Enzyme-Assisted Dendrobium officinale Polysaccharides Enhance Keratinocyte Proliferation and Accelerate Cutaneous Wound Healing

Abstract

Dendrobium polysaccharides (DOPs) have been demonstrated to possess protective activities against UVB-induced skin damage and oxidative stress, but their role in wound healing remains unexplored. This study employed multiple enzymatic hydrolysis methods to prepare Dendrobium polysaccharide hydrolysates and systematically evaluated their wound-healing activity and molecular mechanisms in an in vitro HaCaT keratinocyte model and an in vivo mouse wound model. In vitro results demonstrated that enzymatically extracted DOPs promoted the proliferation and migration of HaCaT keratinocytes, with the composite enzymatic product (D-ceh) exhibiting optimal efficacy. Mechanistic analyses revealed that D-ceh activated the NF-κB signaling pathway and upregulated pro-inflammatory cytokines, thereby enhancing keratinocyte proliferation and migration. In vivo experiments demonstrated that D-ceh considerably enhanced collagen deposition and extracellular matrix remodeling, accelerating wound closure. These findings reveal that enzymatically processed DOPs have potential therapeutic value in accelerated skin wound healing, and the NF-κB signaling pathway plays a pivotal role in its biphasic regulation, promoting inflammation in the early phase and remodeling in the mid-to-late phase, thereby supporting the clinical development prospects of DOPs as natural wound healing promoters.

1. Introduction

Acute skin injuries, including thermal burns, surgical incisions, cosmetic procedure-related wounds, abrasions, and accidental trauma, are common in daily life [1]. Although most wounds can heal spontaneously, improper healing may result in excessive scar formation, impaired aesthetics, or functional deficits, causing substantial physical and psychological distress and imposing considerable economic burden [2,3]. When the skin barrier is disrupted by acute injury, the body initiates a tightly regulated and multistage repair process involving hemostasis, inflammation, cell proliferation, cell migration, angiogenesis, and extracellular matrix (ECM) remodeling [4]. Dysregulation at any stage of this process may result in delayed wound closure, chronic nonhealing wounds, or excessive scarring, including hypertrophic scars and keloids, ultimately compromising the integrity and function of the skin barrier [3]. During this process, the synergistic interaction between early pro-inflammatory signals and subsequent keratinocyte and fibroblast proliferation and migration is considered a key factor determining the speed and quality of healing [5,6].

Some agents, such as recombinant human epidermal growth factor (rh-EGF) and basic fibroblast growth factor, have been employed to accelerate wound healing, but their prolonged or uncontrolled use may lead to adverse complications, including epidermal hyperplasia and excessive scar formation [7]. Therefore, safe and effective natural alternatives that support wound healing are urgently needed [8]. Natural polysaccharides possess excellent biocompatibility and multiple biological activities, including immunomodulation, antioxidant effects, and tissue regeneration, and have thus attracted considerable interest [9]. Biomaterials, such as alginates [10] and Bletilla striata polysaccharides [11], promote wound repair by activating TGF-β/Smad [12], PI3K/Akt [13], and MAPK/ERK pathways [14], thereby regulating inflammation [15], angiogenesis [16], and oxidative stress [17]. These features demonstrate their promising applications in skin healing.

DOPs possess antioxidant activity and can maintain skin barrier homeostasis [18]. However, their role and mechanisms in the regulation of inflammation, cell proliferation, and migration during acute wound healing have not been reported. In this study, an enzymatic hydrolysis strategy for preparing Dendrobium polysaccharide hydrolysates (EHWE) with enhanced bioactivity was proposed [19]. Their wound healing-promoting effects and underlying molecular mechanisms were systematically investigated using in vitro cell models and in vivo mouse wound models. The result would provide experimental evidence and a theoretical basis for the development of DOPs as natural wound healing promoters.

