Discovery of Exoticoumarins A–L: New Anti-Inflammatory Coumarin Derivatives from Murraya exotica

Abstract

The ethanolic extract of the roots of Murraya exotica (Rutaceae) yielded twenty coumarins, including twelve previously undescribed compounds named exoticoumarins A–L (1–12; two biscoumarins, five coumarin hybrids, and five monomers). Their structures, including absolute configurations, were elucidated by a combination of NMR and HR-ESI-MS analyses, single-crystal X-ray diffraction, ECD exciton coupling, Mo₂(OAc)₄- and Rh₂(OCOCF₃)₄-induced ECD, comparison of experimental with calculated ECD spectra, and chemical hydrolysis. Anti-inflammatory evaluation in LPS-stimulated RAW264.7 macrophages identified exoticoumarins A and K (1 and 11) as potent inhibitors of nitric oxide (NO) production, with IC₅₀ values of 7.41 and 10.63 μM, respectively. Mechanistic studies revealed that 1 suppressed nitric oxide synthase (iNOS) expression at both transcriptional and translational levels, an effect associated with the inhibition of c-Jun N-terminal kinase (JNK) phosphorylation within the mitogen-activated protein kinase (MAPK) signaling pathways, without markedly affecting extracellular regulated protein kinases (ERK) 1/2 phosphorylation. These findings highlight exoticoumarin A (1) as a promising anti-inflammatory lead derived from M. exotica.

1. Introduction

The coumarin nucleus (2H-chromen-2-one) serves as a privileged scaffold in natural product chemistry, renowned for its structural diversity and multifaceted pharmacological activities, including anti-coagulant, anti-inflammatory, and anti-tumor properties [1]. The clinical significance of this structural class is evident in the therapeutic success of warfarin, underscoring its considerable potential for drug discovery [2]. Driven by this pharmaceutical interest, there is a continual search for novel coumarins from natural sources. These compounds are widely distributed in the plant kingdom, with particularly high abundance in the Rutaceae and Umbelliferae families [3]. Within Rutaceae, the genus Murraya stands out for its prolific production of structurally complex and bioactive coumarins [4].

Murraya exotica (recognized as “Jiulixiang” in the Chinese pharmacopeia) is an ornamental plant and a rich source of diverse secondary metabolites [5]. Notably, the aerial parts of M. exotica serve as a key component in various Chinese pharmaceutical products, including Sanjiu Weitai granules, used for gastrointestinal disorders [6]. Consistent with this use, its efficacy in treating inflammatory and analgesic conditions has been demonstrated in pharmacological investigations [7]. Previous phytochemical studies on M. exotica have reported a variety of bioactive constituents, including coumarins [6], alkaloids [8], and flavonoids [9]. Of particular interest are structurally unique dimers, such as the prenylated phenylpropenols exotiacetals A–C [10] and the indole-coumarin heterodimers exotines A and B [11], which highlight the plant’s chemical diversity and pharmacological promise.

Inflammation constitutes a complex defense response in living tissues, underpinning a broad spectrum of both physiological maintenance and pathological progression [12]. The activation of innate immune cells, such as macrophages, is central to this process. Upon activation, macrophages release a storm of pro-inflammatory cytokines (e.g., IL-1β, TNF-α, and IL-6) and reactive oxygen species (ROS), which are critical mediators in the exacerbation of inflammatory diseases [13]. The lipopolysaccharide (LPS)-induced model is the standard paradigm for simulating this response [14]. LPS acts as a potent immunostimulant, triggering the upregulation of iNOS and cyclooxygenase-2 (COX-2)—the key enzymes responsible for the synthesis of NO and prostaglandin E2 (PGE2), respectively [15,16]. Furthermore, MAPK signaling pathways play a pivotal role in orchestrating this inflammatory cascade. Major MAPK subfamilies, including ERK1/2, p38, and JNK, function as essential signal transducers that relay environmental stimuli to the nucleus [17]. Therefore, the modulation of MAPK signaling pathways represents a promising therapeutic strategy for the development of anti-inflammatory agents.

As part of our continuing search for structurally interesting and biologically natural products from traditional Chinese medicinal plants [18,19,20], we investigated the ethanolic extract of the roots of M. exotica, leading to the discovery of 12 new coumarins (1–12) (Figure 1). These include two biscoumarins (1 and 2), five coumarin hybrids (3–7), three C-8-substituted coumarins (8, 9, and 12), and two long-chain fatty acid-coupled coumarins (10 and 11), together with eight known analogs (13–20) (Figure S1). This paper describes the isolation, structural elucidation, and evaluation of the anti-inflammation effects of these compounds.

2. Results

2.1. Structure Elucidation

Compound 1 was obtained as colorless crystals. Its molecular formula was determined as C₃₁H₃₄O₁₀ by HRESIMS ion at m/z 589.2025 [M + Na]⁺ (calcd. for C₃₁H₃₄O₁₀Na⁺, 589.2044), requiring 15 degrees of unsaturation. The IR spectrum showed absorptions bands indicative of hydroxy (3340 cm⁻¹), carbonyl (1726 cm⁻¹ and 1714 cm⁻¹), and aromatic (1607, 1567, 1498, and 1443 cm⁻¹) functionalities. The ¹H NMR data (

Table 1. ¹H (400 MHz) and ¹³C (100 MHz) NMR data of compounds 1 and 2 in CDCl₃ (δ in ppm).

Position	1		2
	δC, Type	δH, Multi. (J in Hz)	δC, Type	δH, Multi. (J in Hz)
2	161.9, C		162.2, C
3	110.7, CH	6.13, d (9.6)	110.7, CH	6.11, d (9.6)
4	139.2, CH	8.01, d (9.6)	139.3, CH	7.98, d (9.6)
5	155.7, C		155.7, C
6	90.7, CH	6.36, s	90.5, CH	6.30, s
7	161.7, C		161.6, C
8	108.4, C		108.6, C
9	154.4, C		154.5 C
10	104.0, C		104.1, C
11	24.9, CH2	a 3.11, dd (13.7, 10.3) b 2.89, dd (13.7, 2.6)	26.8, CH2	a 2.98, dd (13.9, 8.0) b 2.87, overlapped
12	75.5, CH	3.92, overlapped	77.9, CH	4.01, dd (8.0, 4.7)
13	79.5, C		74.3, C
14	22.8, CH3	1.24, s	23.8, CH3	1.46, s
15	22.6, CH3	1.31, s	27.6, CH3	1.19, s
2′	160.5, C		161.5, C
3′	113.12, CH	6.19, d (9.5)	110.9, CH	6.14, d (9.6)
4′	143.8, CH	7.57, d (9.5)	138.9, CH	8.00, d (9.6)
5′	128.5, CH	7.33, d (8.7)	155.7, C
6′	108.0, CH	6.81, d (8.7)	90.2, CH	6.34, s
7′	160.6, C		161.5, C
8′	116.9, C		108.5, C
9′	152.8, C		154.4, C
10′	113.0, C		103.8, C
11′	69.0, CH	5.41, d (7.8)	24.4, CH2	a 3.16, dd (13.7, 10.7) b 2.87, overlapped
12′	78.2, CH	4.73, d (7.8)	78.4, CH	3.45, dd (10.8, 5.2)
13′	113.06, CH2	a 4.64, s; b 4.60, s	78.4, C
14′	146.0, C		22.7, CH3	1.03, s
15′	18.2, CH3	1.73, s	25.1, CH3	0.88, s
5-OCH3	56.3, CH3	3.93, s	56.2, CH3	3.95, s
7-OCH3	56.0, CH3	3.89, s	56.1, CH3	3.90, s
5′-OCH3			56.1, CH3	3.94, s
7′-OCH3	56.4, CH3	3.96, s	56.0, CH3	3.90, s

) of 1 presented signals for six methyls [δ_H 1.24, 1.31, 1.73, 3.89, 3.93, and 3.96 (each 3H, s)], three sets of cis-disubstituted double bonds [δ_H 6.13 (1H, d, J = 9.6 Hz), 8.01 (1H, d, J = 9.6 Hz); 6.19 (1H, d, J = 9.5 Hz), 7.57 (1H, d, J = 9.5 Hz); and 7.33 (1H, d, J = 8.7 Hz, H-5′), 6.81 (1H, d, J = 8.7 Hz)], one terminal double bond [δ_H 4.64 and 4.60 (each 1H, s)], an aromatic singlet [δ_H 6.36 (1H, s)], three oxygenated methines [3.92 (1H, m), 4.73 (1H, d, J = 7.8 Hz), and 5.41 (1H, d, J = 7.8 Hz)], and one methylene [δ_H 2.89 (1H, dd, J = 13.7, 2.6 Hz) and 3.11 (1H, dd, J = 13.7, 10.3 Hz)]. The ¹³C NMR spectrum, in combination with DEPT experiments, resolved 31 carbon resonances classified as two carbonyls [δ_C 161.9 (C) and 160.5 (C)]; two benzene rings (one penta-substituted and one 1,2,3,4-tetrasubstituted); three double bonds, including one terminal double bond, a oxygenated quaternary carbon [δ_C 79.5 (C)], three sp³ oxygenated methines [δ_C 78.2 (CH), 75.5 (CH), and 69.0 (CH)]; six sp³ methyls, including three methoxyls; and a sp³ methylene. These data suggested that 1 was a dimeric coumarin comprising two prenylated coumarin units.

