Antillattus clade is currently composed of twenty-three species distributed as follows: ten species of Antillattus from Hispaniola and three species from Cuba, five species of Truncattus from Hispaniola, and five species of Petemathis from Puerto Rico. Here, we include a total of thirty-two taxa collected using beating and visual search methods in Cuba, Puerto Rico, and Hispaniola (Figure 1 and Figure 4, Table 1). Material collected was fixed in the field in 95% ethanol. Caribbean voucher specimens will be deposited in the Smithsonian Institute, Washington DC. We collect and identify just over 60% of the known species for the Antilattus clade (nine Antillattus, three Petemathis, and three Truncattus), while the remaining sampled taxa could not be attributed to known species (Figure 2 and Figure 3, Table 1).

3. DNA Extraction, Amplification and Sequencing

DNA was isolated with a Qiagen DNeasy Tissue Kit (Qiagen, Valencia, CA, USA). We sequenced fragments of CO1, 16S-ND1, and 28S. We amplified CO1 using the LCO1490 (GGTCAACAAATCATAAAGATATTGG) [82] and C1–N–2776 (GGATAATCAGAATATCGTCGAGG) [83] primers. The fragment of 16S-ND1 ribosomal RNA was amplified with the primers 16SA/12261 (CGCCTGTTTACCAAAAACAT) [82] and 16SB (CCGGTTTGAACTCAGATC) [83]. The 28S ribosomal RNA fragment was amplified with the 28SO (TCGGAAGGAACCAGCTACTA) and 28SC (GAAACTGCTCAAAGGTAAACGG) primers. For CO1, 16S-ND1, and 28S, the polymerase chain reactions (PCR) were performed with an initial denaturation at 94 °C for 2 min, followed by 40 cycles of denaturation at 94 °C for 25 s, annealing at 50 °C (first round)/44.5 °C (second round) for 25 s and extension at 65 °C for 2 min (first round)/1 min (second round); with a final extension at 72 °C for 10 min. We sequenced amplified fragments in both directions using Sanger sequencing at GENEWIZ’s New Jersey facility. The forward and reverse reads were interpreted with Phred and Phrap [84,85] via Chromaseq v. 1.31 [86] in Mesquite v. 3.6 [87] using default parameters.

3.1. Phylogenetic Inference

We aligned sequences in MAFFT [88] using L–INS–I with a parameter 1PAM/k = 200, and a Gap opening penalty of 1.53. Gaps were treated as missing characters. The data resulting from the alignments were manually reviewed in Mesquite 3.6 (Maddison and Maddison [87]) with reference to the translation of amino acids using the “Color Nucleotide by Amino Acid” option. The dataset was partitioned by gene (and in the case of CO1 by codon), and the appropriate substitution model for each partition was selected with jModeltest 2.1.10 [89] using the Akaike information criterion [90] to select among the 24 models that can be implemented in MrBayes (Supplementary Table S1).
Maximum likelihood analyses were conducted in IQ–TREE v.2.0 [91]. ModelFinder [92], as implemented in IQ–TREE v.2.0 [91], was used to select the optimal partition scheme and substitution models for the molecular characters (iqtree–s dataMatrix.nex––runs 1000–m TESTMERGEONLY–spp setsBlock.nex–pre iqtreeAnalysis–nt AUTO). Finally, we used the CIPRES online portal [93,94] to run a Bayesian analysis with MrBayes v. 3.2.6 [95,96]. We ran the Markov chain Monte Carlo (MCMC) with four chains for 25,000,000 generations, sampling every 1000 generations, with a sampling frequency of 100 and a burn–in of 25%. The results were examined in Tracer v.1.7 [97] to verify proper mixing of chains, that stationarity had been reached, and to determine adequate burn-in. All resulting trees were interpreted in FIGTREE v.1.4.2 and edited in Adobe Illustrator CS6.

3.2. Time Calibration and Divergence Estimation

For the divergence time estimation analysis, the monophyly of darlingtoni group was constrained based on the results of the Bayesian and ML analyses. Node ages were estimated using a Bayesian, multi-gene approach in BEAST 1.10.4 [98] using a two-tier approach: (1) including outgroups, (2) excluding outgroups. Here, for the divergence estimation, we included as outgroups the South American representatives of Pensacola-Mexigonus clade (Mexigonus cf. minuta, M. arizonensis), and Sidusa clade and the Greater Antilles Agobardus clade (Agobardus, Compsodecta and Bythocrotus).
The dating analyses were run under a lognormal relaxed clock model [99] with a CO1 substitution rate parameter (ucld.mean) as a normal prior (mean = 0.0112 and s.d. = 0.001) [100] and an estimated substitution rate parameter for 28S and 16S-ND1. The lognormal relaxed clock model was selected between alternative clock models (non–clock, strict clock, relaxed clock) using a stepping-stone method [101] of Bayes Factors in MrBayes 3.2.7a [96,102]. The analysis ran for 20,000,000 generations with a birth–death process [103] under a GTR + G+I model, with default options for all other prior and operator settings. The birth–death model was used for the tree prior because it can simulate speciation and extinction rates over time; thus, at any point in time, every lineage can undergo speciation at rate λ or go extinct at rate μ [104].
We used a combination of calibrations with fossils and calibrations based on the results of Zhang and Maddison [68]. Our fossil calibration point is based on the Dominican amber genus Pensacolatus (type species Pensacolatus coxalis Wunderlich, 1988 [105]) (see Penney, [106]). Wunderlich [105] described Pensacolatus based on a Dominican amber fossil (20–15 Mya) and discusses similarity with the species described by Bryant [79] as Pensacola (Peckham and Peckham [107]). We confidently place Pensacolatus coxalis within the Antillatus darlingtoni group after thorough review of the original description of P. coxalis and comparison of morphological details with those compiled for taxa in this lineage in Zhang and Maddison [81]. Key characteristics in this assessment include one retromarginal tooth, post-epigastrium without a visible pre-spiracular bump, endite with an anterolateral cusp, palp with a proximal tegular lobe, and ventral tibial apophysis. Therefore, we use this fossil to calibrate the MRCA (Most Recent Common Ancestor) of the darlingtoni group (logNormal Prior [tmrca, mu = 0.01, sigma = 1.0, offset = 16]) (see [68,105]). Our second calibration is MRCA of Antillattus clade secondarily based on dating inferences within this linage from Zhang [108] [tmrca, normalPrior mean = 27.24 stdev = 5.0]. The convergence of parameters was examined in Tracer 1.7 [97] to determine burn–in and to check for stationarity. The maximum clade credibility tree was produced in TreeAnnotator v1.10.4, with 25% burn-in.

4. Biogeographical Estimation

For ancestral range estimation of the Antillattus clade, we used the tree of the divergence dating analysis resulting from the first tier approach (analysis with outgroups). We coded the Caribbean islands in their past shape, considering their historical composition of multiple paleo-islands [32]. The distribution ranges were divided into the following areas: A—Puerto Rico, B—Hispaniola, C—Cuba, D—Jamaica, E—North America, F—South America (Figure 1). We carried out the ancestral range estimation in the R package BioGeoBEARS v. 1.1.1 [109,110] to test different time periods and infer which are more likely with base of the model’s configuration. This package tests three models in a maximum likelihood framework with various parameters that can be altered to test specific scenarios: a DEC model [110,111], a DIVALIKE model (likelihood version of the DIVA model [111,112]) and a BAYAREALIKE model (likelihood version of the BayArea model [113]). Moreover, each model is available in its original version and with an additional parameter +j (i.e., peripatric speciation) representing jump dispersal, or a founder event, which is speciation following long-distance dispersal [111].
To estimate the ancestral range distribution for Antillattus clade and outgroups, we conducted time-stratified analyses testing (1) non–GAARlandia (overwater dispersal), and (2) GAARlandia as the Antillattus clade ancestor colonization route using a set of 36 models that varied in the parameters [e—the rate of range contraction, d—the base rate of range expansion, and j—the weight of founder-event speciation at cladogenesis] and in the configuration of dispersal multiplier matrices used [109]. To estimate the ancestral range distribution among Antillattus clade without outgroups, we conducted time-stratified analyses testing (1) overwater dispersal, and (2) land connections prior to the opening of the Mona Passage and the Windward Passage using a set of 72 models that varied in the parameters and in the configuration of dispersal multiplier matrices used [109]. In both approaches, we tested three dispersal probability hypotheses: (a) the dispersal probability decreases with distance, (b) dispersal probability is independent of distance, and (c) the probability of overwater dispersal is essentially zero (Table 2) (see Crews and Esposito [52]). Dispersal probabilities were set as follows: they were set to 0.8 when two areas were adjacent, to 0.5 when two areas were weakly separated by a geographical barrier, to 0.2 when two areas were separated by water over a distance less than 200 km, to 0.05 for connection by island chain (e.g., Lesser Antilles) or intermediate island (e.g., Hispaniola between Cuba and Puerto Rico), to 0.001 for long-distance dispersal (areas separated by more than 200 km from sea), and to 0.0000001when dispersal was not possible by the lack area availability (we followed the BioGeoBEARS manual in setting extremely low rather than zero probabilities). Time periods were defined as follows to reflect the paleogeography of the area in each period [5,17,24]: (1) 23–15 Mya: Windward Passage, (2) 30–23 Mya: Mona Passage, (6) 32–35: GAARlandia hypothesis [32,33].
The +j parameter represents an approximation to model dispersal–dominated systems [109,114]; however, the validity of comparing models with and without +j parameter is controversial [115,116]. To conservatively address these issues [108,114,115,116], we use the best-fitting basic model and the best fitting model with +j parameter to discuss the ancestral range estimation, to estimate the number of lineages through time by area, and the number and type of biogeographical events [extinction, speciation (sympatric–subset speciation, within–area speciation, founder–event speciation), vicariance and dispersal events (anagenetic dispersal, range–expansion dispersal)]. Both the basic model with +j parameter were compared using likelihood values and the Akaike information criterion corrected for small sample sizes (AICc) [117]. Finally, to estimate the number of lineages through time, and the number and type of biogeographical events, we used the best model resulted in the analysis of Antillattus clade without outgroups. We ran biogeographical stochastic mapping (BSM) using the maximum clade credibility (MCC) tree [118,119]. Event frequencies were estimated by taking the mean and standard deviation of event counts from 100 BSMs.