2. Results

2.1. Preparation of Dendrobium officinale Polysaccharides and Their Effects on HaCaT Cell Proliferation and Migration

DOPs were prepared using hot-water extraction, single enzyme-assisted extraction, and composite enzyme-assisted extraction, and their biological activities in wound healing-related models were investigated.

To mimic the inflammatory microenvironment associated with skin injury, TNF-α was employed for a damage model in HaCaT keratinocytes. A dose–response analysis (0–100 ng/mL) revealed that TNF-α reduced cell viability in a concentration-dependent manner. At 100 ng/mL, cell viability decreased by approximately 50.3%, indicating excessive cytotoxicity that may not reflect the moderate inflammatory conditions typically observed during early-stage wound healing. In contrast, treatment with 25 ng/mL TNF-α reduced cell viability to 71.7%, representing a moderate and potentially reversible suppression without severe cell damage. Therefore, 25 ng/mL was selected for subsequent experiments to establish a physiologically relevant inflammatory injury model (Figure S1). Upon treatment with 250 μg/mL DOPs, CCK-8 assays demonstrated that all polysaccharide fractions effectively restored TNF-α-suppressed cell proliferation without inducing cytotoxicity (Figure 1A). EdU incorporation and Western blot analyses revealed that DOPs promoted HaCaT cell proliferation, and the composite enzyme-assisted fraction (D-ceh) exhibited the most pronounced effect (Figure 1B,C and Figure S2). Transwell assays demonstrated enhanced cell migration after enzyme-assisted extraction, with the D-ceh group exhibiting a 72.97% increase in migrated cells (Figure 1D and Figure S3). Consistently, scratch wound assays showed that DOPs markedly accelerated wound closure, with the migration rate increasing from 42.16% to 68.02% in the D-ceh group (Figure 1E and Figure S4). Although the D-w group showed a migration rate comparable to that of the D-ceh group, proliferation-related assays (CCK-8, EdU, and PCNA expression) indicated a weaker proliferative effect compared with enzyme-assisted extracts. These findings suggest that different extraction methods may differentially regulate keratinocyte proliferation and migration.

Overall, these results indicate that DOPs can promote the proliferation and migration of keratinocytes, and these activities are enhanced by enzymatic treatment, especially after composite enzymatic treatment.

2.2. DOPs Promote Cell Repair Functions by Regulating Inflammatory Cytokine Expression Through the NF-κB Pathway

Moderate inflammatory responses play a critical regulatory role in cell proliferation and migration. To investigate whether DOPs modulate cellular behavior through inflammatory cytokines, we assessed their effects on IL-6, IL-8, and TNF-α expression in HaCaT cells. ELISA results demonstrated that the enzyme-assisted extraction of DOPs considerably elevated the levels of these cytokines, particularly the D-ceh fraction, which increased IL-6, IL-8, and TNF-α expression levels by 53.45%, 191.47%, and 669.84%, respectively. This increase in TNF-α reflects endogenous cytokine production associated with activation of inflammatory signaling pathways rather than the cytotoxic effects induced by exogenous TNF-α. By contrast, the nonenzymatically treated D-w fraction showed no considerable effect (Figure 2A–C). These findings suggest that enzymatically treated DOPs promote wound healing by enhancing specific inflammatory pathways. Subsequently, RNA sequencing analysis revealed that DOPs activated the NF-κB signaling cascade and associated cytokine networks in the HaCaT cells, indicating the pathway’s crucial role in the mediation of DOP-induced pro-inflammatory and reparative responses (Figure 2D,E and Figure S5). The subsequent Western blot analysis confirmed that the DOPs promoted IκBα phosphorylation, ubiquitin-mediated degradation, and the nuclear translocation of p65. The composite enzyme-treated DOPs (D-ceh) exhibited the most pronounced effects, and nuclear p65 phosphorylation levels increased by 135% (Figure 2F). These findings suggest that DOPs enhance keratinocyte proliferation and migration by further activating the NF-κB signaling pathway, leading to the upregulation of inflammatory cytokines and accelerated wound healing.