Extensive analysis of 2D NMR analysis enabled the elucidation of the 2D structure of 1. As shown in Figure 2, the HMBC correlations from H-3 to C-2 and C-10, H-4 to C-2, C-5, and C-9, H-6 to C-8 and C-10, 5-OMe to C-5, and 7-OMe to C-7, together with the ¹H–¹H COSY correlation of H-3/H-4, established the presence of a 5,7-dimethoxycoumarin moiety. A 2,3-dihydroxyprenyl side chain was positioned at C-8, as supported by the ¹H–¹H COSY correlation of H₂-11/H-12 and the HMBC correlations from H₃-15 and H₃-14 to C-13 and C-12, as well as from H₂-11 to C-7, C-8, and C-9. A second coumarin moiety, identified as a 7-methoxycoumarin, was indicated by the ¹H–¹H COSY correlations of H-3′/H-4′ and H-5′/H-6′, along with the HMBC correlations from H-3′ to C-2′ and C-10′, H-4′ to C-2′, C-5′, and C-9′, H-5′ to C-4′ and C-7′, H-6′ to C-8′ and C-10′, and 7′-OMe to C-7′. Furthermore, a 1,2 dihydroxy-3-methylbut-3-enyl unit was attached at C-8′ based on the key HMBC correlations from H-11′ to C-7′, C-8′, and C-9′, from H₃-15′/H₂-14′ to C-12′, and the ¹H–¹H COSY correlation of H-11′/H-12′. Although no observed HMBC correlation was available to link the two monomeric units, the oxygen bridge between C-12′ and C-13 was assigned based on the characteristic deshielded ¹³C NMR signals of C-12′ and C-13, a shift pattern only consistent with such an oxygen linkage. Consequently, the 2D structure of 1 was proposed as illustrated in Figure 2.

Fortunately, a single crystal suitable for X-ray analysis was obtained from a MeCN/H₂O solvent mixture. The diffraction experiment (Figure 3) confirmed the proposed 2D structure and defined the absolute configuration of 1 as 12S,11′S,12′S. Thus, compound 1 was given a trivial name, exoticoumarin A.

Compound 2 was obtained as a white solid. Its molecular formula was established as C₃₂H₃₈O₁₁ based on the positive HRESIMS ion at m/z 621.2296 [M + Na]⁺ (calcd. for C₃₂H₃₈O₁₁Na⁺, 621.2306), corresponding to 14 degrees of unsaturation. The NMR data of 2 (Table 1) closely resembled those of 1, suggesting a structurally analogous dimeric coumarin scaffold. A detailed comparison revealed that one prenylated coumarin unit in 2 was identical to that in 1, whereas the second coumarin moiety exhibited two distinct modifications. The first difference was the introduction of an additional methoxy group [δ_H 3.94 (3H, s); δ_C 56.1 (CH₃)] at C-5′. This was supported by the replacement of the aromatic AX spin system for H-5′/H-6′ observed in 1 with a single aromatic proton [δ_H 6.34 (1H, s)] in 2, along with the HMBC correlation from the methoxy protons to C-5′. The second modification involved the C-8′ side chain: the 1,2 dihydroxy-3-methylbut-3-enyl group present in 1 was replaced by a 2,3-dihydroxy-3-methylbutyl moiety in 2. This change was confirmed by the HMBC correlations from H₂-11′ to C-7′, C-8′, and C-9′, from H₃-15′ and H₃-14′ to C-13′ and C-12′, as well as the ¹H–¹H COSY correlation of H₂-11′/H-12′. The two coumarin units were connected via an ether linkage between C-12′ and C-13, as evidenced by the key HMBC correlation from H-12′ to C-13.

The absolute configuration of C-12′ was determined as R based on a positive exciton coupling split [281 nm (Δε −0.79); 343 nm (Δε +2.55)] observed in the ECD spectrum (Figure 4A,B) [21]. To resolve the stereochemistry at C-12, experimental ECD data were compared with theoretical spectra generated via Time-Dependent Density Functional Theory (TDDFT). As observed from Figure 4C, the experimental ECD spectrum of 2 showed excellent agreement with the calculated spectrum for the (12S,12′R)-isomer. Therefore, the structure of 2 was assigned as depicted and named exoticoumarin B.

Compound 3 was isolated as a white amorphous solid. Its molecular formula was established as C₃₂H₄₀O₁₂ based on the HRESIMS ion at m/z 639.2409 [M + Na]⁺ (calcd for C₃₂H₄₀O₁₂Na⁺, 639.2412), indicating 13 degrees of unsaturation. The ¹H NMR data (

Table 2. ¹H (500 MHz) and ¹³C (125 MHz) NMR data of compounds 3–5 in CDCl₃ (δ in ppm).

Position	3		4		5
	δC, Type	δH, Multi. (J in Hz)	δC, Type	δH, Multi. (J in Hz)	δC, Type	δH, Multi. (J in Hz)
2	162.4, C		162.1, C		162.3, C
3	110.2, CH	5.97, d (9.6)	110.5, CH	6.00, d (9.6)	110.4, CH	6.00, d (9.6)
4	139.2, CH	7.85, d (9.6)	139.2, CH	7.89, d (9.6)	139.3, CH	7.88, d (9.6)
5	155.8, C		155.9, C		155.9, C
6	90.4, CH	6.25, s	90.3, CH	6.26, s	90.3, CH	6.24, s
7	161.7, C		161.7, C		161.7, C
8	106.8, C		106.7, C		106.6, C
9	154.2 C		154.2 C		154.2, C
10	103.7, C		103.7, C		103.7, C
11	22.7, CH2	a 3.30, d (13.6, 10.8) b 2.99, overlapped	22.9, CH2	a 3.29, dd (13.8, 10.6) b 3.03, dd (13.8, 2.4)	22.8, CH2	a 3.28, dd (13.8, 10.7) b 3.02, dd (13.8, 2.3)
12	78.5, CH	5.15, d (10.8, 2.4)	79.0, CH	5.16, dd (10.6, 2.4)	79.0, CH	5.17, dd (10.6, 2.3)
13	72.6, C	1.39, s	72.8, C		72.8, C
14	25.6, CH3	1.32, s	25.4, CH3	1.39, s	25.4, CH3	1.38, s
15	26.9, CH3		26.7, CH3	1.33, s	26.7, CH3	1.32, s
1′	106.3, C		116.5, C		116.3, C
2′	158.0, C		157.5, C		157.5, C
3′	107.8, C		112.1, C		112.3, C
4′	159.8, C		159.3, C		159.3, C
5′	87.3, CH	5.99, s	102.7, CH	6.38, d (8.7)	102.6, CH	6.33, d (8.7)
6′	159.7, C		129.7, CH	7.29, d (8.7)	129.8, CH	7.23, d (8.7)
7′	136.7, CH	7.87, d (16.2)	140.4, CH	7.73, d (16.1)	140.6, CH	7.68, d (16.1)
8′	116.8, CH	6.58, d (16.2)	115.7, CH	6.25, d (16.1)	113.6, CH	6.24, d (16.1)
9′	168.7, C		167.5, C		167.6, C
10′	25.8, CH2	a 3.02, overlapped b 2.43, d (14.5, 10.0)	70.8, CH	5.29, d (6.3)	70.9, CH	5.28, d (6.8)
11′	80.9, CH	3.60, d (10.0, 2.0)	77.8, CH	4.33, d (6.3)	77.9, CH	4.30, d (6.8)
12′	73.4, C		143.6, C		143.6, C
13′	22.9, CH3	1.29, s	113.7, CH2	a 4.85, s; b 4.83, s	113.6, CH2	a 4.78, s; b 4.72, s
14′	26.3, CH3	1.31, s	18.4, CH3	1.76, s	18.2, CH3	1.74, s
5-OCH3	55.9, CH3	3.90, s	56.2, CH3	3.91, s	56.2, CH3	3.89, s
7-OCH3	56.3, CH3	3.86, s	55.9, CH3	3.87, s	55.9, CH3	3.86, s
4′-OCH3	55.5, CH3	3.79, s	55.5, CH3	3.76, s	55.4, CH3	3.72, s
6′-OCH3	55.8, CH3	3.81, s
2′-OH				9.34, s		9.45, s

