Effects of Microplastics on the Central Reproductive Neuroendocrine System in a Sheep Model

Abstract

The present study investigated the impact of microplastics, specifically polystyrene microparticles (PS-MP), on the hypothalamic-pituitary-gonadal (HPG) neurohormonal axis, which regulates reproductive functions in animals and humans. The primary objective was to examine the effects of PS-MP on the expression of key genes and hormone concentrations within the gonadotropic system of sheep. Two doses of PS-MP—the lower dose (LD; 0.015 mg/kg) and the higher dose (HD; 0.15 mg/kg)—were administered intravenously every three days over two estrous cycles (34 days). Both doses significantly decreased the relative abundance of gonadotropin-releasing hormone (GnRH) transcripts in the mediobasal hypothalamus (MBH), whereas only the HD reduced GnRH mRNA levels in the preoptic area (POA). These transcript-level changes were not accompanied by detectable alterations in GnRH protein concentration. In the MBH, the expression of kisspeptin (KISS-1) and neurokinin B (NKB) genes decreased following exposure to the HD, whereas in the POA, significant decrease in expression were observed only after the LD administration. Changes in prodynorphin (PDYN) gene expression were confined to the MBH and were dose-dependent: the LD increased transcript levels, whereas the HD caused a decrease. The HD of PS-MP also significantly downregulated GnRH receptor (GnRHR) expression in the anterior pituitary (AP). Both PS-MP doses resulted in marked reductions in luteinizing hormone beta (LHβ) and follicle-stimulating hormone beta (FSHβ) subunit gene expression in the AP, without significant changes in hormone protein concentrations. Exposure to PS-MP reduced plasma LH and FSH concentrations: the lower dose reduced both hormones, while the higher dose significantly reduced mainly FSH, showing statistical differences between doses. To summarize, the present study demonstrates that PS-MP exerts a modulatory effect on the secretory activity of the central reproductive system in sheep, at both the hypothalamic and pituitary levels. Consequently, PS-MP has the potential to induce significant disruptions to the reproductive processes of large farm animals.

1. Introduction

Plastics constitute a diverse group of synthetic and semi-synthetic materials with wide-ranging applications in the economy and everyday human life. In 2020, global consumption of plastics reached 367 million tons. Given the growing global population and the pervasive use of plastics across multiple sectors, it is projected that production will triple relative to current levels by 2050 [1]. Plastic waste has become a pressing global concern, as its mismanagement exerts deleterious effects on the natural environment. Among such waste, microplastic (MP) particles—defined as particles smaller than 5 mm in diameter—are particularly noteworthy. Owing to their small size and remarkable environmental persistence, these particles can infiltrate cellular structures, accumulate within tissues, and disrupt fundamental biological processes [2,3]. The existing literature has primarily focused on the occurrence and accumulation of microplastics in both aquatic and terrestrial environments [4]. MPs have been detected in a wide range of environmental and dietary sources, including seafood, drinking water (bottled and tap), beer, table salt, honey, tea, milk, canned food, personal care products such as face creams, body lotions, lipsticks, and toothpaste, as well as food packaging materials and even in airborne particles [5,6]. Microplastics have also been identified in various internal organs, including the intestines, liver, lungs, kidneys, and brain. Their presence has been associated with diverse physiological disturbances, such as alterations in energy balance, inflammatory responses, neurotoxicity, immune dysregulation, metabolic disorders, and genotoxic effects [7].

Polystyrene microplastics (PS-MPs) are widely used polymer materials that have become particularly prevalent in the food industry. This material exhibits several advantageous properties, including low weight, ease of processing and transportation, and resistance to external factors. Despite its extensive industrial use and potential implications for human health, the full extent of its effects on human and animal health has yet to be fully elucidated [8]. Beyond acknowledging the general harmful effects of microplastics on humans and animals, a critical challenge remains in understanding the mechanisms by which these particles exert their effects at the molecular and cellular levels, particularly within complex hormonal systems that regulate reproductive functions [9]. Of particular concern are data indicating the potentially harmful effects of PS-MPs on the female reproductive system. A substantial body of experimental research using animal models has demonstrated that exposure to polystyrene leads to the accumulation of these particles in the ovaries. Such exposure has been shown to disrupt the estrous cycle, reduce sex hormone levels, impair embryo implantation, and induce structural damage to oocytes and granulosa cells [10,11]. Deterioration in gamete quality and reduced fertility are further accompanied by an increased number of atretic follicles, alterations in mitochondrial morphology, and enhanced apoptotic activity [12].