5. Results

Phylogeny and Divergence Time

The combined molecular dataset consisted of 3071 sites (27,369 internal gaps), the best BI tree has a harmonic-means = −24208.96, and the best ML tree has an lnL = −24,214.758 (Figure 4). The Antillattus clade is supported as monophyletic (ML, bootstrap = 100%). The phylogeny suggests that the Antillattus clade is sister to other Caribbean (e.g., Agobardus clade) (ML, bootstrap = 88%) and continental clades (e.g., Mexigonus-Pensacola clade). The relationships among the three genera in the Antillattus clade are not well resolved. The genus Petemathis is resolved as sister to Truncattus + Antillattus with low support (bootstrap = 73%, pp =0). A second analysis without outgroups (Figure 4, lnL = −13,533.817, Harmonic–means = −13,597.32) support Petemathis as sister to Truncattus + Antillattus (ML, bootstrap = 100%, BI, pp = 1.0), while Truncattus is poorly resolved as sister to Antillattus (ML, bootstrap = 0%, BI, pp = 0.68). In both analyses, the genus Antillattus is monophyletic, however, the relationships within the genus are not well resolved. The representatives of the genus Antillattus were divided into three groups of species that we refer to as the darlingtoni, keyserlingi, and gracilis groups, with gracilis sister to the other two. The phylogeny recovered the genus Petemathis, the darlingtoni group, and the keyserlingi group as single-island endemic lineages. The gracilis group and Truncattus are found both on Hispaniola and Cuba.
In both BEAST analyses (including outgroups and excluding outgroups), the posterior probability values from our BEAST analyses are higher than those in the MrBayes analysis (Figure 4 and Figure S1). For example, the genus Truncattus is recovered as sister group of the genus Antillattus with better support values (pp = 0.91). The chronogram of the Antillattus clade based on the birth–death process derived chronogram with a relaxed clock model (Figure 5), indicates that the MRCA of the Antillattus clade diverged during the Oligocene (c. 25 ± 3 Mya), and most of the subsequent divergences happened in the Miocene to present (c. present–21 Mya). The lineage leading to Petemathis diverged during the late Oligocene (c. 25 ±3 Mya). The divergence of the lineages leading to Truncattus, and the genus Antillattus were dated to the early Miocene (c. 21 ± 3 Mya and c. 19 ± 2 Mya respectively). Finally, the lineages leading to the gracilis, keyserlingi, and darlingtoni groups were dated to the early Miocene (c. 19 ± 2 Mya and c. 17 ± 2 Mya, respectively).

6. Model Selection and Ancestral Range Estimation

The A2a DEC+J model (log likelihood: LnL = −33.87; parameter estimates: d = 0; e = 0; j = 0.22) and the A2a DEC model (log likelihood: LnL = −43.84; parameter estimates: d = 0.022; e = 0; j = 0) (Table 3, Supplementary Data S3) are consistent with the GAARlandia, and dispersal probability decreasing with distance. Both the basic and +j models resolve the most probable ancestral area for the extant species of the Antillattus clade is Northern South America and Hispaniola. The estimation of ancestral ranges among Antillattus clade, show that the favored model was the B2a DIVALIKE +j model (log likelihood: LnL = −17.6; parameter estimates: d = 0; e = 0; j = 0.29), while the best model within the basic models was the B2a DIVALIKE model (log likelihood: LnL = −25.01; parameter estimates: d = 0.048; e = 0; j = 0) (Table 3, Supplementary Data S3). Both models are consistent with the land connections prior to the Mona Passage and the Windward Passage hypothesis, and dispersal probability decreasing with the distance. Both the basic and +j models show again Hispaniola as a probable ancestral area (Figure 6).

Estimation of Biogeographical Events

The DIVALIKE and DIVALIKE +j BioGeoBEARS stochastic map (BSM) based on 100 stochastic historical maps revealed that most probabilistic biogeographical events comprise within-area speciation (between 65 and 76% of probabilistic events in stochastic runs), founder-event (21%), range-expansion dispersal (15%), and vicariance (between 18 and 3%) (Table 4, Figure 6). The high number of within-area speciation probabilistic events in Hispaniola (between 43 and 48% of the total of the DIVALIKE and DIVALIKE +j within-area speciation probabilistic events), Cuba (between 40 and 44%), and Puerto Rico (between 12 and 13%) could be closely related to species richness. Most of the probabilistic estimated vicariance events among Cuba, Puerto Rico, and Hispaniola involved Hispaniola–Cuba (between 84 and 27% of the DIVALIKE and DIVALIKE +j vicariance probabilistic events), Hispaniola–Cuba–Puerto Rico (between 2 and 16%), Cuba–Puerto Rico (between 2 and 32%), and Hispaniola–Puerto Rico (between 1 and 26%).
Dispersal events are represented by range-expansions and founder-events (Table 4). Focusing on the range-expansion between Puerto Rico, Cuba, and Hispaniola, we found that the movement patterns varied enormously between areas and were highest among groups that have their ancestral range in Hispaniola (73% of the range-expansion probabilistic events and 45% of the founder-events probabilistic events). Range-expansion events only involved movements from Hispaniola–Cuba (73% of the range-expansion probabilistic events), and from Hispaniola–Puerto Rico (27%), while the range–expansion from Puerto Rico to Cuba and Hispaniola, and Cuba and Hispaniola to Puerto Rico were improbable (0% of simulations) (Supplementary Data S4). In contrast to the range–expansion events, founder-event speciation occurred in lineages that have their ancestral range in Cuba (51%), and the highest number of founder-event speciation involved movements from Cuba to Hispaniola (49% of the founder-event probabilistic events) and Hispaniola to Cuba (45%), with other events playing little or no role (less 2%). Finally, the number of lineages estimated through time by zone showed the occurrence of a greater number of events [within-area speciation, dispersions, and vicariances] representing movement from Hispaniola (Figure 7).

7. Discussion

7.1. Ancestral Range of the Antillattus Clade and GAARlandia

Our expanded Caribbean sampling within the Antillattus clade provides a more thorough analysis of diversification within the Caribbean and an opportunity to reassess its biogeographic origins. Our data suggest that the ancestor of the Antillattus clade colonized the Greater Antilles once from South America within a time frame consistent with GAARlandia; however, our continental outgroup taxon sampling limits confidence in inference of the source [32,33] (Figure 4). The estimated time of divergence of the Antillattus clade (25 ± 3 Mya) is consistent with dates inferred by Zhang and Maddison [68]. Neither the colonization of the Caribbean by Antillatus clade ancestors, nor the diversification of the group can in any way be linked to the colonization of the proto-Antillean volcanic arc in the Late Cretaceous (c. 65.5 Mya) [39,40].

7.2. Inter-Island Biogeographical History

The phylogenetic structure within the Greater Antilles reflects patterns consistent with historical island connectivity and breakup. Our estimation of the biogeographic history identified speciation within the Caribbean as the driving force of diversification (Table 4), consistent with the high levels of endemism in these spiders. For example, the species of the darlingtoni group are restricted to Hispaniola suggesting diversification exclusively within the island, while members of the genus Truncattus and the gracilis group are present in Cuba and Hispaniola, suggesting diversification both within and between these islands (Supplemental Data S4 and S5). The estimated divergence between Hispaniolan and Puerto Rican clades is c. 25.16 Mya consistent with the approximate timing of separation of these islands (c. 23–30 Mya). Similarly, Hispaniolan and Cuban clades split around 17–22 Mya coinciding with the geological separation of these islands. Hence, vicariance hypotheses can readily explain the distribution of major clades among islands. Similarly, the Puerto Rican genus Petemathis branched off from a Hispaniola lineage at c. 25 ± 3 Mya prior to the estimated timeframe of the Hispaniola and Puerto Rico split (20–30 Mya). While Petemathis only began to diversify later to around c.16.34 ± 6 Mya the split between Hispaniola and Puerto Rican lineages is easily explained by paleogeographical models and no long-distance dispersal is implied. Similarly, the keyserlingi and darlingtoni groups branched off from a Hispaniola lineage at c. 17.63 ± 2 Mya. The keyserlingi group only begins diversifying much later (c. 8.94 ± 3 Mya) and is restricted to Cuba. Of course, we cannot rule out earlier diversification of the group followed by extinction of early branches without much more detailed fossil record than is currently available. The darlingtoni group quickly diversified (c. 16.7 ± 1 Mya), presumably facilitating their colonization of Cuba before Hispaniola and Cuba split (c. 14–17 Mya).
On the other hand, the BSM analyses imply that dispersal between Hispaniola and Cuba continued happening after the geological separation of these islands suggesting that overwater dispersal also played an important role in shaping the current distribution and diversity of the linage (Figure 6, Supplementary Data S4). As in other groups of spiders, overwater dispersal is common in at least some lineages (e.g., Čandek et al. [50]; Crews and Esposito [52], Agnarsson et al. [46], Shapiro et al. [120], and can explain non-vicariant movement among Caribbean islands. Long-distance dispersal followed by range-expansion seems important in Truncattus (c. 13.66 ± 5 Mya) and the gracilis group (c. 15.5 ± 4 Mya). Similar studies show the occurrence of overwater dispersal/colonization events (e.g., founder-events and range-expansions) as the best explanation of among island movement after Hispaniola–Cuba split (butterflies Calisto: Matos–Maraví et al. [5]; aquatic beetles Phaenonotum: Deler–Hernández et al. [24]; weevils Exophthalmus: Zhang et al. [67]; mastiff bats Molossus: Loureiro et al. [121]).

7.3. From Hispaniola to Cuba and Puerto Rico

Our study indicates Hispaniola as a potential source for subsequent radiations throughout the Greater Antilles, with multiple exchanges between Hispaniola and Cuba (Figure 6 and Figure 7, Supplementary Data S4 and S5). Other studies also support Hispaniola as a point of dispersal to other Antillean islands [122,123]. Fabre et al. [124] found evidence in Caribbean Capromyidae (hutias) supporting Hispaniola as a potential source of colonization to other Greater Antilles islands and the Bahamas. In their study, they suggest either (i) a vicariant event between eastern (Hispaniola) and western (Bahamas, Cuba, Jamaica) hutias or (ii) stepping-stone colonization from east to west. Čandek et al., [50] found that in Cyrthognata spiders dispersal from Hispaniola explains their colonization of the rest of the Caribbean Archipelago. The BioGeoBEARS ancestral range estimation of the GAARlandia DEC+j model for Deinopis (see, Chamberland et al., [4]) also supports the hypothesis that Hispaniola plays a pivotal role in Caribbean dispersal. McHugh et al. [48] and Shapiro et al. [120]) provide evidence that Caribbean Micrathena are not monophyletic and likely colonized the region multiple times, with evidence of interchanges between Cuba, Hispaniola and Puerto Rico. In the case of the origin of the Antillattus clade, the exact role of Hispaniola is less clear; however, the available evidence indicates that it may be the area of the Caribbean first colonized by the ancestor of the clade. Further studies of Caribbean biota will further clarify the role of Hispaniola in the overall biogeographical complexity of the Greater Antilles.