) exhibited characteristic resonances for four methyl singlets [δ_H 1.29, 1.31, 1.32, and 1.39 (each 3H, s)], four methoxy groups [δ_H 3.79, 3.81, 3.86, and 3.90 (each 3H, s)], two trans-olefinic protons [δ_H 6.58 (1H, d, J = 16.2 Hz) and 7.87 (1H, d, J = 16.2 Hz)], two cis-olefinic protons [δ_H 5.97 (1H, d, J = 9.6 Hz) and 7.85 (1H, d, J = 9.6 Hz)], alongside two aromatic singlets [δ_H 6.25 (1H, s) and 5.99 (1H, s)] and several methylene protons. The ¹³C NMR and DEPT data resolved 32 carbons, categorized as two carbonyls, 12 aromatic carbons, two double bonds, two oxygenated sp³ quaternary carbons, two oxygenated methines, four methoxys, two methylenes, and four methyls. These spectroscopic data closely resembled those of the known compound toddalin D [22], indicating a similar framework. Key differences, however, were observed in the substitution patterns of both the coumarin and the prenylated cinnamic acid units. Unlike the 5,7-dimethoxy-6-substituted coumarin in toddalin D, compound 3 possesses a 5,7-dimethoxy-8-substituted pattern (Figure 2). Furthermore, the key HMBC correlations from H-10′ to C-2′, C-3′, and C-4′ positioned the 2,3-dihydroxy-3-methylbutyl moiety at C-3′ of the cinnamic acid unit, rather than C-5′ as in toddalin D. The absolute configuration at C-11′ was assigned as S by the Mo₂(OAc)₄-induced CD method (Figure 5). The absolute configuration at C-12 was also established as S through chemical correlation: alkaline hydrolysis of 3 afforded the known compound mexoticin [23], whose S configuration was well established. This assignment was further corroborated by the exciton coupling method (Figure 6). Consequently, the structure of 3 was fully elucidated and named exoticoumarin C.

Compounds 4 and 5 were obtained as colorless oils and shared the same molecular formula C₃₁H₃₆O₁₁, which is consistent with 14 degrees of unsaturation, as determined by positive HRESIMS data ([M + Na]⁺ ions at m/z 607.2133 and 607.2121, respectively; calcd for C₃₁H₃₆O₁₁Na⁺, 607.2150). A comparative analysis of their ¹H and ¹³C NMR data (Table 2) revealed a high degree of similarity to those of 3, except that the 2,3-dihydroxyprenyl unit in 3 was replaced by a 1,2-dihydroxy-3-methylbut-3-enyl moiety in 4 and 5, along with the absence of a methoxy group. The 1,2-dihydroxy-3-methylbut-3-enyl moiety was supported by the HMBC correlations from H-10′ to C-2′, C-3′, and C-4′ and from H₃-14′ and H₂-13′ to C11′ and C-12′, as well as by the ¹H–¹H COSY correlation between H-10′ and H-11′. In contrast to 3, the absence of the methoxy group at C-6′ in 4 and 5 was evidenced by the appearance of the ¹H–¹H COSY cross-peak between H-5′ and H-6′, together with the key HMBC correlations from H-5′ to C-1′ and C-3′ and from H-6′ to C-2′ and C-4′. Both compounds displayed relatively large coupling constants (J_10′,11′ = 6.3 Hz for 4; J_10′,11′ = 6.8 Hz for 5), consistent with a threo configuration of OH-10′ and OH-11′. The absolute configurations of these diol moieties were ultimately differentiated using the Mo₂(OAc)₄-induced ECD method. Based on the signs of the observed Cotton effects at approximately 310 nm (Figure 5), the stereocenters were assigned as (10′R,11′R) for 4 and (10′S,11′S) for 5. The absolute configuration at the C-12 position for both compounds was assigned as S by alkaline hydrolysis to mexoticin, employing the same method used for 3. Consequently, the structures were elucidated as (12S,10′R,11′R) for exoticoumarin D (4) and (12S,10′S,11′S) for exoticoumarin E (5), respectively.

Compounds 6 and 7 were obtained as colorless oils. Both shared the same molecular formula, C₃₂H₃₈O₁₁ (14 degrees of unsaturation), as determined by the HRESIMS analysis, which displayed [M + Na]⁺ peaks at m/z 621.2279 and 621.2300, respectively (calcd for C₃₂H₃₈O₁₁Na⁺, 621.2306). Their 1D NMR data (

Table 3. ¹H (400 MHz) and ¹³C (100 MHz) NMR data of compounds 6 and 7 in CDCl₃ (δ in ppm).

Position	6		7
	δC, Type	δH, Multi. (J in Hz)	δC, Type	δH, Multi. (J in Hz)
2	161.6, C		161.6, C
3	110.6, CH	6.00, d (9.6)	110.7, CH	6.03, d (9.6)
4	138.9, CH	7.88, d (9.6)	138.9, CH	7.89, d (9.6)
5	155.9, C		155.9, C
6	90.3, CH	6.26, s	90.3, CH	6.25, s
7	161.7, C		161.7, C
8	106.8, C		106.7, C
9	154.3 C		154.3 C
10	103.7, C		103.8, C
11	23.0, CH2	a 3.29, dd (13.8, 10.6) b 3.03, dd (13.8, 2.1)	23.0, CH2	a 3.30, dd (13.9, 10.6) b 3.04, dd (13.9, 2.3)
12	79.1, CH	5.18, dd (10.8, 2.1)	79.1, CH	5.19, dd (10.5, 2.43)
13	72.8, C		72.8, C
14	25.4, CH3	1.39, s	25.4, CH3	1.39, s
15	26.8, CH3	1.33, s	26.8, CH3	1.34, s
1′	116.2, C		116.2, C
2′	156.8, C		156.8, C
3′	109.8, C		109.8, C
4′	160.3, C		160.3, C
5′	102.6, CH	6.39, d (8.7)	102.6, CH	6.39, d (8.7)
6′	130.2, CH	7.32, d (8.7)	130.2, CH	7.32, d (8.7)
7′	140.2, CH	7.72, d (16.1)	140.1, CH	7.72, d (16.1)
8′	116.1, CH	6.29, d (16.1)	116.1, CH	6.29, d (16.1)
9′	167.4, C		167.4, C
10′	81.3, CH	4.87, d (7.2)	81.3, CH	4.88, d (7.1)
11′	77.3, CH	4.28, d (7.2)	77.3, CH	4.29, d (7.1)
12′	143.0, C		143.0, C
13′	113.7, CH2	a 4.76, s b 4.65, s	113.7, CH2	a 4.76, s b 4.66, s
14′	18.1, CH3	1.74, s	18.1, CH3	1.74, s
5-OCH3	56.2, CH3	3.91, s	56.2, CH3	3.91, s
7-OCH3	55.9, CH3	3.88, s	55.9, CH3	3.88, s
4′-OCH3	55.5, CH3	3.76, s	55.5, CH3	3.76, s
10′-OCH3	58.3, CH3	3.46, s	58.3, CH3	3.46, s
2′-OH		8.77, s		8.77, s

) were found to be very similar to those of 4 and 5, with the key distinction being the presence of an additional methoxy group [δ_H 3.46; δ_C 58.3 in 6 and 7] at C-10′. This structure modification was supported by the upfield shifts in H-10′ (δ_H 4.87 in 6 and 4.88 in 7 vs. δ_H 5.29 in 4 and 5.28 in 5) and further substantiated by a key HMBC correlation between the methoxy protons and C-10′ (Figure 2). The highly similar chemical shifts of 6 and 7 suggest that they are also a pair of diastereomers. The absolute configuration at C-12 was assigned as S via the alkaline hydrolysis method described above. Furthermore, the relative stereochemistry was defined as threo based on the H-10′/H-11′coupling constants (J = 7.2 Hz in 6 and J = 7.1 Hz in 7). The absolute configuration of the C-11′ secondary alcohol was determined using the Rh₂(OCOCF₃)₄ method. A positive Cotton effect near 350 nm (E band) corresponds to an S configuration, whereas a negative Cotton effect implies an R configuration [24]. Based on the induced ECD curves (Figure 7), the absolute configuration at C-11′ was determined as R for compound 6 (negative Cotton effect near 350 nm) and S for compound 7 (positive Cotton effect). Combined with the established threo relationship between OH-10′ and OH-11′ and the S configuration at C-12, the complete absolute configurations were assigned as (12S,10′R,11′R) for 6 and (12S,10′S,11′S) for 7. Consequently, their structures were established as depicted and named exoticoumarin F (6) and exoticoumarin G (7), respectively.