It is important to acknowledge that the majority of available scientific evidence regarding the adverse effects of microplastics on reproductive function originates from in vivo studies conducted in rodents and primarily focuses on peripheral tissues [11,13]. In contrast, data from large mammals and humans remain limited, although preliminary observations are increasingly concerning. Microplastics have been detected in alveolar fluid, amniotic fluid, and placental tissue [14]. Nevertheless, the long-lasting consequences of MP exposure on female reproductive health—particularly with respect to the central nervous system—remain largely unknown. Therefore, the objective of the present study was to employ female sheep as a large-animal model to investigate the effects of PS-MPs on the reproductive neuroendocrine system, specifically at the hypothalamic and pituitary levels.

2. Results

2.1. GnRH Expression in the Hypothalamus

The relative abundance of the GnRH gene transcript and GnRH concentration in the MBH and POA in individual groups of sheep are shown in Figure 1. Both the lower and higher PS-MP doses decreased (p < 0.05 and p < 0.001, respectively) the relative abundance of GnRH transcript in the MBH in comparison with the control group (Figure 1A). In contrast, no significant differences were found between the groups in terms of GnRH protein concentration in the MBH (Figure 1B). However, noteworthy is a tendency for GnRH levels to increase in the LD group, while a downward trend is observed in the HD group, compared to the control group. In the case of the POA, a decrease (p < 0.05) in GnRH transcript levels was observed after exposure to a higher dose of PS-MP compared to the control and LD (Figure 2C). No significant differences in GnRH protein concentration in the POA were found between the control and experimental groups (Figure 2D).

2.2. KNDy Neuropeptides mRNA Expression in the Hypothalamus

The relative abundances of KISS-1, NKB, and PDYN mRNA in the MBH and POA of sheep representing all treatment groups are shown in Figure 2. Overall, exposure of sheep to PS-MP downregulated KISS-1 transcript levels in the selected areas of the hypothalamus. Specifically, a significant decrease was observed in the MBH in response to the PS-MP higher dose (p < 0.001, Figure 2A) and in the POA after exposure to the PS-MP lower dose (p < 0.05, Figure 2B). For NKB mRNA, the results obtained were similar to those observed for KISS-1, showing a significant decrease in NKB transcript levels in the MBH in response to the PS-MP higher dose (p < 0.05, Figure 2C) and in the POA in response to the PS-MP lower dose (p < 0.01, Figure 2D). The significant alterations in PDYN transcript levels were exclusively found in the MBH. The lower dose of PS-MP caused an increase (p < 0.05) in PDYN transcript levels compared to controls (Figure 2E), while the higher dose of PS-MP resulted in the pronounced decrease compared to the control (p < 0.05) and lower dose (p < 0.001) groups. No significant differences in PDYN gene expression were found in the POA (Figure 2F).

2.3. GnRH Receptor Expression in the Anterior Pituitary

The relative abundance of GnRHR mRNA in the anterior pituitary (AP) of sheep from all treatment groups is shown in Figure 3. Exposure to the higher dose of PS-MP led to a significant downregulation of GnRHR transcript expression, compared to the control (p < 0.05) and LD (p < 0.01) groups, while the effect of the lower-dose was not significant.

2.4. LH and FSH mRNA Expression and Hormone Concentrations in the Anterior Pituitary

The relative abundances of LHβ and FSHβ subunits mRNA and protein levels in the AP of sheep from all treatment groups are shown in Figure 4. Exposure to the lower and higher dose of PS-MP resulted in a significant decrease (p < 0.05 and p < 0.001, respectively) in the expression of LHβ subunit gene compared to the control group (Figure 4A). No significant changes were observed in the LH protein concentration in the AP (Figure 4B). In the case of the FSHβ subunit mRNA, the exposure to the higher dose of PS-MP resulted in a significant decrease (p < 0.001) in the expression compared to the control group (Figure 4C). No significant changes in FSH protein concentration were observed in the AP (Figure 4D).