8. Conclusions

Our study sheds new light on the biogeography of the Antillattus clade and their Caribbean radiation. The phylogenetic and biogeographical evidence presented in this study fits the Caribbean palaeogeographical model of colonization and suggests a complex interplay of vicariance and overwater dispersal driven diversification in shaping the biota of this biodiversity hotspot. The ancestor of the Antillattus clade appears to have colonized the Greater Antilles (Puerto Rico, Hispaniola, and Cuba) during the timespan of GAARlandia and land connections prior to the Mona Passage and the Windward Passage. Our results suggest that the evolution of the Antillattus clade included both vicariant processes and long-distance dispersal with the majority of diversification attributed to within island speciation. Finally, among other insights, we have uncovered the importance of Hispaniola in the Antillattus clade colonization of the Caribbean, thereby providing further evidence that islands can function as key diversification hubs for archipelagos.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/d14030224/s1, https://drive.google.com/drive/folders/1HotuTFZ1UVIsRbIDCfOK5Xk4GmNr-jqg?usp=sharing (Accessed on 10 November 2021). Table S1: Substitution models selected by jModelTest and ModelFinder for each individual gene region and partition. Dataset including outgroups and excluding outgroups. Data S1: DNA analysis for dataset including outgroups and excluding outgroups. Data S2: Beast divergence time estimations (including outgroups and excluding outgroups) of all genes (CO1, 16S-ND1, 28S) using a Bayesian relaxed molecular clock. Data S3: BioGeoBEARS Antillattus clade (including outgroups and excluding outgroups). Data S4: B2a model (stochastic mapping (BSM)). Data S5: B2a model (number of lineages through time).

Author Contributions

Conceptualization, F.C.-R.; data curation, F.C.-R. and P.W.; formal analysis, F.C.-R. and P.W.; funding acquisition, G.J.B. and I.A.; investigation, F.C.-R.; methodology, F.C.-R. and E.F.-D.; project administration, G.J.B. and I.A.; resources, G.J.B. and I.A.; software, F.C.-R.; supervision, E.F.-D., G.J.B. and I.A.; validation, G.J.B. and I.A.; Visualization, F.C.-R., P.W., E.F.-D., G.J.B. and I.A.; writing—original draft, F.C.-R., P.W. and E.F.-D.; writing—review & editing, F.C.-R., G.J.B. and I.A. All authors have read and agreed to the published version of the manuscript.

Funding

Funding for this work came from NSF DEB-1314749 and DEB-1050253 to G. Binford and I. Agnarsson. Additional funds came from the Smithsonian Laboratories of Analytical Biology, a 2013 SI Barcode Network grant to J.A. Coddington and I. Agnarsson; and in part from National Geographic Society (WW-203R017) grant to I. Agnarsson.

Institutional Review Board Statement

All material was collected under appropriate collection permits and approved guidelines.

Informed Consent Statement

Not applicable.

