Effects of Perfluorotetradecanoic Acid (PFTeDA) and Biostimulants on Soil Bacterial Community Structure and Diversity and the Growth of Amaranthus cruentus
Abstract
1. Introduction
2. Results
2.1. Bacterial Community Composition in Response to Perfluorotetradecanoic Acid and Biostimulants
2.2. Response of Amaranthus cruentus to Perfluorotetradecanoic Acid and Biostimulants
3. Discussion
3.1. Bacterial Community Composition in Response to Perfluorotetradecanoic Acid and Biostimulants
3.2. Response of Amaranthus cruentus to Perfluorotetradecanoic Acid and Biostimulants
4. Materials and Methods
4.1. Experimental Design
4.2. Reference Soil and Its Characteristics
4.3. Characteristics of Perfluorotetradecanoic Acid and Biostimulants
4.4. DNA and Bioinformatics Analysis
4.5. Data Processing and Statistical Analyses
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| PFAS | Perfluoroalkyl and polyfluoroalkyl substances |
| PFTeDA | Perfluorotetradecanoic acid |
| C | Control soil |
| P | Soil treated with perfluorotetradecanoic acid |
| C_S | Soil with the addition of the biostimulant Shigeki |
| C_A | Soil with the addition of the biostimulant Aminoprim |
| P_S | Soil treated with perfluorotetradecanoic acid and with the addition of the biostimulant Shigeki |
| P_A | Soil treated with perfluorotetradecanoic acid and with the addition of the biostimulant Aminoprim |
| ASV | Amplicon Sequence Variant |
| SPAD | The leaf greenness index |
References
- Glüge, J.; Scheringer, M.; Cousins, I.T.; DeWitt, J.C.; Goldenman, G.; Herzke, D.; Lohmann, R.; Ng, C.A.; Trier, X.; Wang, Z. An overview of the uses of per-and polyfluoroalkyl substances (PFAS). Environ. Sci. Process. Impacts 2020, 22, 2345–2373. [Google Scholar] [CrossRef] [PubMed]
- Kwiatkowski, C.F.; Andrews, D.Q.; Birnbaum, L.S.; Bruton, T.A.; DeWitt, J.C.; Knappe, D.R.U.; Maffini, M.V.; Miller, M.F.; Pelch, K.E.; Reade, A.; et al. Scientific basis for managing PFAS as a chemical class. Environ. Sci. Technol. Lett. 2020, 7, 532–543. [Google Scholar] [CrossRef] [PubMed]
- Cao, L.; Xu, W.; Wan, Z.; Li, G.; Zhang, F. Occurrence of PFASs and its effect on soil bacteria at a fire-training area using PFOS-restricted aqueous film-forming foams. iScience 2022, 25, 104084. [Google Scholar] [CrossRef] [PubMed]
- Ehsan, M.N.; Riza, M.; Pervez, M.N.; Li, C.W.; Zorpas, A.A.; Naddeo, V. PFAS contamination in soil and sediment: Contribution of sources and environmental impacts on soil biota. Case Stud. Chem. Environ. Eng. 2024, 9, 100643. [Google Scholar] [CrossRef]
- Smolarz, K.; Larsson, J.; Dinnetz, P.; Obszarski, J.; Leprêtre, A.; Świeżak, J.; Hallman, A.; Grahn, M.; Porseryd, T. Exposure to environmentally relevant levels of perfluorotetradecanoic acid (PFTeDA) affects respiratory and reproductive functions of Mytilus trossulus: An experimental study. J. Hazard. Mater. 2025, 500, 140306. [Google Scholar] [CrossRef] [PubMed]
- Hazrati, S.; Kumpiene, J.; Leiviskä, T.; Carabante, I. Reciprocal influence of per-and polyfluoroalkyl substances (PFAS) and soil organic matter on their fate in soils. Environ. Sci. Pollut. Res. 2025, 32, 23265–23277. [Google Scholar] [CrossRef] [PubMed]
- Brusseau, M.L.; Anderson, R.H.; Guo, B. PFAS concentrations in soils: Background levels versus contaminated sites. Sci. Total Environ. 2020, 740, 140017. [Google Scholar] [CrossRef] [PubMed]
