Genetic Variability of the Mating Recognition Gene in Populations of Brachionus plicatilis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Area, Rotifer Collection and Maintenance
2.2. Design of mmr-b Specific Primers, Amplification and Sequencing
2.3. Microsatellite Genotyping
2.4. Data Analysis
3. Results
3.1. Nucleotide and Amino Acid Diversity of mmr-b Gene
3.2. Network and Geographic Distribution of Nucleotide Haplotypes
3.3. Patterns of Population Differentiation in mmr-b
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Coyne, J.A.; Orr, H.A. Speciation; Sinauer Associates: Sunderland, MA, USA, 2004; pp. 55–82. ISBN 9780878930913. [Google Scholar]
- Snell, T.W.; Morris, P.D. Sexual communication in copepods and rotifers. Hydrobiologia 1993, 255–256, 109–116. [Google Scholar] [CrossRef]
- Rosenthal, G.G. Mate Choice: The Evolution of Sexual Decision Making from Microbes to Humans; Princeton University Press: Princeton, NJ, USA, 2017; pp. 1–648. ISBN 9780691150673. [Google Scholar]
- Lambert, D.M.; Kingett, P.D.; Slooten, E. Intersexual selection: The problem and a discussion of the evidence. Evol. Theory 1982, 6, 67–78. [Google Scholar]
- Brooks, R.; Hunt, J.; Blows, M.W.; Smith, M.J.; Bussière, L.F.; Jennions, M.D. Experimental evidence for multivariate stabilizing sexual selection. Evolution 2005, 59, 871–880. [Google Scholar] [CrossRef] [PubMed]
- Butlin, R.K.; Hewitt, G.M.; Webb, S.F. Sexual selection for intermediate optimum in Chorthippus brunneus (Orthoptera: Acrididae). Anim. Behav. 1985, 33, 1281. [Google Scholar] [CrossRef]
- Swanson, W.J.; Vacquier, V.D. The rapid evolution of reproductive proteins. Nat. Rev. Genet. 2002, 3, 137–144. [Google Scholar] [CrossRef] [PubMed]
- Wilburn, D.B.; Swanson, W.J. From molecules to mating: Rapid evolution and biochemical studies of reproductive proteins. J. Proteomics 2016, 135, 12–25. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Porter, C.K.; Smith, J.W. Diversification in trophic morphology and a mating signal are coupled in the early stages of sympatric divergence in crossbills. Biol. J. Linn. Soc. 2020, 129, 74–87. [Google Scholar] [CrossRef]
- Civetta, A.; Singh, R.S. High divergence of reproductive tract proteins and their association with postzygotic reproductive isolation in Drosophila melanogaster and Drosophila virilis group species. J. Mol. Evol. 1995, 41, 1085–1095. [Google Scholar] [CrossRef]
- Martin, S.H.; Wingfield, B.D.; Wingfield, M.J.; Steenkamp, E.T. Causes and consequences of variability in peptide mating pheromones of ascomycete fungi. Mol. Biol. Evol. 2011, 28, 1987–2003. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Blows, M.W.; Higgie, M. Evolutionary Experiments on Mate Recognition in the Drosophila Serrata Species Complex. Genetica 2002, 116, 239–250. [Google Scholar] [CrossRef] [PubMed]
- De Meester, L.; Gomez, A.; Okamura, B.; Schwenk, K. The Monopolization Hypothesis and the dispersal-gene flow paradox in aquatic organisms. Acta Oecologica 2002, 23, 121–135. [Google Scholar] [CrossRef]
- Campillo, S.; Serra, M.; Carmona, M.J.; Gomez, A. Widespread secondary contact and new glacial refugia in the halophilic rotifer Brachionus plicatilis in the Iberian Peninsula. PLoS ONE 2011, 6, e20986. [Google Scholar] [CrossRef] [Green Version]