2.5. Plasma LH and FSH Concentrations

The mean plasma concentrations of LH and FSH in sheep are shown in Figure 5. Exposure of sheep to the lower dose of PS-MP resulted in a decrease in the concentrations of both gonadotropins (p < 0.001 for LH and p < 0.01 for FSH) compared to the control group. The higher dose of PS-MP also caused a decrease in FSH concentration (p < 0.05). Statistical differences were also found between the lower and higher dose of PS-MP in terms of LH and FSH concentrations (p < 0.001 and p < 0.05, respectively).

3. Discussion

The hypothalamic-pituitary GnRH-LH/FSH axis plays a pivotal role in regulating reproductive processes by controlling the synthesis and secretion of gonadotropins and sex hormones. Disruption of this axis can result in reduced fertility, abnormal gonadal development, and changes in reproductive behavior [15,16]. Currently, a mounting body of experimental and observational studies suggests that microplastics—in their solid form and as carriers of chemical additives—may interfere with reproductive processes at multiple levels of hormonal regulation [17].

The hypothalamus serves as the principal neuroendocrine mediator by integrating neural signals from the central nervous system with the hormonal regulation of peripheral endocrine glands to maintain systemic homeostasis. It translates synaptic inputs reflecting internal states into the synthesis and pulsatile release of releasing and inhibiting hormones into the hypophyseal portal circulation, which precisely controls AP secretory functions [18]. Despite limited knowledge about the harmful effects of microplastics on the hypothalamus, evidence points to disturbances in the neuroendocrine function of the hypothalamic-pituitary axis in mammals [19]. In this context, the present findings indicate that microplastic exposure may influence GnRH regulation at the transcriptional level within key hypothalamic regions, including the MBH and the POA. The observed dose-depended reduction in GnRH gene expression in the MBH may suggest a heightened sensitivity of this region to microplastic exposure. Conversely, the response only to a higher dose in the POA suggests specific region-related differences in susceptibility, potentially reflecting distinct regulatory mechanisms of GnRH synthesis in these hypothalamic nuclei. As demonstrated by Weems et al. [20] and Lehman et al. [21], GnRH neurons in ovine brains are distinguished by a range of morphologies, frequently exhibiting complex multipolar structures. Immunohistochemical studies have confirmed that the majority of GnRH neuron cell bodies are located in the POA of the hypothalamus. Another significant population of GnRH cells is present in the MBH, particularly around the arcuate nucleus and median eminence—areas directly involved in GnRH neurosecretion into the pituitary portal system [20,21]. In mouse models, it has been demonstrated that microplastic accumulation in the brain can occur as a consequence of exposure through food or water. Furthermore, molecules of microplastics measuring 0.1–10 µm can penetrate biological membranes, including the blood–brain barrier and even the placenta, thereby increasing their potential for bioaccumulation in secondary tissues such as the liver and brain [22]. It is worth noting that the size of the PS-MP used in the present study (2 µm) was specially selected to facilitate the administered molecules to penetrate the sheep’s brain. Therefore, the observed changes in GnRH gene expression may suggest that the administered PS-MP crosses the blood–brain barrier; however, its site and mechanism of action remains unclear. Interestingly, the results of the immunohistochemistry staining showed a significant increase in hypothalamic GnRH protein in the polyethylene (PE)-exposed group of murine [23]. Furthermore, an augmented expression of IBA-1, GFAP, and c-FOS was observed in the hypothalamus, suggesting the activation of microglia, astrocytes, and neurons, respectively [23]. Clinical analysis of girls with precocious puberty revealed elevated serum MP concentrations and concomitant significant hypothalamic GnRH release, which triggers activation of the hypothalamic-pituitary-gonadal axis and accelerates pubertal development following dietary exposure [23].