2.3. Validation of the Key Role of the NF-κB Signaling Pathway in DOP-Mediated Cell Repair

The role of the NF-κB signaling pathway in the mediation of DOP-induced cellular responses was validated using the NF-κB inhibitor BAY-11-7082 (MCE, Monmouth Junction, NJ, USA). The inhibition of the NF-κB pathway by BAY-11-7082 led to a considerable decrease in the concentrations of DOP-induced pro-inflammatory cytokines, including IL-6 and IL-1β (Figure 3A–D). Concurrently, scratch assays demonstrated that BAY-11-7082 markedly attenuated DOP-promoted wound healing (Figure 4E and Figure S6).

To further validate the central role of p65, we transfected p65-targeting siRNA into HaCaT cells to knock down p65 expression (Figure 3F and Figure S7). p65 knockdown not only eliminated the DOP-induced upregulation of inflammatory cytokines but also considerably suppressed DOP-mediated cell proliferation and migration (Figure 3G and Figure S8). EdU incorporation assays and immunofluorescence analyses consistently demonstrated that the reparative effects of DOP were markedly attenuated in p65-knockdown cells. Pharmacological inhibition and siRNA-mediated gene knockdown experiments confirmed that DOPs promote keratinocyte proliferation and migration by further activating the NF-κB pathway, thereby facilitating p65 nuclear translocation and upregulating inflammatory cytokine expression (Figure 3). These findings provide definitive mechanistic evidence elucidating how DOPs promote wound healing.

2.4. D-Ceh Promotes Keratinocyte Proliferation and Accelerates Full-Thickness Skin Wound Healing

In vitro experiments demonstrated that D-ceh exhibited the most potent effects on keratinocyte proliferation and migration. To further evaluate its in vivo reparative potential, a full-thickness skin defect model in mice was established (Figure 4A,B). Wound closure analysis showed that D-ceh markedly accelerated healing, and notable effects were observed at concentrations starting from 2 mg/cm³. From day 11 onward, all the D-ceh-treated groups exhibited considerably higher wound closure rates than the control group (Figure 4C and Figure S9). Histological examination revealed enhanced re-epithelialization and regenerative capacity in D-ceh-treated wounds, wound width decreased, and epidermal thickness approached normal levels. Notably, the healing outcomes of the high-dose D-ceh group (D-ceh-high) were superior to those of the clinically used positive control rh-EGF (Figure 4D and Figure S10). Immunohistochemical analysis confirmed the upregulation of PCNA expression at the wound margins, indicating that D-ceh facilitates tissue repair by promoting keratinocyte proliferation (Figure 4E and Figure S11). Granulation tissue from the D-ceh-high group exhibited considerably elevated collagen deposition, which showed 3.29- and 1.29-fold increases relative to collagen deposition in the control and rh-EGF groups, respectively (Figure 4F and Figure S12). Overall, these results indicate that D-ceh effectively promotes full-thickness skin wound healing by enhancing keratinocyte proliferation, re-epithelialization, and collagen synthesis.

2.5. D-Ceh Promotes Skin Regeneration by Regulating Collagen Deposition and Matrix Balance

To investigate the role of D-ceh in the tissue remodeling phase, we analyzed ECM dynamics in the later stages of wound healing. Immunofluorescence colocalization in mouse skin tissue at day 7 post-injury revealed a notable reduction in MMP-9/TIMP-1 expression ratio in the D-ceh-treated group, and MMP-9 levels stabilized (Figure 5C and Figure S15). This result indicates that D-ceh helps maintain the balance of the metalloproteinase/inhibitor system, thereby preventing excessive ECM degradation. Immunohistochemical analysis at day 14 post-injury further demonstrated that high-dose D-ceh (D-ceh-high) significantly enhanced type I collagen expression and increased α-SMA levels 3.93-fold relative to the control, reaching 77% of the levels observed in the rh-EGF group (Figure 5A,B, Figures S13 and S14). Collectively, these results suggest that D-ceh promotes myofibroblast differentiation and matrix contraction, ultimately improving the mechanical strength of regenerated skin tissue.