Compound 8, a white amorphous powder, possessed a molecular formula of C₂₁H₂₆O₇, indicating nine degrees of unsaturation, as determined by the sodium adduct ion peak at m/z 413.1565 [M + Na]⁺ (calcd for C₂₁H₂₆O₇Na, 413.1571). Analysis of the ¹H and ¹³C NMR data (

Table 4. ¹H (400 MHz) and ¹³C (100 MHz) NMR data of compounds 8, 9, and 12 (δ in ppm).

Position	8 a		9 b		12 a
	δC, Type	δH, Multi. (J in Hz)	δC, Type	δH, Multi. (J in Hz)	δC, Type	δH, Multi. (J in Hz)
2	160.8, C		163.2, C		160.6, C
3	114.7, CH	6.32, d (9.7)	113.2, CH	6.26, d (9.5)	113.6, CH	6.26, d (9.5)
4	138.2, CH	7.89, d (9.7)	146.4, CH	7.89, d (9.5)	143.5, CH	7.63, d (9.5)
5	142.0, C		129.9, CH	7.56, d (8.7)	129.6, CH	7.45, d (8.7)
6	138.3, C		109.7, CH	7.08, d (8.7)	107.6, CH	6.88, d (8.7)
7	150.3, C		161.9, C		161.4, C
8	115.1, C		119.4, C		111.9, C
9	146.8, C		154.1, C		154.2, C
10	109.6, C		114.6, C		113.0, C
11	27.6, CH2	a 3.22, dd (13.6, 8.8) b 3.11, dd (13.6, 5.1)	67.2, CH	5.54, d (5.0)	54.6, CH2	5.36, s
12	76.1, CH	5.52, dd (8.8, 5.1)	77.3, CH	3.98, d (5.0)
13	143.4, C		75.5, C
14	112.8, CH2	a 4.92, s; b 4.85, s	68.8, CH2	a 3.62, d (11.1) b 3.48, d (11.1)
15	18.5, CH3	1.87, s	19.7, CH3	1.20, s
1′	172.3, C				173.1, C
2′	43.7, CH2	2.06, m			43.5, CH2	2.19, d (7.1)
3′	25.7, CH	1.94, m			25.9, CH	2.09, m
4′	22.4, CH3	0.79, d (6.8)			22.5, CH3	0.94, d (6.6)
5′	22.4, CH3	0.78, d (6.8)			22.5, CH3	0.94, d (6.6)
5-OCH3	61.6, CH3	3.95, s
7-OCH3	62.4, CH3	3.99, s	56.9, CH3	3.96, s	56.4, CH3	3.92, s

^a Measured in CDCl₃. ^b Measured in CD₃OD.

) revealed a close resemblance to those of omphamurin isovalerate [25]. The key structural difference in 8 was the substitution of the sole aromatic methine proton with a hydroxy group. This modification was evidenced by the disappearance of the corresponding aromatic proton signal in the ¹H NMR spectrum and by significant changes in the chemical shifts of the surrounding carbon atoms. The absolute configuration at C-12 was assigned as S by comparing the specific rotation sign [α]²⁰_D −17 with that of omphamurin isovalerate [α]²⁵_D −14.9, whose 12S configuration had been previously established by chemical correlation [26]. Consequently, the structure of 8 was elucidated and named exoticoumarin H.

Compound 9 was isolated as a yellow amorphous powder. Its molecular formula was determined to be C₁₅H₁₈O₇, consistent with seven degrees of unsaturation, by analysis of ¹³C NMR and HRESIMS data (m/z 333.0937 [M + Na]⁺, calcd for C₁₅H₁₈O₇Na⁺, 333.0945). The ¹H and ¹³C NMR data (Table 4) showed a close similarity to those of murratin H [7], with the key difference being the replacement of the methyl group in murratin H by a hydroxymethyl group [δ_H 3.62 and 3.48 (each 1H, d, J = 11.1 Hz); δ_C 68.8 (CH₂)] in 9. This was supported by the HMBC correlations from the protons (H₂-14) of this hydroxymethyl to C-12, C-13, and C-15 and from H₃-15 to C-14. The relative configuration was assigned as erythro based on the small vicinal coupling constant observed between H-11 and H-12 (J = 5.0 Hz). The nearly zero specific rotation and the absence of Cotton effects in the ECD spectrum suggested that 9 existed as a racemate. Repeated attempts at chiral resolution were unsuccessful. Therefore, the structure is depicted as shown and named exoticoumarin I.

Compound 10 possessed the molecular formula C₃₃H₄₆O₆, requiring 11 degrees of unsaturation, as inferred from the positive HRESIMS molecular ion peak at m/z 561.3174 [M + Na]⁺ (calcd for C₃₃H₄₆O₆Na⁺, 561.3187). Analysis of the NMR data (

Table 5. ¹H (400 MHz) and ¹³C (100 MHz) NMR data of compounds 10 and 11 in CDCl₃ (δ in ppm).

Position	10		11
	δC, Type	δH, Multi. (J in Hz)	δC, Type	δH, Multi. (J in Hz)
2	160.4, C		160.2, C
3	113.3, CH	6.24, d (9.5)	113.5 CH	6.25, d (9.6)
4	143.6, CH	7.59, d (9.5)	143.6, CH	7.61, d (9.6)
5	127.9, CH	7.37, d (8.7)	127.8, CH	7.39, d (8.8)
6	107.8, CH	6.84, d (8.7)	107.8, CH	6.87, d (8.8)
7	160.3, C		160.0, C
8	113.1, C		115.9, C
9	153.4, C		152.7, C
10	113.7, C		113.1, C
11	70.7, CH	6.41 d (7.8)	68.2, CH	5.52, dd (10.5, 7.8)
12	76.2, CH	4.91, d (7.8)	79.3, CH	5.75, d (7.8)
13	143.2, C		140.9, C
14	114.0, CH2	a 4.77, s b 4.72, t (1.6)	114.7, CH2	a 4.77, s b 4.74, t (1.6)
15	17.6, CH3	1.75, s	18.6, CH3	1.74, s
1′	173.4, C		173.7, C
2′	34.3, CH2	2.37, t (7.2)	34.5, CH2	2.39, t (7.6)
3′	24.9, CH2	1.62, m	25.1, CH2	1.62, m
4′	29.0~29.5, CH2	1.26~1.37, m	29.0, CH2	1.31, m
5′	29.0~29.5, CH2	1.26~1.37, m	29.0, CH2	1.31, m
6′	29.0~29.5, CH2	1.26~1.37, m	29.0, CH2	1.31, m
7′	29.0~29.5, CH2	1.26~1.37, m	29.7, CH2	1.31, m
8′	27.2, CH2	2.03, m	37.3, CH2	1.53, m
9′	130.1, CH	5.28~5.41, m	72.9, CH	4.16, m
10′	128.0, CH	5.28~5.41, m	135.9, CH	5.66, dd (15.2, 6.8)
11′	25.6, CH2	2.76, t (6.2)	125.8, CH	6.49, dd (15.2, 11.2)
12′	129.0, CH	5.28~5.41, m	128.7, CH	5.96, t (11.2)
13′	130.2, CH	5.28~5.41, m	132.8, CH	5.43, dt (11.2, 7.6)
14′	27.2, CH2	2.03, m	27.7, CH2	2.18, m
15′	29.6, CH2	1.26~1.37, m	29.4, CH2	1.37, m
16′	31.5, CH2	1.26~1.37, m	31.8, CH2	1.31, m
17′	22.6, CH2	1.26~1.37, m	22.6, CH2	1.31, m
18′	14.1, CH3	0.89, t (6.8)	14.0, CH3	0.89, t (6.8)
7-OCH3	56.4, CH3	3.94, s	56.3, CH3	4.00, s
11-OH				3.58, d (10.5)

) revealed a close resemblance to those of (–)-murrangatin (17) [26], with the key difference being the presence of an additional 9Z,12Z-octadecadienoyl moiety [27,28], indicating that 10 was a fatty acid ester of 17. This position of acylation was established as C-11 by the HMBC correlation from H-11 to the C-1′ ester carbonyl (Figure 2). Analysis of the coupling constant between H-11 and H-12 (J = 7.8 Hz) supported a threo configuration, identical to that of (–)-murrangatin (17). Alkaline hydrolysis of 10 afforded (–)-murrangatin (17), whose ECD and optical rotation data matched those of an authentic sample. Since the absolute configuration of (–)-murrangatin is known to be (11R,12R), the stereochemistry of 10 was accordingly assigned (Figure 7B). Consequently, compound 10 was designated as exoticoumarin J.