The present study also investigated the hypothalamic mechanism regulating the synthesis and release of GnRH, involving neuropeptides such as KISS-1, NKB, and PDYN—collectively termed the KNDy system [24,25,26]. These neuropeptides are synthesized by neurons, which are located primarily in the arcuate nucleus (forming part of the MBH) and in the POA, integrating steroid and metabolic signals, thereby regulating GnRH pulsatility and, consequently, gonadotropin release from the pituitary gland. This process is critical for the normal sexual development, reproductive cycle, and fertility in mammals. KISS-1 has been shown to stimulate GnRH secretion via the KISS-1/GPR54 receptor. Neurokinin B (NKB) and dynorphin have been demonstrated to modulate the frequency and amplitude of GnRH pulses through autocrine and paracrine regulation of KNDy neurons within the arcuate nucleus. It has been established through seminal studies in sheep that NKB acts as a stimulatory signal, whereas dynorphin provides inhibitory feedback within the KNDy neuronal network. Collectively, these elements constitute the core of the GnRH pulse generator during both pubertal maturation and adulthood [21,24,25]. The results of the present study showed that the higher dose of PS-MP caused a decrease in the expression of KISS-1, NKB, and PDYN genes in the MBH. Concurrently, in the POA, a lower dose of PS-MP significantly reduced the expression of KISS-1 and NKB, while no other significant changes were observed. In the other earlier study, the presence of microplastics has been shown to reduce the level of KISS-1 in the hypothalamus of zebrafish [27]. Laboratory studies in mice demonstrated that PS-MP, administered at a dose of 10 mg/kg (PS-MP 10), resulted in a decrease in both plasma and hypothalamic KISS-1 content in the PS-MP10 group, exhibiting a significant difference compared to the control group. Additionally, GPR54 content in the hypothalamus and testicular tissue was found to be lowest in the PS-MP10 group. These findings underscore the significant disruption of the hypothalamic–pituitary–gonadal axis at its basal regulatory levels by PS-MP exposure [28]. On the contrary, in murine models, bisphenol A (BPA) has been observed to cause an increase in the number of KISS-1 neurons within the anterior periventricular nucleus in male offspring and to elevate the number of KISS-1 cells in the periventricular area of the third ventricle in female offspring. The phenomenon under discussion was found to be associated with impaired pulsatile secretion of GnRH and gonadotropins [29]. Our results also demonstrated that NKB mRNA expression in the MBH decreased in sheep with increasing PS-MP dose, which was analogous to previously observed changes in KISS-1 expression. A similar effect with higher efficacy at the lower dose was observed in the POA. In the case of PDYN, interesting changes in mRNA levels occurred exclusively in the MBH: the lower dose of PS-MP increased PDYN expression, whereas the higher dose decreased it. The increased PDYN expression in the MBH in response to the lower dose of microplastics may cause GnRH accumulation in neurons, which in turn may induce different reproductive disorders. At higher PS-MP doses, complete suppression of GnRH neurons can be expected. Therefore, our findings suggest a microplastic-dose-dependent interaction between KISS-1 and PDYN in the secretory regulation of GnRH neurons. The directions in GnRH content and release that have been described in earlier studies may, therefore, be closely related, at least in part, to the activity of the stimulating and inhibiting components of the KNDy system [30,31].

Analysis of relative GnRHR mRNA expression in the AP revealed an upward trend in GnRHR mRNA following exposure of sheep to the lower dose of PS-MP, whereas the higher dose resulted in significant suppression of GnRHR transcripts compared to both the control and low-dose groups. Thus, the effect of PS-MP on GnRHR mRNA expression was dose-dependent. Increasing plasma concentrations of microplastics could affect the sensitivity of gonadotropes to GnRH, thereby impacting their ability to respond appropriately. The potential increase in gonadotropin sensitivity to GnRH at lower doses of microplastics could stimulate gonadotropin accumulation/secretion, while higher doses could lead to inhibition. To date, no studies have been published on the effect of microplastics on GnRHR expression in the AP of sheep or other mammals, rendering these results the first reports in the literature on this topic. This finding suggests the potential of PS-MPs to modulate the central reproductive neuroendocrine system, not only by impacting GnRH neurons, but also by directly regulating the GnRH receptor in pituitary gonadotropic cells. Consequently, these phenomena may lead to further secretory disorders at the pituitary level.