Data Availability Statement

Acknowledgments

Many thanks to all the members of the CarBio team and our collaborators for their tireless effort in the field over the last years. Many thanks to Robert Anderson, Martín Fikáček, Andrew Smith, and Guanyang Zhang Rodrigo for their important help in the field. Special thanks to our collaborators in Cuba: Alexander Sanchez, Giraldo Alayón, Albert Deler–Hernandez, and rangers of “Pico Turquino National Park, “Maravillas de Viñales” National Park, “Sierra de Cubitas” Ecological Reserve, “Topes de Collantes” National Park, “Duaba–Yunque–Quibijan” Ecological Reserve, and “Soledad” Botanical Garden. In Hispaniola: Carlos Suriel, Solanlly Carrero Jiménez, and Gabriel de los Santos for their invaluable help with the organization and execution of logistically complex expeditions and ongoing collaboration. We are grateful to Laura May-Collado who did extraction and sequencing for many specimens. We especially acknowledge the comments of Sarah Crews and anonymous reviewers. We are grateful to the authorities and personnel of the Cuban Ministry of Science, Technology and Environment (CICA–CITMA), and the Empresa Nacional para la Protección de la Flora y la Fauna (ENPFF) for providing access to protected areas under their control.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Dávalos, L.M. Phylogeny and biogeography of Caribbean mammals. Biol. J. Linn. Soc. 2004, 8, 373–394. [Google Scholar] [CrossRef] [Scilit]
  2. Ricklefs, R.; Bermingham, E. The West Indies as a laboratory of biogeography and evolution. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2008, 363, 2393–2413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Agnarsson, I.; Kuntner, M. The generation of a biodiversity hotspot: Biogeography and phylogeography of the western Indian Ocean islands. In Current Topics in Phylogenetics and Phylogeography of Terrestrial and Aquatic Systems; Anamthawat-Jonsson, K., Ed.; Tech Publishers Press: Rijeka, Croatia, 2012; pp. 33–82. [Google Scholar]
  4. Chamberland, L.; McHugh, A.; Kechejian, S.; Binford, G.J.; Bond, J.E.; Coddington, J.; Dolman, G.; Hamilton, C.A.; Harvey, M.S.; Kuntner, M.; et al. From Gondwana to GAAR landia: Evolutionary history and biogeography of ogre-faced spiders (Deinopis). J. Biogeogr. 2018, 45, 2442–2457. [Google Scholar] [CrossRef] [Scilit]
  5. Matos-Maraví, P.; Águila, R.N.; Peña, C.; Miller, J.Y.; Sourakov, A.; Wahlberg, N. Causes of endemic radiation in the Caribbean: Evidence from the historical biogeography and diversification of the butterfly genus Calisto (Nymphalidae: Satyrinae: Satyrini). BMC Evol. Biol. 2014, 14, 199. [Google Scholar] [CrossRef] [Scilit]
  6. Gillespie, R.G.; Roderick, G.K. Arthropods on islands: Colonization, speciation, and conservation. Annu. Rev. Entomol. 2002, 47, 595–632. [Google Scholar] [CrossRef] [Scilit]
  7. De Queiroz, K. A unified species concept and its consequences for the future of taxonomy. Proc. Calif. Acad. Sci. 2005, 56, 196–215. [Google Scholar]
  8. Cowie, R.H.; Holland, B.S. Dispersal is fundamental to biogeography and the evolution of biodiversity on oceanic islands. J. Biogeogr. 2006, 33, 193–198. [Google Scholar] [CrossRef] [Scilit]
  9. Gillespie, R.G.; Baldwin, B.G.; Waters, J.M.; Fraser, C.I.; Nikula, R.; Roderick, G.K. Long-distance dispersal: A framework for hypothesis testing. Trends Ecol. Evol. 2012, 27, 47–55. [Google Scholar] [CrossRef] [Scilit]
  10. Schönhofer, A.L.; McCormack, M.; Tsurusaki, N.; Martens, J.; Hedin, M. Molecular phylogeny of the harvestmen genus Sabacon (Arachnida: Opiliones: Dyspnoi) reveals multiple Eocene–Oligocene intercontinental dispersal events in the Holarctic. Mol. Phylogenet. Evol. 2013, 66, 303–315. [Google Scholar] [CrossRef] [Scilit]
  11. Agnarsson, I.; Cheng, R.C.; Kuntner, M. A Multi-Clade Test Supports the Intermediate Dispersal Model of Biogeography. PLoS ONE 2014, 91, e86780. [Google Scholar] [CrossRef] [Scilit]
  12. Toussaint, E.F.A.; Fikacek, M.; Short, A.E.Z. India-Madagascar vicariance explains cascade beetle bio-geography. Biol. J. Linn. Soc. 2016, 118, 982–991. [Google Scholar] [CrossRef] [Scilit]
  13. Weaver, P.F.; Cruz, A.; Johnson, S.; Dupin, J.; Weaver, K.F. Colonizing the Caribbean: Biogeography and evolution of livebearing fishes of the genus Limia (Poeciliidae). J. Biogeogr. 2016, 43, 1808–1819. [Google Scholar] [CrossRef] [Scilit]
  14. Mittermeier, R.A.; Robles-Gil, P.; Hoffman, M.; Pilgrim, J.; Brooks, T.; Mittermeier, C.G.; Lamoreux, J.; da Fonseca, G.A.B. Hotspots Revisited: Earth’s Biologically Richest and Most Endangered Terrestrial Ecoregions; CEMEX, Agrupación Sierra Madre: Monterrey, Mexico, 2004. [Google Scholar]
  15. Diamond, J.M.; Gilpin, M.E.; Mayr, E. Species-Distance Relation for Birds of Solomon Archipelago, and Paradox of Great Speciators. Proc. Natl. Acad. Sci. USA 1976, 73, 2160–2164. [Google Scholar] [CrossRef] [Scilit]
  16. Glor, R.E.; Losos, J.B.; Larson, A. Out of Cuba: Overwater dispersal and speciation among lizards in the Anolis carolinensis subgroup. Mol. Ecol. 2005, 14, 2419–2432. [Google Scholar] [CrossRef] [Scilit]
  17. Iturralde-Vinent, M.A. Meso-Cenozoic Caribbean paleogeography: Implications for the historical biogeography of the region. Int. Geol. Rev. 2006, 48, 791–827. [Google Scholar] [CrossRef] [Scilit]
  18. Crews, S.C.; Gillespie, R.G. Molecular systematics of Selenops spiders (Araneae: Selenopidae) from North and Central America: Implications for Caribbean biogeography. Biol. J. Linn. Soc. 2010, 101, 288–322. [Google Scholar] [CrossRef] [Scilit]
  19. Claramunt, S.; Derryberry, E.P.; Remsen, J.V., Jr.; Brumfield, R.T. High dispersal ability inhibits speciation in a continental radiation of passerine birds. Proc. Royal Soc. B 2012, 279, 1567–1574. [Google Scholar] [CrossRef] [Scilit]
  20. Algar, A.C.; Mahler, D.L.; Glor, R.E.; Losos, J.B. Niche incumbency, dispersal limitation and climate shape geographical distributions in a species-rich island adaptive radiation. Glob. Ecol. Biogeogr. 2013, 22, 391–402. [Google Scholar] [CrossRef] [Scilit]
  21. Helmus, M.R.; Mahler, D.L.; Losos, J.B. Island biogeography of the Anthropocene. Nature 2014, 513, 543–546. [Google Scholar] [CrossRef] [Scilit]
  22. Dziki, A.; Binford, G.J.; Coddington, J.A.; Agnarsson, I. Spintharus flavidus in the Caribbean—A 30 million year biogeographical history and radiation of a ‘widespread species’. PeerJ 2015, 3, e1422. [Google Scholar] [CrossRef] [Scilit]
  23. Esposito, L.A.; Bloom, T.; Caicedo, L.; Alicia-Serrano, A.; Sanchez-Ruiz, J.; May-Collado, L.J.; Binford, G.; Agnarsson, I. Islands within islands: Diversification of tailless whip spiders (Amblypygi, Phrynus) in Caribbean caves. Mol. Phylogenet. Evol. 2015, 93, 107–117. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Deler-Hernández, A.; Sýkora, V.; Seidel, M.; Cala-Riquelme, F.; Fikáček, M. Multiple origins of the Phaenonotum beetles in the Greater Antilles (Coleoptera: Hydrophilidae): Phylogeny, biogeography and systematics. Zool. J. Linnean Soc. 2017, 183, 97–120. [Google Scholar] [CrossRef] [Scilit]
  25. Reynolds, R.G.; Strickland, T.R.; Kolbe, J.J.; Falk, B.G.; Perry, G.; Revell, L.J.; Losos, J.B. Archipelagic genetics in a widespread Caribbean anole. J. Biogeogr. 2017, 44, 2631–2647. [Google Scholar] [CrossRef] [Scilit]
  26. Chamberland, L.; Salgado-Roa, F.C.; Basco, A.; Crastz-Flores, A.; Binford, G.J.; Agnarsson, I. Phylogeography of the widespread Caribbean spiny orb weaver Gasteracantha cancriformis. PeerJ 2020, 8, e8976. [Google Scholar] [CrossRef] [Scilit]
  27. Ali, J.R.; Hedges, S.B. Colonizing the Caribbean: New geological data and an updated land-vertebrate colonization record challenge the GAARlandia land-bridge hypothesis. J. Biogeogr. 2021, 48, 2699–2707. [Google Scholar] [CrossRef] [Scilit]
  28. Iturralde-Vinent, M.A. Aspectos geológicos de la biogeografía de Cuba. Cienc. Tierra Espacio 1982, 5, 85–100. [Google Scholar]
  29. Mann, P.; Schubert, C.; Burke, K. Review of Caribbean neotectonics. In The Caribbean Region: Geological Society of America; Dengo, G., Case, J.E., Eds.; The Geology of North America: Boulder, CO, USA, 1990; pp. 307–338. [Google Scholar]
  30. MacPhee, R.D.E.; Iturralde-Vinent, M.A. First Tertiary land mammal fossils from Greater Antilles: An Early Miocene sloth (Xenarhra, Megalonychidae) from Cuba. Am. Mus. Novit. 1994, 3094, 1–13. [Google Scholar]
  31. MacPhee, R.D.E.; Iturralde-Vinent, M.A. Origin of the Greater Antilles land mammal fauna 1: New Tertiary land mammals from Cuba and Puerto Rico. Am. Mus. Novit. 1995, 314, 1–31. [Google Scholar]
  32. Iturralde-Vinent, M.A.; MacPhee, R.D.E. Paleogeography of the Caribbean region: Implications for Cenozoic biogeography. Bull. Am. Mus. Natl. Hist. 1999, 238, 1–95. [Google Scholar]
  33. MacPhee, R.D.E.; Iturralde-Vinent, M.A. A short history of Greater Antillean land mammals: Biogeography, paleogeography, radiation, and extinctions. Tropics 2000, 10, 145–154. [Google Scholar] [CrossRef] [Scilit]
  34. White, J.L.; MacPhee, R.D.E. The sloths of the West Indies: A systematic and phylogenetic review. In Biogeography of the West Indies: Patterns and Perspectives; Woods, C.A., Sergile, F.E., Eds.; CRC Press: Boca Raton, FL, USA, 2001; pp. 201–235. [Google Scholar]
  35. Pindell, J.L.; Barrett, S.F. Geological evolution of the Caribbean region: A plate tectonic perspective. In The Caribbean Region: Geological Society of America; Dengo, G., Case, J.E., Eds.; The Geology of North America: Boulder, CO, USA, 1990; pp. 405–432. [Google Scholar]
  36. Van Gestel, J.P.; Mann, P.; Grindlay, N.R.; Dolan, J.F. Three-phase tectonic evolution of the northern margin of Puerto Rico as inferred from an integration of seismic reflection, well, and outcrop data. Mar. Geol. 1999, 161, 257–286. [Google Scholar] [CrossRef] [Scilit]
  37. MacPhee, R.D.E.; Iturralde-Vinent, M.A.; Gaffney, E.S. Domo de Zaza, an early Miocene vertebrate locality in south-central Cuba, with notes on the tectonic evolution of Puerto Rico and the Mona Passage. Am. Mus. Novit. 2003, 3394, 1–42. [Google Scholar] [CrossRef] [Scilit]