3. Discussion

Enzymatic treatment has been widely reported to enhance the biological activity of natural polysaccharides, as supported by in vitro and in vivo studies. Rather than serving solely as a processing strategy, enzymatic modification plays a critical role in the identification of polysaccharide structure and biological function. Zhang et al. [20] reported that composite enzymatic degradation using cellulase and papain reduced the molecular weight of shiitake mushroom polysaccharides from approximately 650 kDa to 35–90 kDa, resulting in a 2.3–2.8-fold increase in TNF-α and IL-6 secretion in RAW264.7 macrophages. This enhancement was closely associated with increased exposure of reducing ends after polysaccharide depolymerization. Similarly, Seo et al. [21] demonstrated that the enzymatic hydrolysis of ginseng residue polysaccharides generated low-molecular-weight oligosaccharides that markedly enhanced macrophage immune activity and elevated cytokine secretion and phagocytic capacity, which was mechanistically linked to activation of the TLR2/MerTK signaling pathway. In the present study, complex enzyme-hydrolyzed DOPs (D-ceh) promoted keratinocyte proliferation and migration at a concentration of 250 μg/mL (Figure 1) and induced an early inflammatory response characterized by the upregulation of repair-related cytokines (Figure 2), exerting a pronounced pro-regenerative effect. Notably, although the D-w fraction exhibited a relatively high migration rate in the scratch assay, its proliferative activity was lower than that of enzyme-assisted extracts. This discrepancy may be explained by the distinct regulatory mechanisms governing cell migration and proliferation during wound healing. The migration and proliferation of keratinocytes are somewhat independent biological processes. When injury occurs, compressed cells relax to fill the damaged area; therefore, an enhanced ability to migrate is not necessarily associated with an increased ability to proliferate [22,23]. One possible explanation is that differences in the physicochemical properties of polysaccharides, particularly molecular weight distribution and structural characteristics, may preferentially promote cell migration rather than regulate the cell cycle [24]. Molecular weight analysis further revealed that composite enzymatic hydrolysis markedly reduced the number-averaged molecular weight (Mn), peak molecular weight (Mp), and weight-average molecular weight (Mw) of the DOPs, and Mn decreased from 79,827 to 16,731, Mp shifted from 96,416 to 14,283, and Mw decreased from 89,509 to 42,703 (File S1). The proportion of low- and medium-molecular-weight fractions increased substantially, and the overall molecular weight distribution shifted toward the low-molecular-weight region. These structural changes may contribute to the enhanced biological activity of D-ceh, as lower molecular weight polysaccharides are generally more bioavailable and may facilitate cellular uptake and signaling activation, thereby promoting keratinocyte proliferation and migration [25].

Early pro-inflammatory response plays a critical role in acute wound healing, facilitating the release of growth factors, promoting angiogenesis, and supporting granulation tissue formation [26]. However, excessive or persistent inflammation is detrimental because it may lead to tissue damage, abnormal collagen deposition, delayed wound closure, and hypertrophic scarring [27]. Moderate levels of TNF-α are known to participate in early inflammatory signaling during wound healing, whereas excessive concentrations may induce cytotoxic damage and impair tissue repair [26]. It should be noted that the TNF-α used for model establishment was applied as an exogenous stimulus at a relatively high concentration to induce an inflammatory injury state, thereby reducing cell viability. In contrast, the increased TNF-α observed following DOP treatment represents endogenous cytokine production at physiologically relevant levels. These distinct contexts may lead to different biological outcomes: moderate, endogenously regulated TNF-α is involved in initiating early inflammatory responses that support tissue repair, whereas excessive exogenous TNF-α can exert cytotoxic effects and impair cell function [28,29]. Notably, we observed that although DOPs enhanced keratinocyte proliferation and migration by activating the NF-κB signaling pathway, leading to increased inflammatory cytokine expression and accelerated wound healing, enhanced collagen deposition and PCNA-mediated cell proliferation [30,31] and the early regulation of the MMP-9/TIMP-1 balance [32], DOPs did not induce sustained inflammatory activation (Figure 4E,F and Figure 5C). The disruption of the MMP-9/TIMP-1 balance results in aberrant collagen deposition and impaired tissue remodeling in various skin pathologies [33], underscoring the importance of tightly controlled ECM turnover during wound repair [34]. Consistent with these findings, the controlled modulation of the MMP-9/TIMP-1 axis observed in this study likely contributed to optimized collagen deposition and improved tissue remodeling. These findings indicate that DOPs do not induce sustained inflammation but exhibit distinct stage-specific regulatory characteristics. A moderate pro-inflammatory response in the early phase promotes keratinocyte proliferation and migration, followed by enhanced ECM remodeling and tissue maturation in the mid-to-late phases. This biphasic regulatory pattern, characterized by early pro-inflammatory activation and subsequent pro-remodeling effects, is the DOPs’ key feature facilitating efficient wound repair.