Exposure of sheep to PS-MP significantly reduced LHβ mRNA expression in the AP at both the lower and higher dose, while LH protein levels remained unchanged. In contrast, FSHβ mRNA expression was significantly decreased only at the higher PS-MP dose, with no corresponding changes in FSH protein concentration across treatment groups. The discrepancy between the lack of changes in hormone concentrations and reduced mRNA expression of LH and FSH genes may result from the multilevel regulation of the hypothalamic–pituitary–gonadal axis. Transcriptional changes do not always translate directly into circulating hormone levels, which may be modulated by mRNA stability, translation efficiency and gonadotropin release. Feedback mechanisms of the hormonal axis, including signals from the gonads, may compensate for reduced gene expression, maintaining stable LH and FSH concentrations. Alternatively, the observed mRNA downregulation may reflect an early adaptive response or partial tissue desensitization, which explains the lack of changes in plasma hormone concentrations despite subtle molecular effects. Interestingly, the alterations occurring in the expression of LH and FSH genes in the AP were largely reflected in the concentrations of both gonadotropins in plasma. These results suggest that lower-dose exposure may exert a broader suppressive effect on pituitary gonadotropin secretion, while higher-dose exposure appears to differentially modulate FSH regulation. Such dose-related divergence may reflect complex regulatory mechanisms within the hypothalamic–pituitary axis, including feedback sensitivity and differential control of LH and FSH synthesis and release. It has been observed that exposure of fish to fibrous microplastics (500–1000 fibers/L) for a period of 7–10 days causes changes in the expression of reproductive genes. At the onset of exposure, an increase in GnRH levels in the brain and in LH receptor (LH-R) mRNA expression in the testes was observed. However, after a 10-day period, a decrease in GnRH and LH-R expression was noted, accompanied by indications of hormonal imbalances and vitellogenesis, suggesting the presence of endocrine dysfunction [32]. Another study in mice indicated that exposure to nanoplastics in polystyrene led to alterations in the profile of LH and FSH, as well as disruptions in the expression of LH and FSH genes in the gonadal tissues [33]. In a mouse model, exposure to polyethylene microplastics has been demonstrated to be associated with reduced levels of GnRH, luteinizing hormone (LH), and testosterone, confirming a potential endocrine effect in mammalian models [34]. In the mouse model, exposure to 2 µm PS-MP for a period of six weeks resulted in a significant decrease in serum FSH, LH and testosterone concentrations. Whilst the experiment was chiefly concerned with the measurement of hormone concentrations in the blood, as opposed to the direct expression of FSH mRNA in the pituitary gland, the decline in FSH concentration was indicative of HPG axis dysfunction. This dysfunction may be attributable to transcriptional changes in the pituitary gland or GnRH suppression in the hypothalamus [35]. A study in mice comparing different PS-MP sizes (0.5 µm, 4 µm, and 10 µm) demonstrated that smaller particles resulted in stronger HPG axis dysregulatory effects, including greater reductions in LH and FSH concentrations. That finding suggests a particle size-dependent effect [19]. Despite the fact that in certain experimental studies concentrated on hormones and steroidogenesis pathways, the results obtained provide support for the hypothesis that smaller MP particles (including nanoplastics) have a greater potential to cross biological barriers and affect central endocrine mechanisms, including pituitary hormone transcription [19]. Another study on rats revealed that exposure to PS-MP resulted in a decline in serum LH and FSH concentrations. This decline was attributed to a negative effect on the hypothalamic–pituitary–gonad axis, leading to impaired sperm quality [28]. In contrast, the results of other study demonstrated that exposure to polystyrene nanoplastics led to alterations in the profile of LH and FSH, as well as disruptions in the expression of LH and FSH genes in the rat gonadal tissues [36]. In a separate model of rats exposed to PS-MPs, reduced plasma FSH and LH levels were observed, along with dysfunction of HPG axis regulatory pathways, including downregulation of kisspeptin/GPR54 signaling in the hypothalamus, which biochemically translated into lower gonadotropin secretion [28].