  38. Alonso, R.; Crawford, A.J.; Bermingham, E. Molecular phylogeny of an endemic radiation of Cuban toads (Bufonidae: Peltophryne) based on mitochondrial and nuclear genes. J. Biogeogr. 2012, 39, 434–451. [Google Scholar] [CrossRef] [Scilit]
  39. Rosen, D.E. A vicariance model of Caribbean biogeography. Syst. Zool. 1975, 24, 431–464. [Google Scholar] [CrossRef] [Scilit]
  40. Rosen, D.E. Geological hierarchies and biogeographical congruence in the Caribbean. Ann. Mo. Bot. Gard. 1985, 72, 636–659. [Google Scholar] [CrossRef] [Scilit]
  41. Tada, R.; Iturralde-Vinent, M.; Matsui, T.; Tajika, E.; Oji, T.; Goto, K.; Nakano, Y.; Takayama, H.; Yamamoto, S.; Toyoda, K.; et al. K/T Boundary deposits in the Paleo-western Caribbean basin. AAPG Mem. 2003, 26, 23. [Google Scholar]
  42. Hedges, S.B.; Hass, C.; Maxson, L. Caribbean biogeography: Molecular evidence for dispersal in West Indian terrestrial vertebrates. Proc. Natl. Acad. Sci. USA 1992, 89, 1909–1913. [Google Scholar] [CrossRef] [Scilit]
  43. Hedges, S.B. Biogeography of the West Indies: An overview. In Biogeography of the West Indies: Patterns and Perspectives; Woods, C.A., Sergile, F.E., Eds.; CRC Press: Baton Rouge, LA, USA, 2001; pp. 15–33. [Google Scholar]
  44. Hedges, S.B. Paleogeography of the Antilles and origin of West Indian terrestrial vertebrates. Ann. Missouri Bot. Gard. 2006, 93, 231–244. [Google Scholar] [CrossRef] [Scilit]
  45. Sato, J.J.; Ohdachi, S.D.; Echenique-Diaz, L.M.; Borroto-Páez, R.; Begué-Quiala, G.; Delgado-Labañino, L.J.; Gámez-Díez, J.; Álbarez-Lemus, J.; Nguyen, T.S.; Yamaguchi, N.; et al. Molecular phylogenetic analysis of nuclear genes suggests a Cenozoic overwater dispersal origin for the Cuban solenodon. Sci. Rep. 2016, 6, 31173. [Google Scholar] [CrossRef] [Scilit]
  46. Uit de Weerd, D.R.; Robinson, D.G.; Rosenberg, G. Evolutionary and biogeographical history of the land snail family Urocoptidae (Gastropoda: Pulmonata) across the Caribbean region. J. Biogeogr. 2016, 43, 763–777. [Google Scholar] [CrossRef] [Scilit]
  47. Yusseff-Vanegas, S.; Agnarsson, I. Molecular phylogeny of the forensically important genus Cochliomyia (Diptera: Calliphoridae). ZooKeys 2016, 609, 107–120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Mchugh, A.; Yablonsky, C.; Binford, G.; Agnarsson, I. Molecular phylogenetics of Caribbean Micrathena (Araneae: Araneidae) suggests multiple colonization events and single island endemism. Invertebr. Syst. 2014, 28, 337–349. [Google Scholar] [CrossRef] [Scilit]
  49. Agnarsson, I.; LeQuier, S.M.; Kuntner, M.; Cheng, R.C.; Coddington, J.A.; Binford, G. Phylogeography of a good Caribbean disperser: Argiope argentata (Araneae, Araneidae) and a new ‘cryptic’ species from Cuba. ZooKeys 2016, 2016, 25–44. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Čandek, K.; Agnarsson, I.; Binford, G.J.; Kuntner, M. Biogeography of the Caribbean Cyrtognatha spiders. Sci. Rep. 2019, 9, 397. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  51. Čandek, K.; Binford, G.J.; Agnarsson, I.; Kuntner, M. Caribbean golden orbweaving spiders maintain gene flow with North America. Zool. Scr. 2020, 49, 210–221. [Google Scholar] [CrossRef] [Scilit]
  52. Crews, S.C.; Esposito, L.A. Towards a synthesis of the Caribbean biogeography of terrestrial arthropods. BMC Evol. Biol. 2020, 20, 12. [Google Scholar] [CrossRef] [Scilit]
  53. Ali, J.R. Colonizing the Caribbean: Is the GAARlandia land-bridge hypothesis gaining a foothold? J. Biogeogr. 2012, 39, 431–433. [Google Scholar] [CrossRef] [Scilit]
  54. Philippon, M.; Cornée, J.-J.; Münch, P.; van Hinsbergen, D.J.J.; BouDagher-Fadel, M.; Gailler, L. Eocene intra-plate shortening responsible for the rise of a faunal pathway in the northeastern Caribbean realm. PLoS ONE 2020, 15, e0241000. [Google Scholar] [CrossRef] [Scilit]
  55. Murphy, W.J.; Collier, G.E. Phylogenetic relationships within the aplocheiloid fish genus Rivulus (Cyprinodontiformes, Rivulidae): Implications for Caribbean and Central American biogeography. Mol. Biol. Evol. 1996, 13, 642–649. [Google Scholar] [CrossRef] [Scilit]
  56. Dávalos, L.M. Short-faced bats (Phyllostomidae: Stenodermatina): A Caribbean radiation of strict frugivores. J. Biogeogr. 2007, 34, 364–375. [Google Scholar] [CrossRef] [Scilit]
  57. Santiago-Valentin, E.; Olmstead, R.G. Phylogenetics of the Antillean Goetzeoideae (Solanaceae) and their relationships within the Solanaceae based on chloroplast and ITS DNA sequence data. Am. Soc. Plant Taxon. 2003, 28, 452–460. [Google Scholar]
  58. Tong, Y.; Binford, G.; Rheims, A.R.; Kuntner, M.; Liu, J.; Agnarsson, I. Huntsmen of the Caribbean: Multiple tests of the GAARlandia hypothesis. Mol. Phylogenet. Evol. 2019, 130, 259–268. [Google Scholar] [CrossRef] [Scilit]
  59. Censky, E.J.; Hodge, K.; Dudley, J. Over-water dispersal of lizards due to hurricanes. Nature 1998, 395, 556. [Google Scholar] [CrossRef] [Scilit]
  60. Hall, J.P.W.; Robbins, R.K.; Harvey, D.J. Extinction and biogeography in the Caribbean: New evidence from a fossil riodinid butterfly in Dominican amber. Proc. Soc. R. Soc. B-Biol. Sci. 2004, 271, 797–801. [Google Scholar] [CrossRef] [Scilit]
  61. Wahlberg, N. That awkward age for butterflies: Insights from the age of the butterfly subfamily Nymphalinae (Lepidoptera: Nymphalidae). Syst. Biol. 2006, 55, 703–714. [Google Scholar] [CrossRef] [Scilit]
  62. Wahlberg, N.; Freitas, A.V. Colonization of and radiation in South America by butterflies in the subtribe Phyciodina (Lepidoptera: Nymphalidae). Mol. Phylogenet. Evol. 2007, 44, 1257–1272. [Google Scholar] [CrossRef] [Scilit]
  63. Sourakov, A.; Zakharov, E.V. “Darwin’s butterflies”? DNA barcoding and the radiation of the endemic Caribbean butterfly genus Calisto (Lepidoptera, Nymphalidae, Satyrinae). Comp. Cytogenet. 2011, 5, 191–210. [Google Scholar] [CrossRef] [Scilit]
  64. Ceccarelli, F.S.; Zaldívar-Riverón, A. Broad polyphyly and historical biogeography of the Neotropical wasp genus Notiospathius (Braconidae: Doryctinae). Mol. Phylogenet. Evol. 2013, 69, 142–152. [Google Scholar] [CrossRef] [Scilit]
  65. Lewis, D.S.; Sperling, F.A.H.; Nakahara, S.; Cotton, A.M.; Kawahara, A.Y.; Condamine, F.L. Role of Caribbean Islands in the diversification and biogeography of Neotropical Heraclides swallowtails. Cladistics 2015, 31, 291–314. [Google Scholar] [CrossRef] [Scilit]
  66. Rodriguez, J.; Pitts, J.P.; von Dohlen, C.D. Historical biogeography of the widespread spider wasp tribe Aporini (Hymenoptera: Pompilidae). J. Biogeogr. 2015, 42, 495–506. [Google Scholar] [CrossRef] [Scilit]
  67. Zhang, G.; Basharat, U.; Matzke, N.; Franz, N.M. Model selection in statistical historical biogeography of Neotropical insects—the Exophthalmus genus complex (Curculionidae: Entiminae). Mol. Phylogenet. Evol. 2017, 109, 226–239. [Google Scholar] [CrossRef] [Scilit]
  68. Zhang, J.X.; Maddison, W.P. Molecular phylogeny, divergence times and biogeography of spiders of the subfamily Euophryinae (Araneae: Salticidae). Mol. Phylogenet. Evol. 2013, 68, 81–92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  69. Chakrabarty, P. Systematics and historical biogeography of Greater Antillean Cichlidae. Mol. Phylogenet. Evol. 2006, 39, 619–627. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  70. Říčan, O.; Piálek, L.; Zardoya, R.; Doadrio, I.; Zrzavý, J. Biogeography of the Mesoamerican Cichlidae (Teleostei: Heroini): Colonization through the GAARlandia land bridge and early diversification. J. Biogeogr. 2013, 40, 579–593. [Google Scholar] [CrossRef] [Scilit]
  71. World Spider Catalog. World Spider Catalog. Version 22.5. Natural History Museum Bern. Available online: http://wsc.nmbe.ch (accessed on 17 November 2021).
  72. Spagna, J.C.; Peattie, A.M. Terrestrial locomotion in arachnids. J. Insect Physiol. 2012, 58, 599–606. [Google Scholar] [CrossRef] [Scilit]
  73. Kropf, C. Hydraulic system of locomotion. In Spider Ecophysiology; Nentwig, W., Ed.; Springer: Berlin, Germany, 2013; pp. 43–56. [Google Scholar]
  74. Brandt, E.E.; Roberts, K.T.; Williams, C.M.; Elias, D.O. Low temperatures impact species distributions of jumping spiders across a desert elevational cline. J. Insect. Physiol. 2020, 122, 104037. [Google Scholar] [CrossRef] [Scilit]
  75. Bodner, M.R.; Maddison, W.P. The biogeography and age of salticid spider radiations (Araneae: Salticidae). Mol. Phylogenet. Evol. 2012, 65, 213–240. [Google Scholar] [CrossRef] [Scilit]
  76. Maddison, W.P.; Hedin, M.C. Jumping spider phylogeny (Araneae: Salticidae). Invertebr. Syst. 2003, 17, 529–549. [Google Scholar] [CrossRef] [Scilit]
  77. Maddison, W.P.; Bodner, M.R.; Needham, K.M. Salticid spider phylogeny revisited, with the discovery of a large Australasian clade (Araneae: Salticidae). Zootaxa 2008, 1893, 46–64. [Google Scholar] [CrossRef] [Scilit]
  78. Bryant, E.B. The salticid spiders of Hispaniola. Bull. Mus. Comp. Zool. 1943, 92, 445–529. [Google Scholar]
  79. Zhang, J.X.; Maddison, W.P. New euophryine jumping spiders from the Dominican Republic and Puerto Rico (Araneae: Salticidae: Euophryinae). Zootaxa. 2012, 3476, 1–54. [Google Scholar] [CrossRef] [Scilit]
  80. Prószyński, J.; Deeleman-Reinhold, C.L. Description of some Salticidae (Aranei) from the Malay Archipelago. II. Salticidae of Java and Sumatra, with comments on related species. Arthropoda Sel. 2012, 21, 29–60. [Google Scholar] [CrossRef] [Scilit]
  81. Zhang, J.X.; Maddison, W.P. Genera of euophryine jumping spiders (Araneae: Salticidae), with a combined molecular-morphological phylogeny. Zootaxa 2015, 3938, 1–147. [Google Scholar] [CrossRef] [Scilit]
  82. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Bio. Biotechnol. 1994, 3, 294–299. [Google Scholar]
  83. Hedin, M.C.; Maddison, W.P. A combined molecular approach to phylogeny of the jumping spider subfamily Dendryphantinae (Araneae: Salticidae). Mol. Phylogenet. Evol. 2001, 18, 386–403. [Google Scholar] [CrossRef] [Scilit]
  84. Green, P. Phrap, Version 0.990329. 1999. Available online: http://www.phrap.org (accessed on 2 June 2021).
  85. Green, P.; Ewing, B. Phred, Version 0.020425 c. 2002. Available online: http://www.phrap.org (accessed on 2 June 2021).
  86. Maddison, D.R.; Maddison, W.P. 2021. Chromaseq: A Mesquite Package for Analyzing Sequence Chromatograms. Version 1.31. 2018. Available online: http://chromaseq.mesquiteproject.org (accessed on 2 June 2021).