- Wei, M.; Chen, Z.; Yang, K.; Cao, L.; Qiu, C.; Zhou, L.; Shi, Z.; Chen, S. Global ecological and health risks of PFAS in surface soil. Environ. Int. 2025, 206, 109925. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Song, C.; Ren, M.; Kong, Y.; Cui, X. Distribution patterns and influencing factors of PFAS in soils: A meta-analysis. Environ. Res. 2025, 279, 121806. [Google Scholar] [CrossRef] [PubMed]
- Dobrzyńska, E.; Wasilewski, P.; Pośniak, M. Per- and polyfluoroalkyl substances (PFASs): A comprehensive review of environmental distribution, health impacts, and regulatory landscape. Appl. Sci. 2025, 15, 11884. [Google Scholar] [CrossRef]
- Bao, Y.; Li, B.; Xie, S.; Huang, J. Vertical profiles of microbial communities in perfluoroalkyl substance-contaminated soils. Ann. Microbiol. 2018, 68, 399–408. [Google Scholar] [CrossRef]
- Huang, S.; Jaffé, P.R. Defluorination of perfluorooctanoic acid (PFOA) and perfluorooctane sulfonate (PFOS) by Acidimicrobium sp. strain A6. Environ. Sci. Technol. 2023, 53, 11410–11419. [Google Scholar] [CrossRef] [PubMed]
- Huang, H.; Lyu, X.; Xiao, F.; Fu, J.; Xu, H.; Wu, J.; Sun, Y. Three-year field study on the temporal response of soil microbial communities and functions to PFOA exposure. J. Hazard. Mater. 2024, 476, 135008. [Google Scholar] [CrossRef] [PubMed]
- Calcagnile, M.; Giuliano, A.; Tredici, M.S.; Gualandris, D.; Rotondo, D.; Calisi, A.; Leo, C.; Martelli, M.; Rocchi, A.; Lint, K.E.; et al. Per-and polyfluoroalkyl substances (PFAS) as environmental drivers of antimicrobial resistance: Insights from genome sequences of Klebsiella grimontii and Citrobacter braakii isolated from contaminated soil. Environ. Sci. Adv. 2025, 4, 1444–1476. [Google Scholar] [CrossRef]
- Easmin, N.; Sapkota, P.; Ramirez, K.S.; Mohammadi, Y.; Narayan, M.; Sharifan, H. Differential impacts of perfluorooctanoic acid (PFOA) on soil microbial communities in aerobic and anaerobic agricultural soils. ACS Omega 2025, 10, 44541–44548. [Google Scholar] [CrossRef] [PubMed]
- Chetverikov, S.; Hkudaigulov, G.; Sharipov, D.; Starikov, S. Probable new species of bacteria of the genus Pseudomonas accelerates and enhances the destruction of perfluorocarboxylic acids. Toxics 2024, 12, 930. [Google Scholar] [CrossRef] [PubMed]
- Chetverikov, S.; Hkudaygulov, G.; Sharipov, D.; Starikov, S.; Chetverikova, D. Biodegradation potential of C7-C10 perfluorocarboxylic acids and data from the genome of a new strain of Pseudomonas mosselii. Toxics 2023, 11, 1001. [Google Scholar] [CrossRef] [PubMed]
- Cousins, I.T.; Goldenman, G.; Herzke, D.; Lohmann, R.; Miller, M.; Ng, C.A.; Patton, S.; Scheringer, M.; Trier, X.; Viereke, L.; et al. The concept of essential use for determining when uses of PFASs can be phased out. Environ. Sci. Process. Impacts 2020, 21, 1803–1815. [Google Scholar] [CrossRef] [PubMed]
- Senevirathna, S.T.M.L.D.; Krishna, K.B.; Mahinroosta, R.; Sathasivan, A. Comparative characterization of microbial communities that inhabit PFAS-rich contaminated sites: A case-control study. J. Hazard. Mater. 2022, 423, 126941. [Google Scholar] [CrossRef] [PubMed]
- Lin, W.; Zhao, J.; Wu, X.; Jiang, J.; Zhou, C.; Zheng, J.; Zhang, C.; Guo, Y.; Wang, L.; Ng, H.Y.; et al. The effects of perfluoroalkyl substance pollution on microbial community and key metabolic pathways in the Pearl River Estuary. Ecotoxicol. Environ. Saf. 2025, 298, 118293. [Google Scholar] [CrossRef] [PubMed]