Although this regulatory feature has been observed in the present study and in related investigations, the signaling mechanisms underlying this process remain unknown. In this study, KEGG enrichment analysis of the HaCaT cell transcriptome identified the NF-κB signaling pathway as a potential core pathway mediating DOP-induced pro-inflammatory responses (Figure 2D,E). This hypothesis was further supported by experimental evidence at the protein and cytokine levels. ELISA assays revealed the marked upregulation of inflammation-related cytokines, including IL-6, IL-8, and TNF-α, and Western blot analysis confirmed increased expression levels of key NF-κB pathway-associated proteins (Figure 2A–C,F). Notably, the pharmacological inhibition or siRNA-mediated silencing of this pathway not only attenuated the early cytokine response but also markedly suppressed DOP-induced keratinocyte proliferation and migration (Figure 3), highlighting the essential role of NF-κB signaling in the mediation of the biological effects of DOPs in HaCaT cells. Mechanistically, the enhanced activation of the NF-κB pathway led to the elevated levels of pro-inflammatory cytokines, such as IL-6 and IL-8. On the one hand, these cytokines promote rapid keratinocyte proliferation and facilitate directional migration toward the wound edge. On the other hand, they contribute to subsequent collagen synthesis, ECM remodeling, and restoration of tissue architecture, thereby accelerating the overall wound healing process (Figure 5). Therefore, NF-κB plays a pivotal role in the biphasic regulation of DOPs, promoting inflammation in the early phase and remodeling in the mid-to-late phase. However, it is important to note that the inflammatory response is highly context-dependent and requires tight regulation. While transient activation of NF-κB signaling is essential for initiating early wound healing processes, excessive or prolonged activation may lead to chronic inflammation, delayed healing, or aberrant extracellular matrix remodeling. Sustained elevation of pro-inflammatory cytokines, such as IL-6, IL-8, and TNF-α, has been associated with impaired wound resolution and pathological fibrosis. Therefore, the beneficial effects of DOPs are likely contingent upon a precisely controlled, temporally regulated activation of NF-κB signaling, highlighting the need for further investigation into the dose- and time-dependent modulation of this pathway.

Traditional views consider NF-κB primarily as a regulator of immune responses in immune cells [35,36]. By contrast, our results indicate that NF-κB plays a central role in keratinocyte-mediated tissue repair. This finding broadens our understanding of skin healing and highlights the importance of inflammatory signaling via NF-κB in the coordination of cell proliferation and tissue regeneration.