4. Materials and Methods

4.1. Animal Management

Eighteen sheep (aged 9–10 months), representing the early maturing, high-yielding and non-seasonal Romanowska breed, were used in the experiment. The animals were housed at the Sheep Breeding Center of the Kielanowski Institute of Animal Physiology and Nutrition, Polish Academy of Sciences (Jablonna near Warsaw, Poland), under natural lighting conditions (52° N, 21° E). They were fed twice a day with a diet based on pelleted concentrate according to their physiological status and the recommendations of the National Research Institute of Animal Production (Krakow–Balice, Poland)—National Institute for Agricultural Research (France) [37]. Hay, water, and mineral licks were available ad libitum. During the experimental period, the sheep were placed in pairs within pens that permitted visual and olfactory contact with the entire flock.

4.2. Experimental Design

The experiment was conducted during the first breeding season of the sheep, from mid-October to December. Upon attaining the appropriate somatic age and reproductive maturity, the ewes underwent a process of estrus synchronization using the Chronogest-CR method [38]. Subsequently, the animals were randomly divided into three groups (n = 6 each) and had a catheter inserted into the external jugular vein. Microplastics, PS-MP, with a particle diameter of 2 µm (Cat. No. 78452, Merck KGaA, Darmstadt, Germany), was suspended in physiological saline (250 mL) and infused intravenously over a period of two estrus cycles, every 3 days, in the following order: (1) control group—infusion of saline; (2) experimental group 1—infusion of a lower dose (LD) (0.015 mg/kg) of PS-MP in saline; (3) experimental group 2—infusion of a higher dose (HD) (0.15 mg/kg) of microplastics in saline. In order to determine a biologically relevant exposure level, PS-MP doses were calculated based on literature on microplastic toxicity in animal models, as well as available data on the presence of microplastics in human blood [17,39,40]. The total exposure period to PS-MP was 34 days, and the sheep were euthanized during the periovulatory phase of the second estrous cycle. During PS-MP administration (250 mL/120 min), sheep were kept in comfortable experimental cages, where they could lie down and to which they were previously adapted.

4.3. Blood Sample and Brain Tissue Collection

On the last day of the study, blood samples were collected over 4 h period (from 10:00 to 14:00 h) through a catheter that was inserted into the jugular vein the day before collection. Four milliliters of blood were taken every 10 min into a heparinized tube (30 μL, 500 units/mL; Polfa, Warsaw, Poland), centrifuged, and then the plasma was stored at −20 °C until LH and FSH analysis. Immediately after the experiment, sheep were slaughtered after prior pharmacological stunning (xylazine: 0.2 mg/kg of body mass and ketamine: 3 mg/kg of body mass, intravenously) and the brains, along with the pituitaries, were rapidly removed from the skull. After median eminence (ME) separation, each brain was sectioned sagittally into cerebral hemispheres. The isolated blocks of the hypothalamus (cut to a depth of 2 mm) were dissected into two parts: preoptic area (POA) and mediobasal hypothalamus (MBH) (containing arcuate nucleus), according to the stereotaxic atlas of the ovine brain [41]. Landmarks included the optic chiasm, thalamus and mammillary body. In addition, anterior pituitary (AP) tissue was collected. All tissue cuts were performed on sterile glass plates placed on ice, and the collected structures were immediately frozen in liquid nitrogen and stored at 80 °C [42].