- Yang, F.; Liu, M.; Liu, S.; Li, F.; Liu, W.; Xu, C. Cross-media dynamics and prioritized risks of PFAS in textile-impacted environments: Using geospatial machine learning. Environ. Int. 2025, 207, 110008. [Google Scholar] [CrossRef] [PubMed]
- Roche, D.; Rickson, J.R.; Pawlett, M. Moving towards a mechanistic understanding of biostimulant impacts on soil properties and processes: A semi-systematic review. Front. Agron. 2024, 6, 1271672. [Google Scholar] [CrossRef]
- Battisti, I.; Trentin, A.R.; Sabia, A.; Masi, A.; Renella, G. Soil amendment with biochar reduces the uptake and translocation of perfluoroalkyl substances by horticultural plants grown in a polluted area. Soil Syst. 2025, 9, 100. [Google Scholar] [CrossRef]
- Bhatti, A.A.; Haq, S.; Bhat, R.A. Actinomycetes benefaction role in soil and plant health. Microb. Pathog. 2017, 111, 458–467. [Google Scholar] [CrossRef] [PubMed]
- Wu, E.; Wang, K.; Zhou, J.; Wang, J.; Liu, Z.; Yan, H.; Zhu, X.; Chen, B. Fatty acid metabolic impairment in soil microbes induced by PFAS: Dependence on the fluorocarbon chain length, headgroups, and ether attached. Environ. Sci. Technol. 2025, 59, 5452–5462. [Google Scholar] [CrossRef] [PubMed]
- Bezabhe, Y.H.; Nassazzi, W.; Tapase, S.; Ahrens, L.; Jass, J. Long-term per-and polyfluoroalkyl substances (PFAS) exposure causes selective changes in the rhizosphere bacterial community. Appl. Soil Ecol. 2025, 216, 106561. [Google Scholar] [CrossRef]
- Ullah, S.; Hussain, B.; Iqbal, N.; Raza, M.M.; Salam, M.; Vasudhevan, P.; Abbas, S.G.; Sani, S.; Pu, S. Microbial ecosystem disruption under persistent organic pollutant stress: Consequences for soil biogeochemistry and environmental sustainability—A review. Environ. Chem. Ecotoxicol. 2025, 7, 2643–2659. [Google Scholar] [CrossRef]
- Pereira, H.C.; Ullberg, M.; Kleja, D.B.; Gustafsson, J.P.; Ahrens, L. Sorption of perfluoroalkyl substances (PFASs) to an organic soil horizon—Effect of cation composition and pH. Chemosphere 2018, 207, 183–191. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Jin, M.; Gao, H.; Yang, X.; Xia, M.; Li, O. Advances in sphingan production: Biosynthesis and synthetic biology strain modification strategies based on Sphingomonas. Biotechnol. Adv. 2025, 83, 108659. [Google Scholar] [CrossRef] [PubMed]
- Smorada, C.M.; Sima, M.W.; Jaffé, P.R. Bacterial degradation of perfluoroalkyl acids. Curr. Opin. Biotechnol. 2024, 88, 103170. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.; Kim, I.; Park, S.; Woo, H.; Yook, S.; Seo, T. Sphingomonas rustica sp. nov. and Sphingomonas agrestis sp. nov.; novel carotenoid-producing bacterial species isolated from farm soil. Int. J. Syst. Evol. Microbiol. 2024, 74, 006551. [Google Scholar] [CrossRef] [PubMed]
- Philippot, L.; Chenu, C.; Kappler, A.; Rillig, M.; Fierer, N. The interplay between microbial communities and soil properties. Nat. Rev. Microbiol. 2024, 22, 226–239. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Chi, Y.; Song, S. Important soil microbiota’s effects on plants and soils: A comprehensive 30-year systematic literature review. Front. Microbiol. 2024, 15, 1347745. [Google Scholar] [CrossRef] [PubMed]