Despite these mechanistic insights and biological significance, several limitations of the present study should be acknowledged. The wound healing effects of DOPs were evaluated using a murine model, and the translational relevance to human skin physiology requires further validation. From a translational perspective, the biphasic regulatory property of DOPs—characterized by controlled early inflammatory activation followed by enhanced extracellular matrix remodeling—highlights their potential as functional biomaterials for wound healing applications. DOPs may serve as promising candidates for wound dressings, regenerative therapeutics, or advanced skincare products. However, further studies focusing on dosage optimization, formulation development, long-term safety, and clinical validation are necessary before practical or commercial applications can be realized. Collectively, these findings provide both mechanistic insights and translational potential for the development of DOP-based therapeutic strategies for skin wound repair.

4. Materials and Methods

4.1. Materials

Whole stems of Dendrobium officinale were obtained from Yipintang Biotechnology Co., Ltd. (Hefei, China); Phosphate-Buffered Saline, Triton X-100, 4% Paraformaldehyde Fix Solution, and crystal violet staining solution were acquired from Beijing Solarbio Co., Ltd. (Beijing, China); Isopentane was procured from Merck KGaA, Darmstadt, Germany; Cellulase (50,000 U/g), neutral protease (80,000 U/g), and pectinase (50,000 U/g) were all purchased from Xia Sheng Group (Beijing, China).

4.2. Extraction of DOPs

The Dendrobium officinale stems were thoroughly washed to remove impurities, dried in a 60 °C oven for 10 days, and then ground into a fine powder. This powder was subsequently sieved through a 100-mesh screen to obtain a uniform powder with particles approximately 150 μm in diameter. Polysaccharides were extracted using two methods: hot-water extraction (HWE) and enzyme-assisted hot-water extraction (EHWE) with either single enzymes (protease, cellulase, pectinase) or a mixture of the three enzymes (protease, pectinase, and cellulase) [37]. The powder was suspended in distilled water at a solid–liquid ratio of 1:80 (w/v). For HWE, powder was suspended in distilled water and extracted at 70 °C for 3 h to obtain sample D-w. For enzyme-assisted hot-water extraction (EHWE), the powder was enzymatically hydrolyzed at 50 °C for 3 h under the optimal pH conditions specific to each enzyme. The total enzyme loading was 8% (w/w) relative to the DOPs content. Based on the enzyme applied, three fractions were obtained and designated as D-nph (neutral protease), D-ch (cellulase), and D-ph (pectinase), respectively. For the composite enzyme-assisted extraction, a mixture of protease, pectinase, and cellulase was applied at a ratio of 2:1:1 (w/w), yielding the composite enzyme-assisted polysaccharide fraction (D-ceh) [38]. After extraction, the mixtures were filtered through a membrane filter (0.45 μm pore size). The mixtures were concentrated and then subjected to freeze-drying, resulting in the polysaccharides.

4.3. In Vitro Investigation of the Skin-Healing Effects of Dendrobium-Derived Polysaccharides

4.3.1. Cultivation of Cells and Inflammation Model Establishment

HaCaT cells (Pruosai Life Science, Wuhan, China) were cultured in DMEM with 10% FBS, 100 U/mL penicillin, and 0.1 mg/mL streptomycin at 37 °C in 5% CO₂. To mimic the inflammatory microenvironment associated with skin injury, TNF-α was employed to establish a damage model in HaCaT cells. Cell viability was assessed using the CCK-8 assay (Biosharp, Beijing, China) by measuring absorbance at 450 nm after 2 h of incubation.

4.3.2. Cell Proliferation and Migration Assays

Cell proliferation was analyzed using EdU (Beyotime, Shanghai, China). Migration was evaluated via scratch and Transwell assays. For the scratch assay, HaCaT cells were seeded into 6-well plates and cultured for 24 h until reaching approximately 90% confluence. A sterile 200 μL pipette tip was used to create linear scratches across the cell monolayer. The detached cells were removed by washing with PBS, and fresh complete medium containing 25 ng/mL TNF-α was added for 2 h to induce inflammatory conditions. Subsequently, cells were treated with DOPs (250 μg/mL) and incubated for 24 h. Images of the same wound area were captured at 0 h and 24 h under a microscope, and wound closure was quantified by measuring the wound area. For Transwell assays, cells were seeded in the upper chamber using serum-free medium, while the lower chamber was filled with complete medium containing DOPs as the chemotactic factor. Cultures were incubated for 24 h. Cells were then fixed and stained with crystal violet, and those that did not migrate through the pores were gently removed using a cotton swab. The total number of migrating cells was counted by visualizing the bottom of the upper chamber through a microscope and taking photographs.