- Gomez, A.; Adcock, G.J.; Lunt, D.H.; Carvalho, G.R. The interplay between colonization history and gene flow in passively dispersing zooplankton: Microsatellite analysis of rotifer resting egg banks. J. Evol. Biol. 2002, 15, 158–171. [Google Scholar] [CrossRef]
- Montero-Pau, J.; Serra, M.; Gomez, A. Diapausing egg banks, lake size, and genetic diversity in the rotifer Brachionus plicatilis Müller (Rotifera, Monogononta). Hydrobiologia 2017, 796, 77–91. [Google Scholar] [CrossRef] [Green Version]
- Franch-Gras, L.; García-Roger, E.M.; Franch, B.; Carmona, M.J.; Serra, M. Quantifying unpredictability: A multiple-model approach based on satellite imagery data from Mediterranean ponds. PLoS ONE 2017, 12, e0187958. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Franch-Gras, L.; García-Roger, E.M.; Serra, M.; José Carmona, M. Adaptation in response to environmental unpredictability. Proc. R. Soc. B Biol. Sci. 2017, 284, 20170427. [Google Scholar] [CrossRef] [PubMed]
- Jezkova, I.; Ortells, R.; Montero-Pau, J.; Serra, M. Insight into incipient reproductive isolation in diverging populations of a rotifer Brachionus plicatilis. Hydrobiologia, 2022; submitted. [Google Scholar]
- Snell, T.W.; Rico-Martinez, R.; Kelly, L.N.; Battle, T.E. Identification of a sex pheromone from a rotifer. Mar. Biol. 1995, 123, 347–353. [Google Scholar] [CrossRef]
- Snell, T.W. A review of the molecular mechanisms of monogonont rotifer reproduction. Hydrobiologia 2011, 662, 89–97. [Google Scholar] [CrossRef]
- Gribble, K.E.; Welch, D.B.M. The mate recognition protein gene mediates reproductive isolation and speciation in the Brachionus plicatilis cryptic species complex. BMC Evol. Biol. 2012, 12, 134–151. [Google Scholar] [CrossRef] [Green Version]
- Snell, T.W.; Stelzer, C.P. Removal of surface glycoproteins and transfer among Brachionus species. Hydrobiologia 2005, 546, 267–274. [Google Scholar] [CrossRef]
- Gribble, K.E.; Snell, T.W.; Welch, D.B.M. Gene and protein structure of the mate recognition protein gene family in Brachionus manjavacas (Rotifera). Hydrobiologia 2011, 662, 35–42. [Google Scholar] [CrossRef]
- Gomez, A.; Carvalho, G.R.; Lunt, D.H. Phylogeography and regional endemism of a passively dispersing zooplankter: Mitochondrial DNA variation in rotifer resting egg banks. Proc. R. Soc. B Biol. Sci. 2000, 267, 2189–2197. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Colwell, R.K. Predictability, Constancy, and Contingency of Periodic Phenomena. Ecology 1974, 55, 1148–1153. [Google Scholar] [CrossRef]
- Gomez, A.; Carvalho, G.R. Sex, parthenogenesis and genetic structure of rotifers: Microsatellite analysis of contemporary and resting egg bank populations. Mol. Ecol. 2000, 9, 203–214. [Google Scholar] [CrossRef] [PubMed]
- Gomez, A.; Serra, M.; Carvalho, G.R.; Lunt, D.H. Speciation in ancient cryptic species complexes: Evidence from the molecular phylogeny of Brachionus plicatilis (rotifera). Evolution. 2002, 56, 1431–1444. [Google Scholar] [CrossRef]
- Suatoni, E.; Vicario, S.; Rice, S.; Snell, T.; Caccone, A. An analysis of species boundaries and biogeographic patterns in a cryptic species complex: The rotifer-Brachionus plicatilis. Mol. Phylogenet. Evol. 2006, 41, 86–98. [Google Scholar] [CrossRef] [PubMed]