- Wu, E.; Wang, K.; Liu, Z.; Wang, J.; Yan, H.; Zhu, X.; Zhu, X.; Chen, B. Metabolic and microbial profiling of soil microbial community under per-and polyfluoroalkyl substance (PFAS) stress. Environ. Sci. Technol. 2023, 57, 21855–21865. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.Y.; Shen, Z.W.; Hua, Z.L.; Gu, L. Nitrogen addition enhanced per-fluoroalkyl substances microbial availability in a wheat soil ecosystem. Chemosphere 2023, 320, 138110. [Google Scholar] [CrossRef] [PubMed]
- Cui, J.; Yang, B.; Zhang, M.; Song, D.; Xu, X.; Ai, C.; Liand, G.; Zhou, W. Investigating the effects of organic amendments on soil microbial composition and its linkage to soil organic carbon: A global meta-analysis. Sci. Total Environ. 2023, 894, 164899. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Chen, X.; Jia, Z.; Zhai, L.; Zhang, B.; Grüters, U.; Ma, S.; Qian, J.; Liu, X.; Zhang, J.; et al. Meta-analysis reveals the effects of microbial inoculants on the biomass and diversity of soil microbial communities. Nat. Ecol. Evol. 2024, 8, 1270–1284. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Hu, S.; Zhu, F.; Li, X.; You, L.; Chen, Z.; Hu, B.; Zhao, F. Mitigating ecological risks: Role of arbuscular mycorrhizal symbiosis in translocation and transformation of per-and polyfluoroalkyl substances in constructed wetlands. Environ. Sci. Technol. 2025, 59, 20616–20629. [Google Scholar] [CrossRef] [PubMed]
- Adedayo, A.A.; Babalola, O.O. The potential of biostimulants on soil microbial community: A review. Front. Ind. Microbiol. 2023, 1, 1308641. [Google Scholar] [CrossRef]
- Ali, S.; Akhtar, M.S.; Siraj, M.; Zaman, W. Molecular communication of microbial plant biostimulants in the rhizosphere under abiotic stress conditions. Int. J. Mol. Sci. 2024, 25, 12424. [Google Scholar] [CrossRef] [PubMed]
- Wei, W.; Ma, M.; Jiang, X.; Meng, F.; Cao, F.; Chen, H.; Guan, D.; Li, L.; Li, J. Soil p-stimulating bacterial communities: Response and effect assessment of long-term fertilizer and rhizobium inoculant application. Environ. Microbiome 2024, 19, 86. [Google Scholar] [CrossRef] [PubMed]
- Sivojienė, D.; Masevičienė, A.; Žičkienė, L.; Ražukas, A.; Kačergius, A. Soil microbial community structure and carbon stocks following fertilization with organic fertilizers and biological inputs. Biology 2024, 13, 534. [Google Scholar] [CrossRef] [PubMed]
- Negi, R.; Sharma, B.; Kaur, T.; Jyothi, S.R.; Gupta, A.; Thakur, N.; Jhamta, S.; Rathore, S.; Yadav, N.; Kapoor, M.; et al. Pseudomonadota: Biodiversity, functional annotation for plant growth and biotechnological applications for agro-environmental sustainability. Ecol. Front. 2025, 46, 459–474. [Google Scholar] [CrossRef]
- Wadduwage, J.; Liu, H.; Egidi, E.; Singh, B.K.; Macdonald, C.A. Effects of biostimulant application on soil biological and physicochemical properties: A field study. J. Sustain. Agric. Environ. 2023, 2, 285–300. [Google Scholar] [CrossRef]
- Chen, X.; Ma, X.; Liu, Z.; Gu, H.; Fang, H.; Shen, Z.; Zhang, H.; Wan, S.; Li, W.; Hao, X.; et al. Organic fertilizers increase microbial community diversity and stability slowing down the transformation process of nutrient cycling. Environ. Microbiome 2025, 20, 130. [Google Scholar] [CrossRef] [PubMed]
- Ding, T.; Zhou, Y.N.; Liu, J.F.; Lu, S.Y.; Yang, J.T. The mechanism of omicron variant-associated cardiac injury in rhesus macaques was revealed by proteomic and phosphoproteomic analyses. MedComm 2025, 6, e70266. [Google Scholar] [CrossRef] [PubMed]