Compound 11 was assigned the molecular formula C₃₃H₄₆O₇, corresponding to 11 degrees of unsaturation, based on its positive-mode HRESIMS ion at m/z 577.3120 [M + Na]⁺ (calcd for C₃₃H₄₆O₇Na⁺, 577.3136). The NMR profiles of 11 were similar to those of 10, with two main differences: the fatty acid chain in 11 was replaced by a (10E,12Z)-9-hydroxy-10,12-octadecadienoyl moiety acid [29], and the ester moiety was located at C-12 rather than C-11. The latter was confirmed by the HMBC correlation from H-12 to the ester carbonyl carbon C-1′ (Figure 2). The coupling constant between H-11 and H-12 was consistent with that of 10, indicating the same threo relative configuration. The absolute configuration (11R,12R) was confirmed by comparing its ECD data with those of 10 (Figure 7B). The stereochemistry at C-9′ of the fatty acid side chain remained undetermined due to the insufficient material for meaningful optical rotation analysis of the hydrolysis product. Thus, compound 11 was assigned as depicted and given the name exoticoumarin K.

Compound 12 was assigned the molecular formula C₁₆H₁₉O₅, indicating eight degrees of unsaturation, based on its ¹³C NMR and HRESIMS data (m/z 313.1033 [M + Na]⁺, calcd for C₁₆H₁₉O₅Na, 313.1046). The proton and carbon NMR profiles matched well with those of murrayacarpin A [30], differing mainly by the presence of an additional 3-methylbutanoyl moiety [δ_H 0.94 (6H, d, J = 6.6 Hz, H₃-4′/5′), 2.09 (1H, m, H-3′), 2.15, (2H, d, J = 7.1 Hz, H₂-2′); δ_C 22.5 (C-4′/5′), 25.9 (C-3′), 43.5 (C-2′), 173.1 (C-1′)]. This moiety was supported by the ¹H–¹H COSY correlations of H-2′/H-3′/H-4′(H-5′) and by the HMBC correlation from H-3′ to C-1′. The attachment of the 3-methylbutanoyl group at C-11 was confirmed by the HMBC correlation from H₂-11 to its carboxyl carbon. Thus, the structure of compound 12 was elucidated as shown and named exoticoumarin L.

Eight known compounds were identified as exotimarin A (13) [10], panitin E (14) [21], seselinal (15) [31], osthole (16) [32], (–)-murrangatin (17) [26], meranzin (18) [33], muraculatin (19) [34], and paniculatin (20) [35] by comparison of observed and reported physical data.

2.2. Evaluation of Anti-Inflammation Activity and Cell Viability

The anti-inflammatory activities of the isolated compounds were initially evaluated in LPS-induced RAW 264.7 cells by measuring NO production. As shown in Figure 8A,C, exoticoumarins A (1) and K (11) exhibited potent, dose-dependent inhibition of NO release, with IC₅₀ values of 7.41 ± 0.45 μM and 10.63 ± 0.69 μM, respectively, marginally inferior to the positive quercetin (IC₅₀ = 16.37 ± 0.96 μM). To exclude the possibility that the observed inhibition resulted from cytotoxicity, the cell viability was assessed using the CCK-8 assay. As illustrated in Figure 8B, compound 1 did not exhibit significant cytotoxicity at concentrations up to 40 μM, thereby ruling out cytotoxicity as the cause of the inhibition of NO production.

2.3. Suppression of iNOS Expression and Modulation of MAPK Signaling by Compound 1

To gain insights into the underlying mechanism of the most potent compound, exoticoumarin A (1), we evaluated its regulatory effect on iNOS. As confirmed by quantitative PCR and immunoblotting assays, the LPS-triggered upregulation of iNOS mRNA and protein was effectively downregulated by 1 in a dose-responsive manner (Figure 8D,E). Furthermore, to explore the upstream regulatory pathways, we examined the phosphorylation status of MAPK. As shown in Figure 8E,F, exposure to LPS significantly elevated the phosphorylation levels of both JNK and ERK1/2. However, pretreatment with 1 significantly downregulated p-JNK levels in a dose-dependent manner, whereas no significant alteration was observed in the phosphorylation levels of ERK1/2.

3. Discussion

In this study, the phytochemical investigation of the roots of M. exotica L. yielded a diverse array of twenty coumarins, characterized by a high degree of prenylation. Notably, twelve new compounds were identified, including two biscoumarins (1–2), five coumarin hybrids (3–7), and two rare coumarin fatty acid esters (10 and 11). The structural elucidation of these coumarins, particularly the assignment of absolute configurations for the flexible prenyl-derived side chains, represented a significant challenge. To address this, we employed a multifaceted approach combining crystallographic, spectroscopic, and chemical methods. X-ray diffraction analysis provided unambiguous evidence for the absolute configuration of exoticoumarin A (1). For compounds lacking suitable crystals (3–7), the in situ Mo₂(OAc)₄- and Rh₂(OCOCF₃)₄-induced ECD methods proved effective in determining the chirality of the acyclic 1,2-diols and secondary alcohols. Furthermore, chemical correlation via alkaline hydrolysis successfully linked the complex esters to known monomers (e.g., mexoticin and murrangatin), establishing a reliable stereochemical correlation network. This rigorous strategy ensures the accuracy of the assigned structures and provides a reference for the stereochemical resolution of similar flexible natural products.

The co-occurrence of biscoumarins (1–2), five coumarin hybrids (3–7), and their potential monomeric precursors within the same plant extract suggests a plausible biosynthetic relationship. As illustrated in Scheme S1, we hypothesize that these coumarin hybrids are assembled via dehydration or esterification between two monomeric coumarin units. While compounds 1 and 2 are postulated to be formed via dehydration of their corresponding precursors, compounds 3–7 are hypothesized to originate from mexoticin and murrangatin via a pathway involving hydrolysis and cis-trans isomerization, followed by esterification with a mexoticin unit, with subsequent methylation for compounds 6 and 7. This structural complexity highlights the robust biosynthetic repertoire of M. exotica and suggests that dimerization is a key strategy for this species to expand its chemical defense diversity.

The anti-inflammatory evaluation revealed distinct patterns in the structure–activity relationship. Among the isolates, the biscoumarin exoticoumarin A (1) and the fatty acid conjugate exoticoumarin K (11) exhibited the most potent inhibition of NO production, with IC₅₀ values of 7.41 ± 0.45 μM and 10.63 ± 0.69 μM, respectively. The superior activity of dimer 1 over monomeric coumarins (13–20) suggests that the biscoumarin skeleton may offer additional binding sites or enhanced stability when interacting with inflammatory mediators. As for compound 11, its conjugation with a long-chain unsaturated fatty acid (hydroxy-linoleic acid) significantly enhances the lipophilicity of the coumarin core. This structural modification is presumed to facilitate membrane penetration, thereby increasing its intracellular concentration and biological efficacy compared to its hydrolysis product.

To further elucidate the molecular mechanism of exoticoumarin A (1), we investigated its regulatory effect on the iNOS-NO signaling axis. Our results demonstrated that 1 significantly suppressed iNOS expression at both transcriptional (mRNA) and translational (protein) levels, indicating that compound 1 acts by interfering with the gene expression machinery rather than merely inhibiting the enzyme’s catalytic activity. To explain this transcriptional suppression, we propose a preliminary working model focusing on the MAPK signaling cascade. Distinct from the ERK1/2 pathway, where activation was not significantly altered, 1 exhibited a dose-dependent attenuation of JNK phosphorylation. Given that JNK activation is critical for the phosphorylation of c-Jun, a component of the AP-1 transcription factor complex, which is essential for the promoter activation of the iNOS gene, we hypothesize that the suppression of JNK phosphorylation by 1 halts this signaling cascade, thereby preventing AP-1 activation and subsequent iNOS transcription. It is worth noting, however, that the MAPK superfamily also includes the p38 pathway, which—along with NF-κB signaling—plays a pivotal role in inflammatory cascades. Since p38 and NF-κB were not assessed in the present study, their potential involvement cannot be ruled out.

In the broader context of Traditional Chinese Medicine, the identification of potent anti-inflammatory agents in this study, particularly exoticoumarin A (1), supports the phytochemical rationale for the historical use of M. exotica in treating pain and rheumatic disorders. Distinct from previous investigations, which primarily characterized complex heterodimers [10] and phenylpropenols [11] in the roots, or cyclopropane-bearing derivatives in the aerial parts [36], this current study reveals a rich diversity of C-8 substituted coumarins. Furthermore, unlike these earlier studies that were limited to preliminary phenotypic screening of NO inhibition, the present work advances our understanding by elucidating the underlying molecular mechanism at the protein level. This finding not only enriches the species’ chemical diversity but also provides mechanistic evidence for its active constituents. Nevertheless, this current study is subjected to certain limitations. Specifically, as the anti-inflammatory effects and the proposed signaling model were verified exclusively through in vitro cellular models, future in vivo investigations are needed to evaluate the bioavailability, safety profile, and therapeutic efficacy of 1 in complex physiological systems.