4.4. Total RNA Isolation, cDNA Synthesis and Quantitative Real-Time Polymerase Chain Reaction Analysis

Total RNA from the hypothalamic and AP tissues was isolated using the Total RNA Mini kit (A&A Biotechnology, Gdynia, Poland) in accordance with the manufacturer’s protocol. RNA quality and quantity were determined with spectrophotometry (NanoDrop ND-1000, Thermo Fisher Scientific Inc., Waltham, MA, USA). Total RNA samples were transcribed to complementary DNA (cDNA) using a TranScriba Kit (A&A Biotechnology, Gdynia, Poland), according to the manufacturer’s instructions. For this synthesis, 1 µg of total RNA was used in a reaction volume of 20 µL. Real Time-PCR was performed with 5 × HOT FIREPol^® EvaGreen qPCR Mix Plus (Solis BioDyne, Tartu, Estonia). The PCR amplification mix contained 2 µL cDNA template, 1 µL primers (0.5 µL each, concentration of 10 pmol/mL), 3 µL buffer PCR Master Mix and 9 µL dd H₂O. Reaction conditions were as follows: initial denaturation at 95 °C for 15 min, denaturation at 95 °C for 15 s, annealing at 60 °C for 20 s, and elongation at 72 °C for 20 s (40 cycles). Specific primers for determining the expression of genes of interest: gonadotropin-releasing hormone (GnRH), kisspeptin (KISS-1), neurokinin B (NKB) and prodynorphin (PDYN) in the hypothalamus and luteinizing hormone beta (LHβ), follicle-stimulating hormone beta (FSHβ) and GnRH receptor (GnRHR) in the AP, as well as endogenous control genes: glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and peptidylprolyl isomerase C (PPIC) were designed using Primer3web, version 4.1.0 (The Whitehead Institute, Cambrige, MA, USA) and are listed in

Table 1. Specific primers sequences.

Gene	Primers (5′–3′)	Genbank Acc. No.	Amplicon Size
GnRH	F: GCCCTGGAGGAAAGAGAAAT R: GAGGAGAATGGGACTGGTGA	XM_060409179.1	123
KISS-1	F: GGATGAACGTGCTGCTT R: CCTGTGGTTCTAGGATTCTC	NM_001306104.1	106
NKB	F: TTGGTGCGGTCTGTGAGGAGTCA R: CAGGAGAGGAGTGCTCATTCCACA	XM_015094789.4	337
PDYN	F: CCAGTGCTCCTTGTGTGCTGT R: GCCGGCTCACTGCTAGACTCT	XM_042229602.2	216
GnRHR	F: ACCACAGTTATACATCTTTGGGA R: ATGAAGAGGCAGCTGAAGGT	NM_001009397.1	147
LHβ	F: AGATGCTCCAGGGACTGCT R: TGCTTCATGCTGAGGCAGTA	NM_001009380.1	84
FSHβ	F: TATTGCTACACCCGGGACTT R: TACAGGGAGTCTGCATGGTG	NM_001009798.1	131
GAPDH	F: GGGTCATCATCTCTGCACCT R: GGTCATAAGTCCCTCCACGA	XM_060411595.1	176
PPIC	F: TGGAAAAGTCGTGCCCAAGA R: TGCTTATACCACCAGTGCCA	XM_004008676.1	158

. The specificity of amplifications was further validated with the electrophoresis of obtained amplicons in a 2% agarose gel and visualized under a UV light camera [43,44,45]. Data were analyzed with the Rotor Gene 6000 v. 1.7 software (Qiagen GmbH, Hilden, Germany) using the comparative quantification option and determined using the Relative Expression Software Tool according to Pfaffl et al. [46], based on a PCR efficiency correction algorithm developed by Pfaffl et al. [47]. The levels of gene expression were normalized using the geometrical means of two reference gene expressions, GAPDH and PPIC. Both endogenous control genes were assayed in each sample to compensate for cDNA concentration variation and PCR efficiency between individual tubes.