- Nalini, M.S.; Prakash, H.S. Actinobacteria: Diversity, plant interactions, and biotechnology applications. In Plant Microbiomes for Sustainable Agriculture; Yadav, A., Singh, J., Rastegari, A., Yadav, N., Eds.; Sustainable Development and Biodiversity; Springer: Cham, Switzerland, 2020; Volume 25. [Google Scholar] [CrossRef]
- Javed, Z.; Tripathi, G.D.; Mishra, M.; Dashora, K. Actinomycetes–the microbial machinery for the organic-cycling, plant growth, and sustainable soil health. Biocatal. Agric. Biotechnol. 2021, 31, 101893. [Google Scholar] [CrossRef]
- Guo, T.; Wang, M.; Yue, K.; Luo, P.; Song, X.; Huang, S.; Xu, X.; Zhang, Q.; Chen, Y.; Zhang, Z.; et al. Metagenomics insights into the functional profiles of soil carbon, nitrogen under long-term chemical and humic acid urea application. Agronomy 2025, 15, 2535. [Google Scholar] [CrossRef]
- Dai, W.; Liu, Y.; Cui, Z.; Li, W.; Wang, H. From predation to function: How myxobacteria drive soil microbial community dynamics and ecological functions. Appl. Environ. Microbiol. 2025, 91, e01922-25. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Gu, W.H.; Bai, J.F.; Wang, R.X.; Zhang, C.L.; Guo, Y.G.; Lu, C.; Chen, S.P. Metagenomic insights into the synergistic properties and mechanisms of sludge microbial communities degrading polystyrene and polypropylene. J. Hazard. Mater. 2025, 498, 139929. [Google Scholar] [CrossRef] [PubMed]
- Borovkov, S.; Kolchyk, O.; Paliy, A.; Borovkova, V.; Zlenko, O.; Pavlichenko, O. Effect of probiotic complex of spore-forming bacteria Bacillus on the intestinal microbiome of normal and overweight horses. Croat. Vet. J. 2026, 57, 94–103. [Google Scholar] [CrossRef]
- Feng, T.; Liu, Y.; Huang, M.; Chen, G.; Tian, Q.; Duan, C.; Chen, J. Reshaping the root endophytic microbiota in plants to combat mercury-induced stress. Sci. Total Environ. 2024, 945, 174019. [Google Scholar] [CrossRef] [PubMed]
- Moretti, L.G.; Crusciol, C.A.C.; Leite, M.F.A.; Momesso, L.; Bosolani, J.W.; Costa, O.Y.A.; Hungria, M.; Kuramae, E.E. Diverse bacterial consortia: Key drivers of rhizosoil fertility modulating microbiome functions, plant physiology, nutrition, and soybean grain yield. Environ. Microbiome 2024, 19, 50. [Google Scholar] [CrossRef] [PubMed]
- Yi, S.; Zhu, Z.; Li, F.; Zhu, L.; Wu, C.; Ge, F.; Ji, X.; Tian, J. Metagenomic and proteomic insights into the self-adaptive cell surface hydrophobicity of Sphingomonas sp. strain PAH02 reducing the migration of cadmium-phenanthrene co-pollutant in rice. Environ. Microbiol. 2024, 26, e16577. [Google Scholar] [CrossRef] [PubMed]
- Han, M.; Han, Y.; Liu, X.; Li, G.; Li, P. Rhizosphere microbiomes altered by environmental stresses and agronomic practices: Implications for plant adaptation and soil biogeochemical processes. Plant Stress 2025, 18, 101062. [Google Scholar] [CrossRef]
- Liu, J.; Zhang, W.; Teng, C.; Pang, Z.; Peng, Y.; Qiu, J.; Lei, J.; Su, X.; Zhu, W.; Ding, C. Intercropping changed the soil microbial community composition but no significant effect on alpha diversity. Front. Microbiol. 2024, 15, 1370996. [Google Scholar] [CrossRef] [PubMed]
- Thamvithayakorn, P.; Phosri, C.; Robinson-Boyer, L.; Limnonthakul, P.; Doonan, J.H.; Suwannasai, N. The synergistic impact of a novel plant growth-promoting rhizobacterial consortium and Ascophyllum nodosum seaweed extract on rhizosphere microbiome dynamics and growth enhancement in Oryza sativa L. RD79. Agronomy 2024, 14, 2698. [Google Scholar] [CrossRef]