4.3.3. ELISA

Cell culture supernatants were centrifuged and stored at −80 °C. IL-1β, IL-6, IL-8, and TNF-α levels were measured using ELISA. Kits from NOUVS (Centennial, CO, USA) were used, and absorbance was read at 450 nm to determine cytokine concentrations.

4.3.4. RNA Sequencing and Bioinformatics Analysis

HaCaT cells were exposed to 25 ng/mL TNF-α in combination with 250 μg/mL DOPs for a period of 24 h. RNA was extracted and quantified using a Qubit fluorometer. Polyadenylated RNA was isolated with oligo(dT) beads, and cDNA libraries were subsequently prepared. Sequencing analysis was carried out with the Illumina platform. We identified DEGs with q-value < 0.05 and |Fold Change| > 2 and performed KEGG-based pathway enrichment analysis.

4.3.5. Western Blot

Western blotting was performed to assess the protein expression levels of PCNA, total p65, phosphorylated p65, p65(N), IκBα, β-actin, GAPDH, and Lamin B1. Cells were lysed to extract cytoplasmic and nuclear proteins. After centrifugation, protein concentrations were determined using a BCA kit(Thermo Fisher, Waltham, MA, USA). A total of 20 µg of denatured protein was applied to SDS-PAGE gels for separation and subsequently transferred to PVDF membranes. The membranes were incubated with the appropriate primary and secondary antibodies. Protein bands were visualized using enhanced chemiluminescence (ECL) and quantified with ImageJ 1.54p (National Institutes of Health, Bethesda, MD, USA).

4.3.6. siRNA Transfection

HaCaT cells were transiently transfected with 50 nM NF-κB p65 siRNA or negative control siRNA (RIBOBIO, Guangzhou, China) using Lipofectamine 3000 (Thermo Fisher, Waltham, MA, USA). After 6 h, the cells were resuspended in fresh medium and cultured for an additional 36 h. Subsequently, DOPs were added for 24 h prior to subsequent experiments.

4.3.7. Real-Time Fluorescent Quantitative PCR (qRT-PCR) Analysis

Total RNA was extracted using the FastPure RNA Kit (Vazyme, Nanjing, China) and reverse transcribed into cDNA. Quantitative real-time PCR was performed using ChamQ SYBR qPCR Master Mix (Vazyme, Nanjing, China) on a LightCycler system. The selected genes were involved in inflammatory regulation and NF-κB signaling-related responses. Gene expression levels were normalized to β-actin and calculated using the ΔΔCT. Primer sequences were listed in

Table 1. Primer sequences used for quantitative real-time PCR (qRT-PCR).

Gene Name	Forward (5′–3′)	Reverse (5′–3′)
p65 (human)	GGCTATCAGTCAGCGCATCC	CCCACGCTGCTCTTCTTGGAA
IL-6 (human)	CCTTCTCCACAAGCGCCTTC	CAGGCAACACCAGGAGCAG
β-actin (human)	CCTTTGCCGATCCGCCG	GATATCATCATCCATGGTGAGCTGG

.

4.3.8. NF-κB Signaling Pathway Inhibition Assay

NF-κB inhibition experiments were conducted using BAY 11-7082 (5 μM) [39]. Briefly, cells were seeded in culture plates for 24 h, followed by treatment with BAY 11-7082 (MCE, USA) for 2 h. After adding TNF-α (25 ng/mL) for 2 h of induction, different DOPs (250 μg/mL) were added for subsequent treatment before proceeding with further experiments [40].