- Campillo, S.; García-Roger, E.M.; Martínez-Torres, D.; Serra, M. Morphological stasis of two species belonging to the L-morphotype in the Brachionus plicatilis species complex. Hydrobiologia 2005, 546, 181–187. [Google Scholar] [CrossRef]
- Tortajada, A.M.; Carmona, M.J.; Serra, M. Effects of population outcrossing on rotifer fitness. BMC Evol. Biol. 2010, 10, 312. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guillard, R.R.; Ryther, J.H. Studies of marine planktonic diatoms. I. Cyclotella nana Hustedt, and Detonula confervacea (cleve) Gran. Can. J. Microbiol. 1962, 8, 229–239. [Google Scholar] [CrossRef] [PubMed]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bell, J.R. A simple way to treat PCR products prior to sequencing using ExoSAP-IT®. Biotechniques 2008, 44, 834. [Google Scholar] [CrossRef]
- Bonfield, J.K.; Smith, K.F.; Staden, R. A new DNA sequence assembly program. Nucleic Acids Res. 1995, 23, 4992. [Google Scholar] [CrossRef] [Green Version]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Montero-Pau, J.; Gomez, A.; Muñoz, J. Application of an inexpensive and high-throughput genomic DNA extraction method for the molecular ecology of zooplanktonic diapausing eggs. Limnol. Oceanogr. Methods 2008, 6, 218–222. [Google Scholar] [CrossRef] [Green Version]
- Gomez, A.; Clabby, C.; Carvalho, G. Isolation and characterization of microsatellite loci in a cyclically parthenogenetic rotifer. Brachionus Plicatilis Mol. 1998, 7, 1613–1621. [Google Scholar]
- Excoffier, L.; Lischer, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef] [PubMed]
- Trifinopoulos, J.; Nguyen, L.T.; von Haeseler, A.; Minh, B.Q. W-IQ-TREE: A fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res. 2016, 44, W232–W235. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Leigh, J.W.; Bryant, D. POPART: Full-feature software for haplotype network construction. Methods Ecol. Evol. 2015, 6, 1110–1116. [Google Scholar] [CrossRef]
- Notredame, C.; Higgins, D.G.; Heringa, J. T-Coffee: A novel method for fast and accurate multiple sequence alignment. J. Mol. Biol. 2000, 302, 205–217. [Google Scholar] [CrossRef] [Green Version]
- Nguyen, L.T.; Schmidt, H.A.; Von Haeseler, A.; Minh, B.Q. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [PubMed]
- Hoang, D.T.; Chernomor, O.; Von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Mol. Biol. Evol. 2018, 35, 518–522. [Google Scholar] [CrossRef] [PubMed]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; Von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dray, S.; Dufour, A.B. The ade4 Package: Implementing the Duality Diagram for Ecologists. J. Stat. Softw. 2007, 22, 1–20. [Google Scholar] [CrossRef] [Green Version]
- Snell, T.W.; Kubanek, J.; Carter, W.; Payne, A.B.; Kim, J.; Hicks, M.K.; Stelzer, C.P. A protein signal triggers sexual reproduction in Brachionus plicatilis (Rotifera). Mar. Biol. 2006, 149, 763–773. [Google Scholar] [CrossRef]
- Butlin, R. Speciation by reinforcement. Trends Ecol. Evol. 1987, 2, 8–13. [Google Scholar] [CrossRef]
- Symonds, M.R.E.; Elgar, M.A. The evolution of pheromone diversity. Trends Ecol. Evol. 2008, 23, 220–228. [Google Scholar] [CrossRef]
- Hall, M.C.; Willis, J.H. Divergent selection on flowering time contributes to local adaptation in Mimulus guttatus populations. Evolution 2006, 60, 2466–2477. [Google Scholar] [CrossRef]