- Wang, F.; Jia, M.; Li, K.; Cui, Y.; An, L.; Sheng, H. Sphingomonas sp. Hbc-6 alters Arabidopsis metabolites to improve plant growth and drought resistance by manipulating the microbiome. Microbiol. Res. 2024, 287, 127852. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Qiu, Y.; Yi, F.; Li, J.; Wang, X.; Fu, Q.; Fu, X.; Yao, Z.; Dai, Z.; Qiu, Y.; et al. Biochar dose-dependent impacts on soil bacterial and fungal diversity across the globe. Sci. Total Environ. 2024, 930, 172509. [Google Scholar] [CrossRef] [PubMed]
- Karamat, A.; Tehrani, R.; Foster, G.D.; Van Aken, B. Plant responses to per-and polyfluoroalkyl substances (PFAS): A molecular perspective. Int. J. Phytoremediat. 2024, 26, 219–227. [Google Scholar] [CrossRef] [PubMed]
- Marzi, D.; Valente, F.; Luche, S.; Caissutti, C.; Sabia, A.; Capitani, I.; Capobianco, G.; Serranti, S.; Masi, A.; Panozzo, A.; et al. Phytoremediation of perfluoroalkyl and polyfluoroalkyl substances (PFAS): Insights on plant uptake, omics analysis, contaminant detection and biomass disposal. Sci. Total Environ. 2025, 959, 178323. [Google Scholar] [CrossRef] [PubMed]
- Fawad, M.; Wu, T.; Xu, X.; Wang, J.; Zhou, X.; Rajput, V.D.; Qin, C.; Ling, W. Mechanisms of PFAS uptake and bioaccumulation in plants. Ecotoxicol. Environ. Saf. 2026, 311, 119888. [Google Scholar] [CrossRef] [PubMed]
- Guo, X.; Zhang, X.; Chen, J.; Shan, W.; Wang, R.; Wang, K.; Chen, Z.; Wang, L.; Zhang, Y. Identification of a PFAS hyperaccumulator and elucidation of its translocation mechanism for sustainable phytoremediation. Nat. Commun. 2025, 16, 10283. [Google Scholar] [CrossRef] [PubMed]
- Adu, O.; Ma, X.; Sharma, V.K. Bioavailability, phytotoxicity and plant uptake of per-and polyfluoroalkyl substances (PFAS): A review. J. Hazard. Mater. 2023, 447, 130805. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Oliver, D.P.; Kookana, R.S. A critical analysis of published data to discern the role of soil and plant properties in the bioaccumulation of PFASs in plants. Sci. Total Environ. 2018, 628–629, 110–120. [Google Scholar] [CrossRef] [PubMed]
- Xu, B.; Qiu, W.; Du, J.; Wan, Z.; Zhou, J.L.; Chen, H.; Liu, R.; Magnuson, J.T.; Zheng, C. Translocation, bioaccumulation, and distribution of perfluoroalkyl and polyfluoroalkyl substances (PFASs) in plants. iScience 2022, 25, 104061. [Google Scholar] [CrossRef] [PubMed]
- Boutahiri, S.; Benrkia, R.; Tembeni, B.; Idowu, O.E.; Olatunji, O.J. Effect of biostimulants on the chemical profile of food crops under normal and abiotic stress conditions. Curr. Plant Biol. 2024, 40, 100410. [Google Scholar] [CrossRef]
- Rouphael, Y.; Colla, G. Biostimulants in agriculture. Front. Plant Sci. 2020, 11, 40. [Google Scholar] [CrossRef] [PubMed]
- Bulgari, R.; Franzoni, G.; Ferrante, A. Biostimulants application in horticultural crops under abiotic stress conditions. Agronomy 2019, 9, 306. [Google Scholar] [CrossRef]
- Belal, H.E.E.; Elkelish, A.; Zaid, M.M.; Alhudhaibi, A.; El-Roby, M.S.A.; Abd Elmohsen, Y.H.; Abeed, A.H.A.; Ukozehasi, C.; Rady, M.M.; Sayed, A.A.S. Novel biostimulants-mediate tolerance to drought stress in Phaseolus vulgaris plants by optimizing osmoprotectants and antioxidant defense systems. Bot. Stud. 2025, 66, 36. [Google Scholar] [CrossRef] [PubMed]