4.5. Tissue GnRH, LHβ and FSHβ Concentration Assay

Frozen sections (MBH, POA, AP) were mixed with radioimmunoprecipitation assay (RIPA) buffer (0.5 M Tris-HCl, pH 7.4, 1.5 M NaCl, 2.5% deoxycholic acid, 10% NP-40, 10 mM EDTA) (Merck KGaA, Darmstadt, Germany), with aprotinin as protease inhibitor (10 IU/mL, Sigma-Aldrich, Saint Louis, MO, USA). Each tissue sample was homogenized using a laboratory homogenizer and ceramic beads. After 30 min of incubation on ice, the homogenates were centrifuged at 12,000× g for 10 min at 4 °C. The supernatants were then transferred to a new 1.5 mL Eppendorf tube and immediately stored at −80 °C for later use. The GnRH concentration in the homogenates was determined using the Goat gonadotropin-releasing hormone, GnRH ELISA Kit (CSB-E13276G, Cusabio, Wuhan, China) according to the manufacturer’s protocol. Although originally designed for goat studies, this ELISA kit is also suitable for quantifying GnRH in biological material obtained from other ruminants, including sheep. The LH concentration in the homogenates was determined using the sheep LH ELISA kit (ESH0034, FineTest, Wuhan, China). The FSH concentration in the homogenates was determined using the sheep FSH ELISA kit (ESH0028, FineTest, Wuhan, China). The assay demonstrated reproducibility with intra- and interassay CVs of 1% and 5%, respectively. In addition, the total protein concentration in the tissue homogenates was analyzed spectrophotometrically using the Bradford method and the Bio-Rad Protein Assay Kit II (Bio-Rad, Hercules, CA, USA), according to the manufacturer’s instructions. The GnRH concentration in each homogenate sample was expressed as pg per mg of total protein. The LH and FSH concentration in each homogenate sample was expressed as mUI per mg of total protein.

4.6. Hormone Concentration Assay

LH concentration in plasma samples was determined by the double-antibody radioimmunoassay (RIA) using antiovine-LH (rabbit) and anti-rabbit gamma-globulin antisera, as described by Stupnicki and Madej [48]. The reference standard for LH and anti-ovine LH antiserum were provided by Dr. A. F. Parlow (National Hormone and Pituitary Program, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Torrance, CA, USA). The range of the calibrated curve was from 0.3 to 40 ng/mL and the working dilution of anti-ovine LH antiserum was 1:2,000,000. Assay sensitivity was 0.06 ng/mL and the intra- and inter-assay CV were 8.7% and 12.4%, respectively. FSH concentration in plasma samples was determined by the double-antibody RIA using anti-ovine FSH (rabbit) and anti-rabbit gamma-globulin antisera, as described by L’Hermite et al. [49]. The ovine FSH reference standard (calibrated in terms of NIH-FSH-S1) and anti-ovine FSH antiserum were provided by Dr. A. F. Parlow (National Hormone and Pituitary Program, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Torrance, CA, USA). The range of the calibrated curve was 1.56–200 ng/mL; working dilution of anti-ovine FSH antiserum was 1:15,000. Assay sensitivity was 1.56 ng/mL, and intra- and inter-assay CV were 3.3% and 11.3%, respectively.

4.7. Statistical Analyses

Initially, all data were tested for normality by the Shapiro–Wilk test and subsequently grouped into parametric and non-parametric variables. Statistical assessments of differences in mRNA expression levels of GnRH, KISS-1, NKB, and PDYN in the hypothalamus (MBH and POA), and LHβ, FSHβ, and GnRHR in the AP between the treatment groups were carried out using non-parametric statistics, including the Kruskal–Wallis test with multiple comparisons of average ranks, and subsequently the Mann–Whitney U test for individual groups (STATISTICA, Stat Soft, Tulsa, OK, USA). GnRH, LH, and FSH data (for tissue homogenate) were analyzed using one way analysis of variance (ANOVA) (STATISTICA, Stat Soft, Tulsa, OK, USA). The post hoc least significant difference test was applied after each analysis. Differences were considered significant at p < 0.05, and all data are presented as a mean ± standard error of the mean (SEM).

5. Conclusions

The findings of this study indicate that the impact of MP on reproductive processes in large mammals may be particularly significant in the central nervous system, resulting in disturbances in the hypothalamic GnRH expression. This may provide support to the existing evidence indicating that MP molecules can cross the blood–brain barrier and accumulate within the hypothalamus [50,51]. In addition to the influence of MP on GnRH neurons, one of the potential pathways of their action may be the hypothalamic KNDy neurons (kisspeptin, neurokinin B, and dynorphin). Exposure to PS-MP has been associated with reduced KISS-1 expression and alterations in PDYN expression, particularly in the MBH. It has been demonstrated that changes in the hypothalamus depend largely on the dose of particles and are associated with altered gonadotropin secretion at the pituitary and plasma levels. Future research in sheep exposed to MP will concentrate on evaluating the secretory and functional activity of peripheral reproductive tissues.