4. Materials and Methods

4.1. General Experimental Procedures

Single-crystal X-ray diffraction data were collected on a Rigaku Oxford Diffraction Supernova diffractometer (Rigaku Corporation, The Woodlands, TX, USA). The MCP 200 modular circular polarimeter from Anton Paar (Graz, Austria) was used to determine the optical rotations. An Applied Photophysics Chirascan spectrometer was used to measure ECD and UV data. A PerkinElmer Spectrum Two FTIR spectrometer (PerkinElmer, Shelton, CT, USA) with a UATR accessory was applied to collect IR spectra. One-dimensional and two-dimensional NMR spectra were recorded using Bruker Avance III 400 and Bruker Ascend TM 500 spectrometers (Bruker, Rheinstetten, Germany). A Micromass Q-TOF spectrometer from Waters (Milford, MA, USA) was used to receive HR-ESI-MS data. Column chromatography (CC) fractionations mainly relied on silica gel (100–200, 200–300, and 300–400 mesh, Qingdao Haiyang Chemical Co., Ltd., Qingdao, China), reversed-phase C₁₈ (Rp-C₁₈) silica gel (12 nm, S-50 μm, YMC Co., Ltd., Kyoto, Japan), and Sephadex LH-20 gel (Amersham Biosciences, Little Chalfont, UK). High-performance liquid chromatography (HPLC) separations were conducted on a Shimadzu LC-20 AT with an SPD-M20A PDA detector (Shimadzu Co., Ltd., Kyoto, Japan) using a YMC-pack ODS-A column (10 × 250 mm, S-5 μm), a chiral CNZ column (10 × 250 mm, 5 μm, NanoChrom, Suzhou, China), and a NanoChrom ChromCoreTM 5-120 C₁₈ column (250 × 10 mm, 5 µm). Chemical solvents were of analytical grade (Guangzhou Chemical Reagents Company, Ltd., Guangzhou, China) while acetonitrile (MeCN) was of HPLC grade (Grace Chemical Technology Co., Ltd., Shanghai, China).

4.2. Plant Material

The roots of M. exotica (20.0 kg) were collected from Yuanjiang County, Yuxi city, Yunnan Province, China, in September 2022, and authenticated by one of the authors (G. H. Tang). A voucher specimen (accession number 93202209) was deposited at the School of Pharmaceutical Sciences, Sun Yat-sen University.

4.3. Extraction and Isolation

The air-dried powder of the roots of M. exotica (20 kg) was extracted with 95% EtOH (3 × 50 L) at room temperature to yield 930 g of crude extract. The extract was suspended in H₂O (3 L) and partitioned with EtOAc (6 × 2 L) to yield the EtOAc-soluble fraction (563 g). The EtOAc fraction was subjected to silica gel column chromatography eluted with a CH₂Cl₂/MeOH gradient (100:1 ⟶ 0:1) to yield seven fractions (Frs. A–G). Fr. E (78.0 g) was separated over an ODS column (MeOH/H₂O, 30 ⟶ 100%) to obtain eight fractions (Frs. E1–E8). Fr. E1 (4.1 g) was further fractionated by silica gel CC eluting with a gradient of CH₂Cl₂-MeOH to yield seven subfractions (Frs. E1A–E1G). Fr. E1B (1.2 g) was passed through a Sephadex LH-20 column (MeOH) and subsequently purified by semi-preparative HPLC (MeCN-H₂O, 58:42, flow rate: 3 mL/min) to yield a mixture of 4/5 (12 mg, t_R = 13.2 min), along with compounds 6 (3.1 mg, t_R = 15.7 min) and 7 (2.0 mg, t_R = 20.3 min). The mixture of 4/5 was resolved using a chiral CNZ column eluting with n-hexane–iPrOH (53:47, v/v) at a flow rate of 2 mL/min to give 5 (8 mg, t_R = 20.1 min) and 4 (3 mg, t_R = 27.2 min). Fr. E1E (130 mg) was purified by semi-preparative HPLC (MeCN-H₂O, 70:30, flow rate: 3 mL/min) to give 20 (4.3 mg, t_R = 15.1 min). Fr. E1G (126 mg) yielded compound 12 (4.2 mg, t_R = 14.0 min) by semi-preparative HPLC (MeCN-H₂O, 16:84, flow rate: 3 mL/min). Fr. E2 (800 mg) was fractionated by Sephadex LH-20 (MeOH) to afford four subfractions (Frs. E2A–E2D). Purification of Fr. E2A (60.2 mg) by semi-preparative HPLC (MeCN-H₂O, 80:20, flow rate: 3 mL/min) gave 18 (2.9 mg, t_R = 18.1 min). Fr. E2B (34 mg) yielded 3 using semi-preparative HPLC (MeCN-H₂O, 50:50, flow rate: 3 mL/min). Fr. E2D was similarly purified (MeCN-H₂O, 60:40, flow rate: 3 mL/min) to give 14 (5.0 mg, t_R = 10.8 min) and 11 (3.0 mg, t_R = 12.1 min). Compound 17 (200 mg) was obtained directly by recrystallization from Fr. E3 (2.2 g). Fr. E4 (3.8 g) was chromatographed on silica gel (petroleum ether/EtOAc, 50:1 ⟶ 0:1) to five Frs. E4A–E4C. Fr. E4A (220 mg) yielded 8 (3.3 mg, t_R = 20.4 min) via semi-preparative HPLC (n-hexane-iPrOH, 90:10, flow rate: 1.2 mL/min). Fr. E4C (152 mg) was purified by Sephadex LH-20 (MeOH) to yield 9 (10 mg). Fr. E5 (2.7 g) was chromatographed over silica gel CC (CH₂Cl₂-MeOH, 100:1 ⟶ 0:1) to afford six subfractions (Frs. E5A–E5F). Fr. E5B (800 mg) was purified by Rp-C₁₈ silica gel CC (MeOH-H₂O, 30 ⟶ 100%), followed by semi-preparative HPLC (MeCN-H₂O, 57:43, flow rate: 3 mL/min) to afford 1 (6.2 mg, t_R = 16.0 min). Compound 2 (3.2 mg, t_R = 10.1 min) was isolated from Fr. E5C (110 mg) via semi-preparative HPLC (MeCN-H₂O, 60:40, flow rate: 3 mL/min). Compounds 15 (22 mg), 16 (7.2 mg), and 19 (3.0 mg) were obtained from Fr. E5E (120 mg) via Sephadex LH-20 column (MeOH). Fr. E7 (5.2 g) was subject to silica gel CC (petroleum ether/EtOAc, 100:1 → 1:1) to obtain five fractions (Frs. E7A–E7E). Compound 13 (4.1 mg, t_R = 7.8 min) was isolated from Fr. E7B via semi-preparative HPLC (MeCN-H₂O, 60:40, flow rate: 3 mL/min). Compound 10 (2.1 mg, t_R = 11.2 min) was obtained from Frs. E7D via semi-preparative HPLC (MeCN-H₂O, 80:20, flow rate: 1 mL/min). The isolation flow chart of the roots of M. exotica is listed in Figure S3.

4.4. Spectroscopic Data of Compounds

4.4.1. Exoticoumarin A (1) [8-((S)-2-Hydroxy-3-(((1S,2S)-1-hydroxy-1-(7-methoxy-2-oxo-2H-chromen-8-yl)-3-methylbut-3-en-2-yl)oxy)-3-methylbutyl)-5,7-dimethoxy-2H-chromen-2-one]

Colorless crystals; [α]²⁰_D −19 (c 0.1, MeCN); IR (UATR) ν_max 3340, 2963, 2929, 1726, 1714, 1607, 1567, 1498, 1443, 1290, 1255, 1032 cm⁻¹; UV (MeCN) λ_max (log ε) 320 (2.25), 201 (3.96) nm; ECD (c 1.0 × 10⁻³ M, MeCN) λ_max (Δε) 256 (+2.76), 273 (−1.30), 335 (−7.08); ¹H and ¹³C NMR data see Table 1; HRESIMS m/z [M + Na]⁺ 589.2025 (calcd for C₃₁H₃₄O₁₀Na⁺ 589.2044).

4.4.2. Exoticoumarin B (2) [8-((R)-2-(((S)-4-(5,7-Dimethoxy-2-oxo-2H-chromen-8-yl)-3-hydroxy-2-methylbutan-2-yl)oxy)-3-hydroxy-3-methylbutyl)-5,7-dimethoxy-2H-chromen-2-one]

White solid; [α]²⁰_D +20 (c 0.1, MeCN); IR (UATR) ν_max 3422, 3081, 2932, 2845, 1712, 1618, 1592, 1569, 1514, 1499 cm⁻¹; UV (MeCN) λ_max (log ε) 323 (0.995), 209 (2.48) nm; ECD (c 1.0 × 10⁻³ M, MeCN) λ_max (Δε) 211 (+0.99), 236 (−2.12), 259 (+1.89), 280 (−0.72), 343 (+2.31); ¹H and ¹³C NMR data see Table 1; HRESIMS m/z [M + Na]⁺ 621.2296 (calcd for C₃₂H₃₈O₁₁Na⁺ 621.2306).