- Win, P.P.; Park, H.-H.; Kuk, Y.-I. Integrated approach of using biostimulants for improving growth, physiological traits, and tolerance to abiotic stressors in rice and soybean. Agronomy 2025, 15, 2265. [Google Scholar] [CrossRef]
- Calvo, P.; Nelson, L.; Kloepper, J.W. Agricultural uses of plant biostimulants. Plant Soil 2014, 383, 3–41. [Google Scholar] [CrossRef]
- Du Jardin, P. Plant biostimulants: Definition, concept, main categories and regulation. Sci. Hortic. 2025, 196, 3–14. [Google Scholar] [CrossRef]
- Hunková, J.; Lisinovičová, M.; Lancíková, V.; Szabóová, M.; Kačírová, J.; Mistríková, V.; Hricová, A. A comparative analysis of heavy metal stress responses in different grain amaranth cultivars. Plant Stress 2024, 14, 100619. [Google Scholar] [CrossRef]
- Tőzsér, D.; Yelamanova, A.; Sipos, B.; Magura, T.; Simon, E.A. Meta-analysis on the heavy metal uptake in Amaranthus species. Environ. Sci. Pollut. Res. 2023, 30, 85102–85112. [Google Scholar] [CrossRef] [PubMed]
- Sim, W.; Park, H.; Yoon, J.K.; Kim, J.I.; Oh, J.E. Characteristic distribution patterns of perfluoroalkyl substances in soils according to land-use types. Chemosphere 2021, 276, 130167. [Google Scholar] [CrossRef] [PubMed]
- Rasmusson, K.; Fagerlund, F. Per-and polyfluoroalkyl substances (PFAS) as contaminants in groundwater resources–A comprehensive review of subsurface transport processes. Chemosphere 2024, 362, 142663. [Google Scholar] [CrossRef] [PubMed]
- Xing, Z.; Wang, G.; Liu, S.; Chen, H.; Dong, X.; Wang, H.; Liu, Y. Legacy and emerging per-and polyfluoroalkyl substances (PFASs) in agricultural soils affected by fluorochemical manufacturing facilities, North China: Occurrence, region-specific distribution, substitution trend and source appointment. J. Hazard. Mater. 2024, 474, 134770. [Google Scholar] [CrossRef] [PubMed]
- Jolankai, Z.; Clement, A.; Kardos, M.K.; Kittlaus, S.; Weber, N.; Gabriel, O.; Broer, M.B.; Braun, K.; Ščančar, R.M.; Kozlica, K.; et al. Occurrence and fate of PTE, PAH, and PFAS trace contaminants in soils and river suspended particulate matter in three DANUBEAN river catchments. J. Environ. Qual. 2026, 55, e70116. [Google Scholar] [CrossRef] [PubMed]
- IUSS Working Group WRB. World Reference Base for Soil Resources 2014: International Soil Classification System for Naming Soils and Creating Legends for Soil Maps. Update 2015; World Soil Resources Reports No. 106; FAO: Rome, Italy, 2015. [Google Scholar]
- Wyszkowska, J.; Boros-Lajszner, E.; Kucharski, J. The impact of soil contamination with lead on the biomass of maize intended for energy purposes, and the biochemical and physicochemical properties of the soil. Energies 2024, 17, 1156. [Google Scholar] [CrossRef]
- Wyszkowska, J.; Borowik, A.; Zaborowska, M.; Kucharski, J. Revitalization of soil contaminated by petroleum products using materials that improve the physicochemical and biochemical properties of the soil. Molecules 2024, 29, 5838. [Google Scholar] [CrossRef] [PubMed]
- National Center for Biotechnology Information. PubChem Compound Summary for CID 67822: Perfluorotetradecanoic Acid. 2026. Available online: https://pubchem.ncbi.nlm.nih.gov/compound/67822 (accessed on 17 February 2026).
- TIBCO Software Inc. Statistica (Data Analysis Software System), Version 13.0; TIBCO Software Inc.: Palo Alto, CA, USA, 2017; Available online: https://www.tibco.com (accessed on 15 March 2026).
- Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; On, J.; et al. TBtools-II: A “one for all, all for one” bioinformatics platform for biological big-data mining. Mol. Plant 2023, 16, 1733–1742. [Google Scholar] [CrossRef] [PubMed]
- Tang, D.; Chen, M.; Huang, X.; Zhang, G.; Zeng, L.; Zhang, G.; Zeng, L.; Wu, S.; Wang, Y. SRplot: A free online platform for data visualization and graphing. PLoS ONE 2023, 18, e0294236. [Google Scholar] [CrossRef] [PubMed]
- Lei, L.; Zhu, J.; Chen, C.; Wang, Y.; Wu, C.; Qi, M.; Wang, Y.; Liu, X.; Hong, X.; Yu, L.; et al. Genome-wide identification, evolution and expression analysis of bone morphogenetic protein (BMP) gene family in chinese soft-shell turtle (Pelodiscus sinensis). Front. Genet. 2023, 14, 1109478. [Google Scholar] [CrossRef] [PubMed]
- Louca, S.; Parfrey, L.W.; Doebeli, M. Decoupling function and taxonomy in the global ocean microbiome. Science 2016, 353, 1272–1277. [Google Scholar] [CrossRef] [PubMed]











| Perfluorotetradecanoic Acid (PFTeDA) | |
|---|---|
![]() Structural formula | |
| Parameter | Value/Formula |
| Chemical formula | CF3(CF2)12COOH |
| Physical state | Solid |
| Molar mass | 714.11 g mol−1 |
| Density | 0.89–1.8 g cm3 |
| Melting point | 130–135 °C |
| Boiling point | approx. 270 °C |
| Flash point | approx. 120–192 °C |
| Acute toxicity (oral) | 500.1 mg kg−1 |
| Acute toxicity (inhalation—vapor) | 11.1 mg dm−3 |
| Gene | Amplified Region | Primer | |
|---|---|---|---|
| Forward | Reverse | ||
| 16S rRNA | V4 | GTGCCAGCMGCCGCGGTAA | GGACTACHVGGGTWTCTAAT |
| V3–V4 | CCTAYGGGRBGCASCAG | GGACTACNNGGGTATCTAAT | |
| V4–V5 | GTGCCAGCMGCCGCGGTAA | CCGTCAATTCCTTTGAGTTT | |
| V5–V7 | AACMGGATTAGATACCCKG | ACGTCATCCCCACCTTCC | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Baćmaga, M.; Wyszkowska, J.; Boros-Lajszner, E.; Kucharski, J.; Nowak, K.M. Effects of Perfluorotetradecanoic Acid (PFTeDA) and Biostimulants on Soil Bacterial Community Structure and Diversity and the Growth of Amaranthus cruentus. Int. J. Mol. Sci. 2026, 27, 6523. https://doi.org/10.3390/ijms27146523
Baćmaga M, Wyszkowska J, Boros-Lajszner E, Kucharski J, Nowak KM. Effects of Perfluorotetradecanoic Acid (PFTeDA) and Biostimulants on Soil Bacterial Community Structure and Diversity and the Growth of Amaranthus cruentus. International Journal of Molecular Sciences. 2026; 27(14):6523. https://doi.org/10.3390/ijms27146523
Chicago/Turabian StyleBaćmaga, Małgorzata, Jadwiga Wyszkowska, Edyta Boros-Lajszner, Jan Kucharski, and Karolina M. Nowak. 2026. "Effects of Perfluorotetradecanoic Acid (PFTeDA) and Biostimulants on Soil Bacterial Community Structure and Diversity and the Growth of Amaranthus cruentus" International Journal of Molecular Sciences 27, no. 14: 6523. https://doi.org/10.3390/ijms27146523
APA StyleBaćmaga, M., Wyszkowska, J., Boros-Lajszner, E., Kucharski, J., & Nowak, K. M. (2026). Effects of Perfluorotetradecanoic Acid (PFTeDA) and Biostimulants on Soil Bacterial Community Structure and Diversity and the Growth of Amaranthus cruentus. International Journal of Molecular Sciences, 27(14), 6523. https://doi.org/10.3390/ijms27146523