  87. Maddison, W.P.; Maddison, D.R. Mesquite: A Modular System for Evolutionary Analysis. Version 3.6. 2018. Available online: http://www.mesquiteproject.org (accessed on 2 June 2021).
  88. Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Scilit]
  89. Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and parallel computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef] [Scilit]
  90. Posada, D.; Buckley, T.R. Model selection and model averaging in phylogenetics: Advantages of Akaike Information Criterion and Bayesian Approaches over Likelihood Ratio Tests. Syst. Biol. 2004, 53, 793–808. [Google Scholar] [CrossRef] [Scilit]
  91. Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [Scilit]
  92. Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.F.K.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2015, 14, 587–589. [Google Scholar] [CrossRef] [Scilit]
  93. Altekar, G.; Dwarkadas, S.; Huelsenbeck, J.P.; Ronquist, F. Parallel Metropolis coupled Markov chain Monte Carlo for Bayesian phylogenetic inference. Bioinformatics 2004, 20, 407–415. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  94. Miller, M.; Pfeiffer, W.; Schwartz, T. Creating the CIPRES Science Gateway for inference of large phylogenetic tres. In Proceedings of the 2010 Gateway Computing Environments Workshop (GCE 2010), New Orleans, LA, USA, 14 November 2010; pp. 1–8. [Google Scholar] [CrossRef] [Scilit]
  95. Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 2001, 17, 754–755. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  96. Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef] [Scilit]
  97. Rambaut, A.; Suchard, M.A.; Xie, D.; Drummond, A.J. Tracer v1.6. 2014. Available online: http://beast.bio.ed.ac.uk/Tracer (accessed on 2 June 2021).
  98. Drummond, A.J.; Suchard, M.A.; Xie, D.; Rambaut, A. Bayesian phylogenetics with BEAUti and the BEAST 1.7. Mol. Biol. Evol. 2012, 29, 1969–1973. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  99. Battistuzzi, F.U.; Billing-Ross, P.; Paliwal, A.; Kumar, S. Fast and slow implementations of relaxed-clock methods show similar patterns of accuracy in estimating divergence times. Mol. Biol. Evol. 2011, 28, 2439–2442. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  100. Bidegaray-Batista, L.; Arnedo, M.A. Gone with the plate: The opening of the Western Mediterranean basin drove the diversification of ground-dweller spiders. MBC Evol. Biol. 2011, 11, 317. [Google Scholar] [CrossRef] [Scilit]
  101. Xie, W.; Lewis, P.O.; Fan, Y.; Kuo, L.; Chen, M.H. Improving marginal likelihood estimation for Bayesian phylogenetic model selection. Syst. Biol. 2011, 60, 150–160. [Google Scholar] [CrossRef] [Scilit]
  102. Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [Scilit]
  103. Gernhard, T. The conditioned reconstructed process. J. Theor. Biol. 2008, 253, 769–778. [Google Scholar] [CrossRef] [Scilit]
  104. Stadler, T. On incomplete sampling under birth–death models and connections to the sampling-based coalescent. J. Theor. Biol. 2009, 261, 58–66. [Google Scholar] [CrossRef] [Scilit]
  105. Wunderlich, J. Die Fossilen Spinnen im Dominikanischen Bernstein; Published by the author Straubenhardt: Baden-Württemberg, Germany, 1988. [Google Scholar]
  106. Penney, D. Dominican Amber Spiders: A Comparative Palaeontological-Neontological Approach to Identification, Faunistics, Ecology and Biogeography; Siri Scientific Press: Rochdale, UK, 2008. [Google Scholar]
  107. Peckham, G.W.; Peckham, E.G. On some new genera and species of Attidae from the eastern part of Guatemala. Proc. Nat. Hist. Soc. Wisconsin. 1885, 2, 62–86. [Google Scholar]
  108. Zhang, J. Phylogeny and Systematics of the Jumping Spider Subfamily Euophryinae (Araneae: Salticidae), with Consideration of Biogeography and Genitalic Evolution. Ph.D. Thesis, University of British Columbia, Vancouver, BC, Canada, 2012. Available online: https://open.library.ubc.ca/collections/ubctheses/24/items/1.0072804 (accessed on 17 November 2021).
  109. Matzke, N.J. Model selection in historical biogeography reveals that founder-event speciation is a crucial process in Island Clades. Syst. Biol. 2014, 63, 951–970. [Google Scholar] [CrossRef] [Scilit]
  110. Matzke, N.J. BioGeoBEARS: BioGeography with Bayesian (and Likelihood) Evolutionary Analysis with R Scripts. Version 1.1.1. 2018. Available online: https://doi.org/10.5281/zenodo.1478250 (accessed on 4 September 2021).
  111. Ree, R.H.; Smith, S.A. Maximum likelihood inference of geographic range evolution by dispersal, local extinction, and cladogenesis. Syst. Biol. 2008, 57, 4–14. [Google Scholar] [CrossRef] [Scilit]
  112. Ronquist, F. Dispersal-vicariance analysis: A new approach to the quantification of historical biogeography. Syst. Biol. 1997, 46, 195–203. [Google Scholar] [CrossRef]
  113. Landis, M.J.; Matzke, N.J.; Moore, B.R.; Huelsenbeck, J.P. Bayesian analysis of biogeography when the number of áreas is large. Syst. Biol. 2013, 62, 789–804. [Google Scholar] [CrossRef] [Scilit]
  114. Klaus, K.V.; Matzke, N.J. Statistical Comparison of Trait-Dependent Biogeographical Models Indicates That Podocarpaceae Dispersal Is Influenced by Both Seed Cone Traits and Geographical Distance. Syst. Biol. 2020, 69, 61–75. [Google Scholar] [CrossRef] [Scilit]
  115. Ree, R.H.; Sanmartín, I. Conceptual and statistical problems with the DEC+J model of founder-event speciation and its comparison with DEC via model selection. J. Biogeogr. 2018, 45, 741–749. [Google Scholar] [CrossRef] [Scilit]
  116. Matzke, N.J. Statistical comparison of DEC and DEC+J is identical to comparison of two ClaSSE submodels, and is therefore valid. OSF Preprint 2021, 1–40. [Google Scholar] [CrossRef] [Scilit]
  117. Matzke, N.J. Probabilistic historical biogeography: New models for founder-event speciation, imperfect detection, and fossils allow improved accuracy and model-testing. Front. Biogeogr. 2013, 5, 242–248. [Google Scholar] [CrossRef] [Scilit]
  118. Matzke, N.J. Stochastic Mapping under Biogeographical Models. PhyloWiki BioGeoBEARS Website. 2016. Available online: http://phylo.wikidot.com/biogeobears#stochastic_mapping (accessed on 27 September 2021).
  119. Magalhaes, I.L.F.; Santos, A.J.; Ramírez, M.J. Incorporating topological and age uncertainty into event-based biogeography supports paleo-islands in Galapagos and ancient connections among Neotropical dry forests. Diversity 2021, 13, 418. [Google Scholar] [CrossRef] [Scilit]
  120. Shapiro, L.; Binford, G.J.; Agnarsson, I. Single-Island Endemism despite Repeated Dispersal in Caribbean Micrathena (Araneae: Araneidae): An Updated Phylogeographic Analysis. Diversity 2022, 14, 128. [Google Scholar] [CrossRef] [Scilit]
  121. Loureiro, L.O.; Engstrom, M.D.; Lim, B.K. Optimization of Genotype by Sequencing data for phylogenetic purposes. MethodsX 2020, 7, 100892. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  122. Hedges, S.B.; Woods, C.A. Caribbean hot spot. Nature 1993, 364, 375. [Google Scholar] [CrossRef] [Scilit]
  123. Woods, C.; Borroto, P.R.; Kilpatrick, C. Insular patterns and radiation of West Indian rodents. In Biogeography of the West Indies: Patterns and Perspectives; Woods, C.A., Sergile, F.E., Eds.; CRC Press: Boca Raton, FL, USA, 2001; pp. 333–351. [Google Scholar]
  124. Fabre, P.H.; Vilstrup, J.T.; Raghavan, M.; Der Sarkissian, C.; Willerslev, E.; Douzery, E.J.P.; Orlando, L. Rodents of the Caribbean: Origin and diversification of hutias unravelled by next-generation museomics. Biol. Lett. 2014, 10, 20140266. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. (A) Map of specimens collected for this work, including samples obtained from Genbank (Zhang and Maddison [69]). Area code used in the distribution ranges (A—Puerto Rico, B—Hispaniola, C—Cuba, D—Jamaica, E—North America, F—South America). (B) Schematic representations of the GAARlandia and Caribbean land areas available at certain time periods (Iturralde-Vinent [17], Iturralde-Vinent and MacPhee [32], MacPhee and Iturralde-Vinent [33]). Maps show simplified island positions in the respective time window used for the time-stratified analysis.
Figure 1. (A) Map of specimens collected for this work, including samples obtained from Genbank (Zhang and Maddison [69]). Area code used in the distribution ranges (A—Puerto Rico, B—Hispaniola, C—Cuba, D—Jamaica, E—North America, F—South America). (B) Schematic representations of the GAARlandia and Caribbean land areas available at certain time periods (Iturralde-Vinent [17], Iturralde-Vinent and MacPhee [32], MacPhee and Iturralde-Vinent [33]). Maps show simplified island positions in the respective time window used for the time-stratified analysis.
Diversity 14 00224 g001
Figure 2. AFgracilis group. (A,B) Antillattus cambridgei, male and female habitus. (C,D) Antillattus gracilis, male and female habitus. (E,F) Antillattus placidus, male and female habitus. Images by Wayne Maddison, released under a Creative Commons Attribution (CC–BY) 3.0 license.
Figure 2. AFgracilis group. (A,B) Antillattus cambridgei, male and female habitus. (C,D) Antillattus gracilis, male and female habitus. (E,F) Antillattus placidus, male and female habitus. Images by Wayne Maddison, released under a Creative Commons Attribution (CC–BY) 3.0 license.
Diversity 14 00224 g002
Figure 3. AFdarlingtoni group. (A,B) Antillattus applanatus, male and female habitus. (C,D) Antillattus darlingtoni, male and female habitus. (E,F) Antillattus maxillosus, male and female habitus. Images by Wayne Maddison, released under a Creative Commons Attribution (CC–BY) 3.0 license.
Figure 3. AFdarlingtoni group. (A,B) Antillattus applanatus, male and female habitus. (C,D) Antillattus darlingtoni, male and female habitus. (E,F) Antillattus maxillosus, male and female habitus. Images by Wayne Maddison, released under a Creative Commons Attribution (CC–BY) 3.0 license.
Diversity 14 00224 g003
Figure 4. Summary of (A) ML (Lnl = −24,214.785) and BI (Harmonic-means −24,208.96) with outgroups and (B) ML (Lnl = −13,533.817) and BI (Harmonic–means = −13,597.32) without outgroups, based on analyses on the molecular datasets (28S, 16S-ND1 and CO1). Individual Gene refers to support for a clade in the ML tree of individual genes.