- Aspinwall, N. Genetic analysis of north american populations of the pink salmon, Oncorhynchus gorbuscha, possible evidence for the neutral mutation-random drift hypothesis. Evolution 1974, 28, 295–305. [Google Scholar] [CrossRef] [PubMed]
- Papakostas, S.; Michaloudi, E.; Triantafyllidis, A.; Kappas, I.; Abatzopoulos, T.J. Allochronic divergence and clonal succession: Two microevolutionary processes sculpturing population structure of Brachionus rotifers. Hydrobiologia 2012, 700, 33–45. [Google Scholar] [CrossRef]
- Linn, C.E.; Dambroski, H.R.; Feder, J.L.; Berlocher, S.H.; Nojima, S.; Roelofs, W.L. Postzygotic isolating factor in sympatric speciation in Rhagoletis flies: Reduced response of hybrids to parental host-fruit odors. Proc. Natl. Acad. Sci. USA 2004, 101, 17753–17758. [Google Scholar] [CrossRef] [Green Version]
- Jankowski, T.; Straile, D. Allochronic differentiation among Daphnia species, hybrids and backcrosses: The importance of sexual reproduction for population dynamics and genetic architecture. J. Evol. Biol. 2004, 17, 312–321. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Titelman, J.; Varpe, Ø.; Eliassen, S.; Fiksen, Ø. Copepod mating: Chance or choice? J. Plankton Res. 2007, 29, 1023–1030. [Google Scholar] [CrossRef]
- Snell, T. Contact chemoreception and its role in zooplankton mate recognition. In Chemical Communication in Crustaceans; Springer: New York, NY, USA, 2011; pp. 451–466. ISBN 9780387771014. [Google Scholar]
- Montero-Pau, J.; Gomez, A.; Serra, M. Founder effects drive the genetic structure of passively dispersed aquatic invertebrates. PeerJ 2018, 2018, e6094. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Population | Acronym | Location 1 | Pond size (m2) | Predictabillity 2 |
---|---|---|---|---|
Atalaya de los Ojicos | AYA | 38°46’20” N, 1°25’49” W | 75,000 | 0.75 |
La Campana | CAM | 38°51’29” N, 1°29’36” W | 29,000 | 0.11 |
Hoya Yerba | HYB | 38°46’46” N, 1°26’06” W | 1060 | 0.34 |
Hoya Chica | HYC | 38°49’46” N, 1°27’49” W | 32,000 | 0.12 |
Hoya del Monte | MNT | 38°50’44” N, 1°26’38” W | 15,800 | 0.19 |
Pétrola | PET | 38°50’16” N, 1°33’49” W | 1,190,000 | 1.00 |
Hoya Rasa | RAS | 38°47’06” N, 1°25’37” W | 40,000 | 0.66 |
Salobralejo | SAL | 38°54’52” N, 1°28’06” W | 237,000 | 1.00 |
Hoya Turnera | TUR | 38°46’36” N, 1°24’37” W | 26,000 | 0.70 |
Chiprana | CHI | 41°14’20” N, 0°11’02” W | 230,000 | nd |
Torreblanca Norte | TON | 40°08’54” N, 0°10’07” E | 120 | nd |
Code | Forward | Reverse |
---|---|---|
mmr-b1 | CAAGCCGATTCCCATTAAAGCA | AAACCAATAAACAAAAACTAATCCTGG |
mmr-b2 | GCCTTTTCAGTACCAGTGAAGC | ACAAATAAACAAAAATTTAACCCTGGA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jezkova, I.; Serra, M.; Ortells, R.; Montero, J. Genetic Variability of the Mating Recognition Gene in Populations of Brachionus plicatilis. Diversity 2022, 14, 155. https://doi.org/10.3390/d14030155
Jezkova I, Serra M, Ortells R, Montero J. Genetic Variability of the Mating Recognition Gene in Populations of Brachionus plicatilis. Diversity. 2022; 14(3):155. https://doi.org/10.3390/d14030155
Chicago/Turabian StyleJezkova, Ivana, Manuel Serra, Raquel Ortells, and Javier Montero. 2022. "Genetic Variability of the Mating Recognition Gene in Populations of Brachionus plicatilis" Diversity 14, no. 3: 155. https://doi.org/10.3390/d14030155