4.4.3. Exoticoumarin C (3) [(S)-1-(5,7-Dimethoxy-2-oxo-2H-chromen-8-yl)-3-hydroxy-3-methylbutan-2-yl (E)-3-(3-((S)-2,3-dihydroxy-3-methylbutyl)-2-hydroxy-4,6-dimethoxyphenyl)acrylate]

Light yellow oil; [α]²⁰_D −33 (c 0.1, MeCN); IR (UATR) ν_max 3406, 2954, 2917, 1703, 1602, 1436, 1407, 1332, 1252, 1084, 993, 736 cm⁻¹; UV (MeCN) λ_max (log ε) 316 (3.36), 247 (1.97), 209 (3.64) nm; ECD (c 1.0 × 10⁻³ M, MeCN) λ_max (Δε) 245 (+5.91), 299 (−12.9), 344 (+3.24) nm; ¹H and ¹³C NMR data see Table 2; HRESIMS m/z [M + Na]⁺ 639.2409 (calcd for C₃₂H₄₀O₁₂Na⁺ 639.2412).

4.4.4. Exoticoumarin D (4) [(S)-1-(5,7-Dimethoxy-2-oxo-2H-chromen-8-yl)-3-hydroxy-3-methylbutan-2-yl (E)-3-(3-((1R,2R)-1,2-dihydroxy-3-methylbut-3-en-1-yl)-2-hydroxy-4-methoxyphenyl)acrylate]

Light yellow oil; [α]²⁰_D −182 (c 0.1, MeCN); IR (UATR) ν_max 3376, 2924, 1704, 1602, 1501, 1436, 1212, 1015, 1042, 963, 808 cm⁻¹; UV (MeCN) λ_max (log ε) 324 (0.14), 203 (0.35) nm; ECD (c 0.6 × 10⁻³ M, MeCN) 202 (+1.28), 248 (−0.37), 293 (−3.70), 343 (−0.08) nm; ¹H and ¹³C NMR data see Table 2; HRESIMS m/z [M + Na]⁺ 607.2133 (calcd for C₃₁H₃₆O₁₁Na⁺ 607.2150).

4.4.5. Exoticoumarin E (5) [(S)-1-(5,7-Dimethoxy-2-oxo-2H-chromen-8-yl)-3-hydroxy-3-methylbutan-2-yl (E)-3-(3-((1S,2S)-1,2-dihydroxy-3-methylbut-3-en-1-yl)-2-hydroxy-4-methoxyphenyl)acrylate]

Light yellow oil; [α]²⁰_D −237 (c 0.1, MeCN); IR (UATR) ν_max 3417, 2927, 2846, 1703, 1601, 1500, 1464, 1434, 1330, 1251, 1212, 1041 cm⁻¹; UV (MeCN) λ_max (log ε) 325 (0.22), 204 (0.55) nm; ECD (c 1.0 × 10⁻³ M, MeCN) 204 (+1.72), 219 (−7.36), 250 (+0.83), 293 (−8.70), 347 (−0.17) nm; ¹H and ¹³C NMR data see Table 2; HRESIMS m/z [M + Na]⁺ 607.2121 (calcd for C₃₁H₃₆O₁₁Na⁺ 607.2150).

4.4.6. Exoticoumarin F (6) [(S)-1-(5,7-Dimethoxy-2-oxo-2H-chromen-8-yl)-3-hydroxy-3-methylbutan-2-yl (E)-3-(2-hydroxy-3-((1R,2R)-2-hydroxy-1-methoxy-3-methylbut-3-en-1-yl)-4-methoxyphenyl)acrylate]

Light yellow oil; [α]²⁰_D −76 (c 0.1, MeCN); IR (UATR) ν_max 3395, 2918, 2849, 1697, 1602, 1264, 734 cm⁻¹; UV (MeCN) λ_max (log ε) 325 (0.38), 200 (0.84) nm; ECD (c 0.8 × 10⁻³ M, MeCN) 203 (+2.95), 220 (−2.41), 248 (+1.39), 294 (−4.26), 346 (+0.56) nm; ¹H and ¹³C NMR data see Table 3; HRESIMS m/z [M + Na]⁺ 621.2279 (calcd for C₃₂H₃₈O₁₁Na⁺ 621.2306).

4.4.7. Exoticoumarin G (7) [(S)-1-(5,7-Dimethoxy-2-oxo-2H-chromen-8-yl)-3-hydroxy-3-methylbutan-2-yl (E)-3-(2-hydroxy-3-((1S,2S)-2-hydroxy-1-methoxy-3-methylbut-3-en-1-yl)-4-methoxyphenyl)acrylate]

Light yellow oil; [α]²⁰_D −80 (c 0.1, MeCN); IR (UATR) ν_max 3344, 2923, 2853, 1707, 1603, 1463, 1253, 1094, 749 cm⁻¹; UV (MeCN) λ_max (log ε) 325 (0.39), 200 (1.04) nm; ECD (c 0.8 × 10⁻³ M, MeCN) 203 (+3.38), 219 (−1.62), 248 (+0.55), 294 (−4.68), 346 (+0.14) nm; ¹H and ¹³C NMR data see Table 3; HRESIMS m/z [M + Na]⁺ 621.2300 (calcd for C₃₂H₃₈O₁₁Na⁺ 621.2306).

4.4.8. Exoticoumarin H (8) [(S)-1-(6-Hydroxy-5,7-dimethoxy-2-oxo-2H-chromen-8-yl)-3-methylbut-3-en-2-yl 3-methylbutanoate]

Light yellow oil; [α]²⁰_D −17 (c 0.1, MeCN); IR (UATR) ν_max 3442, 2935, 1716, 1613, 1512, 1425, 1275, 1247, 1144, 980, 924, 853, 750 cm⁻¹; UV (MeCN) λmax (log ε) 300 (0.22), 205 (0.87); ECD (c 1.0 × 10⁻³ M, MeCN) 226 (+1.40), 283 (−1.02) nm. ¹H and ¹³C NMR data see Table 4; HRESIMS m/z [M + Na]⁺ 413.1565 (calcd for C₂₁H₂₆O₇Na⁺ 413.1571).

4.4.9. Exoticoumarin I (9) [7-Methoxy-8-((1R,2R)-1,2,3,4-tetrahydroxy-3-methylbutyl)-2H-chromen-2-one]

Light yellow oil; [α]²⁰_D 0.1 (c 0.1, MeCN); IR (UATR) ν_max 3343, 2973, 2921, 1637, 1455, 1153, 1082, 1040, 879 cm⁻¹; UV (MeCN) λmax (log ε) 317 (0.98), 203 (3.77); ¹H and ¹³C NMR data see Table 4; HRESIMS m/z [M + Na]⁺ 333.0937 (calcd for C₁₅H₁₈O₇Na⁺ 333.0954).

4.4.10. Exoticoumarin J (10) [(1R,2R)-2-Hydroxy-1-(7-methoxy-2-oxo-2H-chromen-8-yl)-3-methylbut-3-en-1-yl (8Z,11Z)-octadeca-8,11-dienoate]

White solid. [α]²⁰_D −17 (c 0.1, MeCN); IR (UATR) ν_max 3344, 2959, 2112, 1736, 1620, 1597, 1565, 1471, 1438, 1115, 1032, 992 cm⁻¹; UV (MeCN) λ_max (log ε) 319 (1.27), 200 (5.09) nm; ECD (c 0.8 × 10⁻³ M, MeCN) 251 (+1.45), 307 (−2.01) nm; UV (CH₃CN) λmax (log ε) 305 (4.78), 221 (7.45); ¹H and ¹³C NMR data see Table 5; HRESIMS m/z [M + Na]⁺ 561.3174 (calcd for C₃₃H₄₆O₆Na⁺ 561.3187).

4.4.11. Exoticoumarin K (11) [(1R,2R)-1-Hydroxy-1-(7-methoxy-2-oxo-2H-chromen-8-yl)-3-methylbut-3-en-2-yl (10E,12Z)-9-hydroxyoctadeca-10,12-dienoate]

Light yellow oil; [α]²⁰_D −30 (c 0.1, MeCN); IR (UATR) ν_max 3389, 2961, 1716, 1602, 1468, 1332, 1105, 1044 cm⁻¹; UV (MeCN) λ_max (log ε) 319 (1.27), 200 (5.09) nm; ECD (c 0.8 × 10⁻³ M, MeCN) 251 (+1.45), 307 (−2.01) nm; ¹H and ¹³C NMR data see Table 5; HRESIMS m/z [M + Na]⁺ 577.3120 (calcd for C₃₃H₄₆O₇Na⁺ 577.3136).