4.4. In Vivo Wound Healing Evaluation and Tissue-Based Analyses

4.4.1. Experimental Animals and Full-Thickness Skin Wound Model

Six-week-old male C57BL/6 mice (230 ± 20 g, SPF) were acclimated for 2 weeks. Mice were anesthetized, dorsal hair removed, and a 6 mm full-thickness wound created. All procedures were approved by TIO Ethics Committee (TIO-IACUC-04-2025-07-09) and followed national guidelines.

Mice were randomly assigned to different treatment groups. Wound measurements and histological analyses were performed in a blinded manner by investigators unaware of group allocation. The sample size (n = 6 per group) was determined based on previous studies employing similar wound-healing models and practical considerations.

4.4.2. Wound Healing Assessment and Tissue Collection

Medication was applied topically or injected into the wound site every 48 h, and wounds were maintained moist and sterile using 3M dressings. Wound closure progression was analyzed using ImageJ software on images captured at 0, 3, 7, 11, and 13 days. The wound closure rate was calculated using the following formula:

$$Wound closure rate ={\displaystyle \frac{Initial area-Area on Day n}{Initial area}} \times 100\%$$

On days 7 and 14, euthanasia was performed, and 1 × 1 cm wound tissue and surrounding skin were harvested for histological and collagen deposition analysis.

4.4.3. Histological Staining Analysis

All mice (n = 30) were euthanized 14 days after wound creation. No animals were excluded from the analysis. Full-thickness skin specimens (1 × 1 cm) encompassing the wound and adjacent tissue were harvested, fixed in 4% paraformaldehyde, embedded in paraffin, and cut into 5 μm sections. For histological evaluation, sections were deparaffinized, rehydrated, and stained with hematoxylin and eosin (H&E) to assess epidermal regeneration, inflammatory infiltration, and re-epithelialization. Wound width and re-epithelialization were quantified using ImageJ software.

To analyze collagen deposition and extracellular matrix remodeling, adjacent sections were subjected to Masson’s trichrome staining. Collagen distribution and staining intensity within the wound area were quantitatively analyzed using ImageJ.

4.4.4. Immunohistochemical and Immunofluorescence Analysis

Skin tissues were collected from mice (n = 30) on days 7 and 14 post-surgery, fixed, paraffin-embedded, and sectioned at 5 μm. For immunohistochemical staining, sections were deparaffinized, rehydrated, treated with 3% H₂O₂ to block endogenous peroxidase, and subjected to antigen retrieval. Sections were incubated overnight at 4 °C with primary antibodies against collagen I and α-SMA (1:200), followed by HRP-conjugated secondary antibodies and DAB visualization. Positive staining was quantified using ImageJ IHC Profiler.

For immunofluorescence analysis, sections were blocked with 4% BSA, incubated with primary antibodies overnight, followed by Alexa Fluor 488-labeled secondary antibodies and DAPI counterstaining. Images were captured using confocal microscopy and analyzed with ImageJ.

4.5. Statistical Data Analysis

Statistical analyses were conducted using OriginPro 2021 (OriginLab, Northampton, MA, USA) and GraphPad Prism 10 (GraphPad Software, San Diego, CA, USA). One-way or two-way ANOVA and Student’s t-tests were applied, and data are expressed as mean ± SEM.

5. Conclusions

This study demonstrates that enzyme-assisted extraction markedly enhances the bioactivity of DOPs. The results indicate that DOPs can further activate the NF-κB signaling pathway, promote p65 nuclear translocation, and increase the expression of key inflammatory cytokines, including IL-6, IL-8, and TNF-α. These effects contribute to enhanced collagen deposition and ECM remodeling, thereby accelerating wound healing. Notably, the complex enzyme-hydrolyzed DOPs (D-ceh) are superior to rh-EGF in terms of wound healing efficacy. Overall, these findings reveal a novel mechanism by which DOPs promote skin repair through the precise modulation of inflammatory responses and provide a strong rationale for the development of DOPs as a natural therapeutic agent for restoring skin barrier integrity.