Figure 4. Summary of (A) ML (Lnl = −24,214.785) and BI (Harmonic-means −24,208.96) with outgroups and (B) ML (Lnl = −13,533.817) and BI (Harmonic–means = −13,597.32) without outgroups, based on analyses on the molecular datasets (28S, 16S-ND1 and CO1). Individual Gene refers to support for a clade in the ML tree of individual genes.
Diversity 14 00224 g004
Figure 5. Beast divergence time estimations of all genes (CO1, 16S-ND1, 28S) using a Bayesian relaxed molecular clock (A) with outgroups and (B) without outgroups. The scale is in millions of years. Bars show 95% HPD [highest posterior density]. Stars indicate species groups within the genus Antillattus (blue star gracilis group, red star darlingtonia group, and green star keyserlingi group). Arrows indicate calibrated nodes.
Figure 5. Beast divergence time estimations of all genes (CO1, 16S-ND1, 28S) using a Bayesian relaxed molecular clock (A) with outgroups and (B) without outgroups. The scale is in millions of years. Bars show 95% HPD [highest posterior density]. Stars indicate species groups within the genus Antillattus (blue star gracilis group, red star darlingtonia group, and green star keyserlingi group). Arrows indicate calibrated nodes.
Diversity 14 00224 g005
Figure 6. BioGeoBEARS phylograms corresponding to the time-stratified DIVALIKE and DIVALIKE+J B2a model (Table 1). The trees show the most probable geographic range pre- and post-split. The scale is in millions of years.
Figure 6. BioGeoBEARS phylograms corresponding to the time-stratified DIVALIKE and DIVALIKE+J B2a model (Table 1). The trees show the most probable geographic range pre- and post-split. The scale is in millions of years.
Diversity 14 00224 g006
Figure 7. (A) Number of lineages occupying each area through time estimates under DIVALIKE and DIVALIKE +j and (B) the ancestral range. (A) Colored solid lines are the average of 100 biogeographic stochastic maps. Colored dashed lines are the 95% confidence interval. Gray dashed vertical line indicates the boundary between time slices in the time-stratified analysis. (B) Black arrows represent all dispersal events between areas. Red arrows represent a vicariance event between areas. Numbered circles indicate the inferred number of within-area speciation in each of the areas.
Figure 7. (A) Number of lineages occupying each area through time estimates under DIVALIKE and DIVALIKE +j and (B) the ancestral range. (A) Colored solid lines are the average of 100 biogeographic stochastic maps. Colored dashed lines are the 95% confidence interval. Gray dashed vertical line indicates the boundary between time slices in the time-stratified analysis. (B) Black arrows represent all dispersal events between areas. Red arrows represent a vicariance event between areas. Numbered circles indicate the inferred number of within-area speciation in each of the areas.
Diversity 14 00224 g007
Table 1. Taxon sample with specific collection information and Genbank accession numbers of the previous published sequence. Checkmark (√) refers sequence obtained from this study.
Table 1. Taxon sample with specific collection information and Genbank accession numbers of the previous published sequence. Checkmark (√) refers sequence obtained from this study.
SpeciesVoucherLocalityCO116S-ND128S
Agobardus anormalis montanusJXZ357DOMINICAN REPUBLIC: Pedernales, (N18.128, W71.558)KC615636KC615802KC615376
Agobardus bahorucoJXZ324DOMINICAN REPUBLIC: Pedernales, (N18.128, W71.558) KC615844KC615417
Agobardus cf. brevitarsusJXZ311DOMINICAN REPUBLIC: Pedernales, (N18.128, W71.558)KC615637KC615803KC615637
Agobardus cordiformisJXZ358DOMINICAN REPUBLIC: Pedernales, (N17.965, W71.635)KC615634KC615800KC615374
Agobardus gramineusJXZ314DOMINICAN REPUBLIC: Pedernales, (N17.965, W71.635)KC615635KC615801KC615375
Agobardus oviedoJXZ312DOMINICAN REPUBLIC: Pedernales, (N17.802, W71.349)KC615638KC615804KC615378
Antillattus [Cuba1]CU787945
CU00107A
CUBA: Granma, Bartolomé Maso, (N20.009, W76.894)
Antillattus [Cuba2]CU00025A
CU00086A
CU00090A
CU00004A
CU00016A
CUBA: Granma, Bartolomé Maso, (N20.013,W76.834)
Antillattus [Cuba3]CU787957
CU03506A
CUBA: Pinar del Rio, Viñales, (N22.657, W83.701)
Antillattus [Cuba4]CU00100A
CU03361A
CU03317A
CUBA: Guantánamo, Baracoa, (N20.331, W74.569)
Antillattus [Cuba4]CU03121ACUBA: Guantánamo, Nibujón, (N20.052, W76.502)
Antillattus cambridgeiJXZ321DOMINICAN REPUBLIC: La Vega, (N19.033, W70.543)KC615646KC615818KC615392
Antillattus cambridgeiDR784676
DR785410
DR785798
DR782454
DOMINICAN REPUBLIC: La Alta Gracia, (N19.067, W69.463)
Antillattus cambridgeiDR785494
DR782541
DOMINICAN REPUBLIC: La Alta Gracia, (N19.893, W71.653)
Antillattus cambridgeiDR782541
DR785783
DR785508
DOMINICAN REPUBLIC: La Alta Gracia, (N19.355, W070.111)
Antillattus cambridgeiDR782598DOMINICAN REPUBLIC: La Alta Gracia, (19.355N, W70.111)
Antillattus cambridgeiDR784852
DR785098
DR785696
DR785438
DR787296
DOMINICAN REPUBLIC: La Alta Gracia, (19.067, W69.463)
Antillattus cambridgeiDR787296
DR787293
DR787254
DR787223
DOMINICAN REPUBLIC: La Vega, (N19.036, W70.543)
Antillattus cambridgeiDR787328
DR787252
DR787285
DR787207
DR787327
DR787319
DR787324
DOMINICAN REPUBLIC: Santo Domingo, (19.051 N, W70.888)
Antillattus cambridgeiDR787105DOMINICAN REPUBLIC: San Juan, (N19.175, W71.049)
Antillattus cf. applanatusJXZ336DOMINICAN REPUBLIC: Barahona, Cachote (N18.101, W71.194)KC615699KC615911KC615699
Antillattus cubensisCU003076
CU002975
CU003097
CU003360
CU002456
CU003486
CU02560A
CU02975A
CU03033A
CU03076A
CU03097A
CU03360A
CUBA: Cienfuegos, Soledad, (N22.124, W80.325)
Antillattus cubensisCU03417A
CU03488A
CUBA: Santiago de Cuba, San Luis, (N20.179, W75.783)
Antillattus cubensisCU3075ACUBA: Santiago de Cuba, (N20.010, W76.037)
Antillattus cubensisCU02583ACUBA: Guantánamo, Baracoa, (N20.331, W74.569)
Antillattus cubensisCU787598
CU783280
CU787621
CU787283
CU787277
CUBA: Granma, Bartolomé Maso, (N20.009, W76.894)
Antillattus darlingtoniJXZ341DOMINICAN REPUBLIC: La Vega, Ébano Verde, (N19.033,W70.543)KC615762KC616005KC615583
Antillattus darlingtoniDR787120DOMINICAN REPUBLIC: San Juan, Pico Duarte
Antillattus darlingtoniDR786937
DR784873
DOMINICAN REPUBLIC: Valle nuevo
Antillattus darlingtoniDR784828
DR784873
DOMINICAN REPUBLIC: La Vega, Ébano Verde, (N19.026, W19.0264)
Antillattus gracilisJXZ320DOMINICAN REPUBLIC: La Vega, P.N.Armando Bermúdez, (N19.06, W70.86) KC615817KC615391
Antillattus gracilisDR782845
DR787278
DOMINICAN REPUBLIC: Santo Domingo, Los Tablones (N19.051, W70.888)
Antillattus keyserlingiCU03135ACUBA: Holguin, Frank Pais, (N20.529N, N75.768)
Antillattus keyserlingiCU02571ACUBA: Santiago de Cuba, Gran Piedra, (N20.011, W75.623)
Antillattus keyserlingiCU787312CUBA: Guantánamo, Baracoa, (20.331N, W74.569)
Antillattus keyserlingiCU00081A
CU00088A
CU02951A
CU02985A
CU03043A
CU782822
CU783187
CU783232
CU783245
CU783281
CU783404
CU783425
CU787302
CU787433
CU787625
CUBA: Granma, Bartolomé Maso, (N20.052, W76.502)
Antillattus keyserlingiCU02467A
CU03538A
CU03395A
CUBA: Holguin, Frank Pais,(N20.529, W75.768)
Antillattus keyserlingiCU03036A
CU03274A
CUBA: Granma, Bartolomé Maso, (N20.015–W76.839)
Antillattus maxillosusJXZ335DOMINICAN REPUBLIC: La Vega, road Constanza to Ocoa, Valle Nuevo (N18.700, W70.606)KC615708KC615935KC615510
Antillattus maxillosusDR786952
DR786992
DR786981
DOMINICAN REPUBLIC: Valle nuevo, Villa Pajón (N18.82208, W070.6838)
Antillattus [Cuba5]CU03373A
CU03396A
CU03539A
CU03534A
CUBA: Pinar del Rio, Viñales, (N22.653, W83.699)
Antillattus placidusDR787249DOMINICAN REPUBLIC: La Vega, Jarabacoa, (N19.036, W70.543)
Antillattus placidusDR782502
DR785683
DR785081
DOMINICAN REPUBLIC: La Alta Gracia, Yuma, (N19.355, W70.111)
Antillattus scutiformisJXZ326DOMINICAN REPUBLIC: La Vega, road Constanza to Ocoa, Valle Nuevo (N18.848, W70.720) KC615860KC615433
Bythocrotus cf. crypticusJXZ323DOMINICAN REPUBLIC: El Seibo, Pedro Sanchez, (N18.86, W69.11)KC615661KC615839KC615412
Bythocrotus crypticusJXZ322DOMINICAN REPUBLIC: Barahona, (N18.424, W71.112)KC615660KC615838KC615411
Cobanus cambridgeiJXZ122COSTA RICA: Prov. San José, (N9.65, W83.97) KC615872KC615445
Cobanus extensusJXZ122ECUADOR: Pichincha, near El Cisne, (N0.1493, W79.0317) KC615872KC615445
Cobanus mandibularisJXZ245PANAMA: Panamá: Gamboa, Pipeline Road, (N9.15840, W79.74252) KC615876KC615449
Cobanus unicolorJXZ244PANAMA: Chiriqui: Fortuna, Quebrada Samudio, (N8.73464, W82.24839) KC615878KC615451
Compsodecta festivaJAM4122AJAMAICA: Portland, Millbank, (N18.013, W76.379)
Compsodecta haytiensisJXZ325DOMINICAN REPUBLIC: Barahona, Highway 44 south of Barahona (N18.138, W71.070)KC615671KC615859KC615432
Compsodecta peckhamiJXZ327DOMINICAN REPUBLIC: Pedernales, Rio Mulito (N18.155, W71.758) KC615884KC615457
Corticattus guajatacaJXZ305PUERTO RICO: Isabela: Bosque de Guajataca (N18.421, W66.966)KC615715KC615945KC615521
Corticattus latusJXZ337DOMINICAN REPUBLIC: Pedernales: Laguna de Oviedo (N17.802 W71.349)KC615698KC615908KC615483
Mexigonus arizonenzisJXZ163USA: Arizona: Yavapai Co., Iron Springs (N34.58476, W112.57071)KC615747KC615988KC615564
Mexigonus cf. minutad117ECUADOR: Pichincha: Quito
Mexigonus morosusJXZ362USA: California: San Mate Co.,(N37.434, W122.311) KC615990KC615566
Pensacola signataJXZ371GUATEMALA: Depto. Petén, Reserva Natural Ixpanpajul KC616006KC615584
Petemathis portoricensisPR782206PUERTO RICO: Villalba: Toro negro, El Bolo Trail (N18.1777401, W66.488319)
Petemathis portoricensis [Adjuntas]JXZ306PUERTO RICO: Adjuntas, HWY143 to Cerro Punta (N18.167, W66.576)KC615716KC615946KC615522
Petemathis portoricensis [Maricao]JXZ303PUERTO RICO: Maricao, Bosque de Maricao (N18.150, W66.994)KC615711KC615940KC615515
Petemathis tetuaniJXZ303PUERTO RICO: Maricao, Bosque de Maricao (N18.150, W66.994)KC615711KC615940KC615515
Petemathis tetuaniPR782277PUERTO RICO: Villalba: Toro negro, El Bolo Trail, (N18.177, W66.488)
Petemathis tetuaniPR392859PUERTO RICO: Rio Grande, El Yunque, Mt. Britton, (N18.2957, W65.7906)
Popcornella furcataJXZ334DOMINICAN REPUBLIC: La Vega, Reserva Científica Ébano Verde, (N19.04, W70.518)KC615714KC615944KC615520