4.4.12. Exoticoumarin L (12) [(7-Methoxy-2-oxo-2H-chromen-8-yl)methyl 3-methylbutanoate]

Light yellow oil; IR (UATR) ν_max 2974, 1709, 1602, 1504, 1436, 1324, 1234, 1101, 814 cm⁻¹; UV (MeCN) λmax (log ε) 305 (4.78), 221 (7.45); ¹H and ¹³C NMR data see Table 4; HRESIMS m/z [M + Na]⁺ 313.1033 (calcd for C₁₆H₁₉O₅Na⁺ 313.1046).

4.5. X-Ray Crystallographic Analysis of Compound 1

Exoticoumarin A (1) was crystallized from a mixed solvent system (MeCN/H₂O, 5:1) at rt. The X-ray crystallographic data for 1 have already been retrieved at the Cambridge Crystallographic Data Centre, CCDC number: 2520161.

Crystal data for compound 1: C₃₁H₃₄O₁₀, M = 1210.25, a = 13.7650(9) Å, b = 13.7650(9) Å, c = 32.825(2) Å, α = 90°, β = 90°, γ = 90°, V = 6219.5(10) Å3, T = 100 K, space group P41, Z = 4, μ (Ga Kα) = 0.522 mm⁻¹, 71,950 reflections collected, 13,693 independent reflections (R_int = 0.0687). The goodness of fit on F² was 1.057. The final R₁ values were 0.0453 (I > 2σ(I)). The final wR (F²) values were 0.1132 (I > 2σ(I)). The final R₁ values were 0.0530 (all data). The final wR (F²) values were 0.1179 (all data). Flack parameter = 0.06 (11).

4.6. Mo₂(OAc)₄-Induced ECD Experiment

The experiment was performed according to the procedure reported in the literature [37]. First, the sample was dissolved in DMSO to prepare a sample solution with a concentration of 0.5 mg/mL, and a mixed solution of the sample and molybdenum acetate [Mo₂(OAc)₄] was also prepared in DMSO (with a concentration of 0.5 mg/mL). Then, the ECD spectra of the two solutions were measured separately, and the mixed solution should be monitored for 10–30 min to obtain a stable ECD spectrum. Finally, the Mo₂(OAc)₄-induced ECD curve could be calculated by subtracting the ECD of the sample alone.

4.7. Rh₂(OCOCF₃)₄-Induced ECD Experiment

The samples of 6 and 7 (0.5 mg) were dissolved in a dry solution of Rh₂(OCOCF₃)₄ salt (1.0 mg) in CH₂Cl₂ (800 μL). The first ECD spectrum was recorded immediately, and its time evolution was monitored until it became stationary (every 10 min). The inherent ECD was subtracted. The observed signs of the E band at 350 nm in the induced ECD of 6 and 7 were correlated to determine the absolute configuration of C-11′.

4.8. Alkaline Hydrolysis

A sample of 3 (1 mg) was dissolved in 5% aqueous NaOH (5 mL) and stirred at room temperature for 24 h. The reaction mixture was acidified with 1N HCl, extracted with EtOAc, and evaporated in vacuo. The residue was purified by Rp-HPLC (MeCN-H₂O, 43:57, 3 mL/min) to afford 17 (t_R = 11.2 min, 0.4 mg). Compounds 4–7, 10, and 11 were subjected to alkaline hydrolysis following the same procedure described for compound 3.

4.9. ECD Calculations

The details of the quantum chemical ECD calculation for compound 1 are provided in Supplementary Information (see Figures S4 and S5, and Tables S1–S3).

4.10. Cell Culture

The RAW 264.7 murine macrophage cell line was obtained from the Cell Bank of Shanghai Institute of Biochemistry and Cell Biology (Chinese Academy of Sciences, Shanghai, China). Cells were cultured in DMEM supplemented with 10% FBS under standard conditions (5% CO₂ in air in a humidified environment at 37 °C).

4.11. Analysis of NO Production

RAW 264.7 macrophages were plated in 96-well plates at a density of 5 × 10⁴ cells per well and incubated for 24 h. The cells were subsequently treated for 24 h with various concentrations of compounds in the presence or absence of LPS (1.5 μg/mL). The NO concentration in the culture medium was determined by a Griess reagent kit. The absorbance at 540 nm was measured with a multifunction microplate reader. Quercetin was used as a positive control in experiments. The experiments were performed in triplicate, and data are presented as the mean ± SD.

4.12. Cytotoxicity Assay

RAW 264.7 cells were seeded in 96-well plates at a density of 5 × 10⁴ cells per well and allowed to adhere for 24 h. After that, cells were exposed to a range of compound concentrations for an additional 24 h. Subsequently, cell viability was assessed using the Cell Counting Kit-8 (CCK-8; Dojindo, Kumamoto, Japan) in accordance with the manufacturer’s protocol by measuring the luminescence signal. All treatments were plated in triplicate wells, and experiments were repeated three times.

4.13. qRT-PCR Analysis

Total RNA extracted from Raw264.7 cells was subjected to a RNeasy Mini Kit (Yeasen, Shanghai, China), and reverse transcription was performed to generate cDNA templated using Hifair II first Strand cDNA Synthesis SuperMix (Yeasen). Quantitative RT-PCR was performed using a SYBR Green Master Mix (Yeasen). Sequence-specific primers were synthesized by Sangon, and GAPDH was used to normalize the relative level of each transcript. Samples were analyzed in triplicate using a LightCycler 480 System (Roche, Shanghai, China). For quantitative analysis, all samples were analyzed by using the ΔΔCT value method. The PCR primers are described below:

iNOS-forward primer: GGTGAAGGGACTGAGCTGTT

iNOS-reverse primer: ACGTTCTCCGTTCTCTTGCAG

GAPDH-forward primer: CTGGGCTACACTGAGCACC

GAPDH-reverse primer: AAGTGGTCGTTGAGGGCAATG

4.14. Western Blotting Analysis

RAW264.7 cells were plated in 35 mm dishes at a density of 8 × 10⁵ cells per dish. Cells were treated with or without compound 1 prior to being stimulated with LPS (1.5 μg/mL). Then, the cells were washed twice with ice-cold PBS and lysed with RIPA buffer (Beyotime, Shanghai, China), which contained 150 mM NaCl, 50 mM Tris (pH 7.4), 1% (w/v) sodium deoxycholate, 1% (v/v) Triton X-100, 0.1% (w/v) SDS, 1 mM EDTA, 10 μM PMSF, and a phosphatase inhibitor cocktail (Roche, Basel, Switzerland). The lysates were centrifuged at 12,000× g for 15 min, and the protein concentration of the resulting supernatant was quantified using a BCA protein assay kit (Beyotime, China). Proteins (30 μg) from supernatant were subjected to 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) to separate, and then they were transferred to PVDF membranes (Millipore, Billerica, MA, USA). Nonspecific binding sites on the membranes were blocked with 5% skimmed milk at room temperature for 1 h. Blocked membranes were incubated overnight with specific primary antibodies for GAPDH, iNOS, COX-2, ERK1/2, phospho-ERK1/2, JNK, and phospho-JNK at 4 °C. After washing in triplicate in TBST, membranes were incubated with the appropriate HRP-conjugated secondary antibodies for 1 h at room temperature. Immunoreactive bands were detected using an enhanced chemiluminescence Western blotting kit (Sigma, St. Louis, MI, USA), and band intensities were analyzed with ImageJ software (Version 1.53t, National Institutes of Health, Bethesda, MD, USA).

4.15. Statistical Analysis

A statistical evaluation was performed by the analysis of t-tests using GraphPad Prism 10. Values of the different tested parameters within each group are presented as the mean ± SD (n = 3). The IC₅₀ values were calculated by nonlinear regression in GraphPad Prism 10. Statistical significance was defined as ^# p < 0.05, ^## p< 0.01, ^### p < 0.001 or * p < 0.05, ** p < 0.01, *** p < 0.001, or **** p < 0.0001 with respect to the control group or LPS group.

5. Conclusions

In summary, a comprehensive phytochemical investigation of the roots of M. exotica led to the isolation and structural characterization of 20 coumarins, including 12 new compounds designated as exoticoumarins A–L (1–12). A biological evaluation revealed that exoticoumarins A and K (1 and 11) are the most potent anti-inflammatory agents, exhibiting superior efficacy compared to the positive control, quercetin. Mechanistically, our studies demonstrated that the inflammatory activity of 1 is associated with the suppression of the MAPK signaling pathway, particularly by inhibiting JNK phosphorylation, which subsequently downregulates the expression of iNOS at both transcriptional and translational levels. Collectively, by enriching the structural diversity of coumarins from M. exotica and elucidating the anti-inflammatory mechanism of exoticoumarin A (1), this work not only provides a pharmacological basis for the traditional application of M. exotica but also highlights 1 as a promising anti-inflammatory lead for further development.