Popcornella spiniformisJXZ339DOMINICAN REPUBLIC: Barahona, Cachote (N18.098, W71.187) KC615914KC615489
Popcornella yunqueJXZ309PUERTO RICO: Río Grande, El Yunque Nat. Forest, (N18.3174, W65.8314) KC615937KC615512
Sidusa [French guiana1]JXZ128FRENCH GUIANA: Commune Règina, les Nourages Field Station (N4.069, W52.669)KC615770KC616015KC615593
Sidusa [French guiana2]JXZ100FRENCH GUIANA: Commune Règina, les Nourages Field Station, (N4.069, W52.669)KC615679KC615871KC615444
Truncattus [Cuba1]CU3492ACUBA: Granma, Bartolomé Maso, National Park Pico Turquino (N 20.0526, W76.502)
Truncattus [Cuba2]CU787947
CU03405A
CUBA: Granma, Bartolomé Maso, National Park Pico Turquino (N20.0526, W76.5029)
Truncattus [Cuba3]CU787949
CU00083A
CU03065A
CUBA: Granma, Bartolomé Maso, National Park Pico Turquino (N20.0526, W76.5029)
Truncattus [Cuba4]CU00014ACUBA: Granma, Bartolomé Maso, National Park Pico Turquino (N20.052, W76.502)
Truncattus [Dominican Republic1]DR787029DOMINICAN REPUBLIC: Valle nuevo, Villa Pajón, (N18.82208, W070.6838)
Truncattus cachotensisJXZ338DOMINICAN REPUBLIC: Barahona, Cachote, (N18.101, W71.194)KC615701KC615913KC615488
Truncattus dominicanusJXZ340DOMINICAN REPUBLIC: La Vega, P.N.Armando Bermúdez,(N19.06, W70.86)KC615703KC615920KC615495
Truncattus dominicanusDR787325DOMINICAN REPUBLIC: San Juan, Los tablones,(N19.0511, W70.888)
Truncattus flavusJXZ332DOMINICAN REPUBLIC: La Vega, P.N.Armando Bermúdez, (N19.06, W70.86)KC615707KC615933KC615508
Outgroups
Agobardus anormalis montanusJXZ357DOMINICAN REPUBLIC: Pedernales, (N18.128, W71.558)KC615636KC615802KC615376
Agobardus bahorucoJXZ324DOMINICAN REPUBLIC: Pedernales, (N18.128, W71.558) KC615844KC615417
Agobardus cf. brevitarsusJXZ311DOMINICAN REPUBLIC: Pedernales, (N18.128, W71.558)KC615637KC615803KC615637
Agobardus cordiformisJXZ358DOMINICAN REPUBLIC: Pedernales, (N17.965, W71.635)KC615634KC615800KC615374
Agobardus gramineusJXZ314DOMINICAN REPUBLIC: Pedernales, (N17.965, W71.635)KC615635KC615801KC615375
Agobardus oviedoJXZ312DOMINICAN REPUBLIC: Pedernales, (N17.802, W71.349)KC615638KC615804KC615378
Bythocrotus cf. crypticusJXZ323DOMINICAN REPUBLIC: El Seibo, Pedro Sanchez, (N18.86, W69.11)KC615661KC615839KC615412
Bythocrotus crypticusJXZ322DOMINICAN REPUBLIC: Barahona, (N18.424, W71.112)KC615660KC615838KC615411
Cobanus cambridgeiJXZ122COSTA RICA: Prov. San José, (N9.65, W83.97) KC615872KC615445
Cobanus extensusJXZ122ECUADOR: Pichincha, near El Cisne, (N0.1493, W79.0317) KC615872KC615445
Cobanus mandibularisJXZ245PANAMA: Panamá: Gamboa, Pipeline Road, (N9.15840, W79.74252) KC615876KC615449
Cobanus unicolorJXZ244PANAMA: Chiriqui: Fortuna, Quebrada Samudio, (N8.73464, W82.24839) KC615878KC615451
Compsodecta festivaJAM4122AJAMAICA: Portland, Millbank, (N18.013, W76.379)
Compsodecta haytiensisJXZ325DOMINICAN REPUBLIC: Barahona, Highway 44 south of Barahona (N18.138, W71.070)KC615671KC615859KC615432
Compsodecta peckhamiJXZ327DOMINICAN REPUBLIC: Pedernales, Rio Mulito (N18.155, W71.758) KC615884KC615457
Corticattus guajatacaJXZ305PUERTO RICO: Isabela: Bosque de Guajataca (N18.421, W66.966)KC615715KC615945KC615521
Corticattus latusJXZ337DOMINICAN REPUBLIC: Pedernales: Laguna de Oviedo (N17.802, W71.349)KC615698KC615908KC615483
Mexigonus arizonenzisJXZ163USA: Arizona: Yavapai Co., Iron Springs (N34.58476, W112.57071)KC615747KC615988KC615564
Mexigonus cf. minutad117ECUADOR: Pichincha: QuitoKC615748KC615989KC615565
Mexigonus morosusJXZ362USA: California: San Mate Co.,(N37.434, W122.311) KC615990KC615566
Pensacola signataJXZ371GUATEMALA: Depto. Petén, Reserva Natural Ixpanpajul KC616006KC615584
Popcornella furcataJXZ334DOMINICAN REPUBLIC: La Vega, Reserva Científica Ébano Verde, (N19.04, W70.518)KC615714KC615944KC615520
Popcornella spiniformisJXZ339DOMINICAN REPUBLIC: Barahona, Cachote (N18.098, W71.187) KC615914KC615489
Popcornella yunqueJXZ309PUERTO RICO: Río Grande, El Yunque Nat. Forest, (N18.3174, W65.8314) KC615937KC615512
Sidusa [French guiana1]JXZ128FRENCH GUIANA: Commune Règina, les Nourages Field Station (N4.069, W52.669)KC615770KC616015KC615593
Sidusa [French guiana2]JXZ100FRENCH GUIANA: Commune Règina, les Nourages Field Station, (N4.069, W52.669)KC615679KC615871KC615444
Ghelna canadensisd005USA: North Carolina (N35.704, W82.373)EF201651JQ312080KT462689
Table 2. Biogeographic specific scenarios analyzed in BioGeoBEARS for (a) Antillattus clade and outgroups and (b) Antillattus clade without outgroups. Each dispersal or vicariance scenario was tested using the six models available in BioGeoBEARS (DEC, DEC+J, DIVALIKE, DIVALIKE+J, BAYAREALIKE, BAYAREALIKE+J). Abbreviations: MO, Mona passage; WI, Windward passage.
Table 2. Biogeographic specific scenarios analyzed in BioGeoBEARS for (a) Antillattus clade and outgroups and (b) Antillattus clade without outgroups. Each dispersal or vicariance scenario was tested using the six models available in BioGeoBEARS (DEC, DEC+J, DIVALIKE, DIVALIKE+J, BAYAREALIKE, BAYAREALIKE+J). Abbreviations: MO, Mona passage; WI, Windward passage.
(1) Non-GAARlandia/(2) GAARlandia
A: Dispersal probability decreases as distance increasesB: Distance does not affect dispersal probabilityC: Probability of overwater dispersal is very low
(A) GA1A1a/A2aA1b/A2bA1c/A2c
(1) Non–land connections/(2) Land connections
A: Dispersal probability decreases as distance increasesB: Distance does not affect dispersal probabilityC: Probability of overwater dispersal is very low
(A) MOA1a/A2aA1b/A2bA1c/A2c
(B) MO+WIB1a/B2aB1b/B2bB1c/B2c
Table 3. BioGeoBEARS’ relative model probabilities for non-time-stratified analyses and time–stratified analyses corresponding to the most likelihood specific scenario A2a of the 12 specific scenarios tested for the non-GAARlandia and GAARlnadia hypotheses, and B2a of the 12 specific scenarios tested for the overwater dispersal and land connections prior to the Mona Passage and the Windward Passage hypotheses. The best performing model is marked with an asterisk for groups of analyses. LnL = log likelihood; n par = number of parameters in the analysis; d, e, j = parameters of the model (d = dispersal, e = extinction, j = founder event); AIC = Aikake information criterion; AICc = size–corrected AIC. * = Best-performing model for each groups of analyses.
Table 3. BioGeoBEARS’ relative model probabilities for non-time-stratified analyses and time–stratified analyses corresponding to the most likelihood specific scenario A2a of the 12 specific scenarios tested for the non-GAARlandia and GAARlnadia hypotheses, and B2a of the 12 specific scenarios tested for the overwater dispersal and land connections prior to the Mona Passage and the Windward Passage hypotheses. The best performing model is marked with an asterisk for groups of analyses. LnL = log likelihood; n par = number of parameters in the analysis; d, e, j = parameters of the model (d = dispersal, e = extinction, j = founder event); AIC = Aikake information criterion; AICc = size–corrected AIC. * = Best-performing model for each groups of analyses.
Time–Constrained/GAARlandia (A2a)
LnLn pardejAICAICc
DEC−43.84 *20.021<0.0001091.6992.01
DEC +J−33.87 *3<0.0001<0.00010.2273.7374.4
DIVALIKE−47.0520.035<0.0001098.198.43
DIVALIKE +J−3630.005<0.00010.2277.9978.66
BAYAREALIKE−60.8320.0210.0310125.7126
BAYAREALIKE +J−36.7330.0038<0.00010.2179.4580.12
Time–constrained/land connections prior to the Mona Passage and the Windward Passage (B2a)
DEC−25.120.033<0.0001054.1954.61
DEC +J−18.093<0.0001<0.00010.3142.1843.04
DIVALIKE−25.01 *20.048<0.0001054.0154.43
DIVALIKE +J−17.62 *3<0.0001<0.00010.2941.2542.1
BAYAREALIKE−34.222<0.00010.041072.4472.86
BAYAREALIKE +J−18.83<0.0001<0.00010.2743.6144.46
Table 4. Summary count of time-constrained Biogeographic Stochastic Mappings. DIVALIKE and DIVALIKE +j. Abbreviations: j, jump dispersal or founder-event speciation; a, range-switching dispersal; d, range-expansion dispersal; e, extinction; s, sympatric-subset speciation; v, vicariance; y, within-area speciation; Ÿd, allopatric dispersal; Ad, anagenetic dispersal; Ÿa: allopatric anagenetic; Ÿc: allopatric cladogenetic; sums, adds up all of the events across the stochastic maps.
Table 4. Summary count of time-constrained Biogeographic Stochastic Mappings. DIVALIKE and DIVALIKE +j. Abbreviations: j, jump dispersal or founder-event speciation; a, range-switching dispersal; d, range-expansion dispersal; e, extinction; s, sympatric-subset speciation; v, vicariance; y, within-area speciation; Ÿd, allopatric dispersal; Ad, anagenetic dispersal; Ÿa: allopatric anagenetic; Ÿc: allopatric cladogenetic; sums, adds up all of the events across the stochastic maps.
DIVALIKE
jadesvyŸdAdŸaŸcTotal events
means005.5006.6124.395.55.55.53136.5
stdevs000.64000.670.670.640.640.6400.64
sums0055000661243955055055031003650
DIVALIKE+j
jadesvyŸdAdŸaŸcTotal events
means6.6300000.8223.556.63003131
stdevs1.0400000.640.941.040000
sums66300008223556630031003100
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Cala-Riquelme, F.; Wiencek, P.; Florez-Daza, E.; Binford, G.J.; Agnarsson, I. Island–to–Island Vicariance, Founder–Events and within–Area Speciation: The Biogeographic History of the Antillattus Clade (Salticidae: Euophryini). Diversity 2022, 14, 224. https://doi.org/10.3390/d14030224

AMA Style

Cala-Riquelme F, Wiencek P, Florez-Daza E, Binford GJ, Agnarsson I. Island–to–Island Vicariance, Founder–Events and within–Area Speciation: The Biogeographic History of the Antillattus Clade (Salticidae: Euophryini). Diversity. 2022; 14(3):224. https://doi.org/10.3390/d14030224

Chicago/Turabian Style

Cala-Riquelme, Franklyn, Patrick Wiencek, Eduardo Florez-Daza, Greta J. Binford, and Ingi Agnarsson. 2022. "Island–to–Island Vicariance, Founder–Events and within–Area Speciation: The Biogeographic History of the Antillattus Clade (Salticidae: Euophryini)" Diversity 14, no. 3: 224. https://doi.org/10.3390/d14030224

APA Style

Cala-Riquelme, F., Wiencek, P., Florez-Daza, E., Binford, G. J., & Agnarsson, I. (2022). Island–to–Island Vicariance, Founder–Events and within–Area Speciation: The Biogeographic History of the Antillattus Clade (Salticidae: Euophryini). Diversity, 14(3), 224. https://doi.org/10.3390/d14030224

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop