Potential Cardioprotective Effect of a GRK5 Inhibitor Against NF-κB-Mediated Inflammation in an Animal Model of Isoproterenol-Induced Myocardial Infarction
Abstract
1. Introduction
2. Results
2.1. Effect of Amlexanox on ISO-Induced Cardiac Injury, Inflammatory Biomarkers, and Morphology
2.2. Effect of Amlexanox on NF-κB Gene and Protein Expression
2.3. Amlexanox Upregulates GRK5 and MEF2α in ISO-Induced Myocardial Infarction
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Induction of Myocardial Infarction
4.3. Experimental Animal Design
4.4. Examination of Cardiac Injury and Inflammatory Biomarkers
4.5. Histopathological Analysis
4.6. Immunohistochemistry
4.7. Reverse Transcription Polymerase Chain Reaction (RT-PCR)
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| CK-MB | Creatine kinase MB |
| ELISA | Enzyme-linked immunosorbent assay |
| GPCR | G-protein coupled receptor |
| GRK | G protein-coupled receptor kinase |
| GRK5 | G protein-coupled receptor kinase 5 |
| GAPDH | Glyceraldehyde 3-phosphate dehydrogenase |
| IκBα: | Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha |
| IL-1 | Interleukin-1 |
| IL-6 | Interleukin-6 |
| ISO | Isoproterenol |
| IP | intraperitoneal |
| MI | Myocardial Infarction |
| MEF2α | Myocyte-specific enhancer factor 2A |
| NF-κB | Nuclear factor kappa-light-chain-enhancer of activated B cells |
| Tn-I | Troponin 1 |
| TNFα | Tumor necrosis factor-α |
References
- Aljefree, N.; Ahmed, F. Prevalence of Cardiovascular Disease and Associated Risk Factors among Adult Population in the Gulf Region: A Systematic Review. Adv. Public Health 2015, 2015, 235101. [Google Scholar] [CrossRef] [Scilit]
- Alhabib, K.F.; Batais, M.A.; Almigbal, T.H.; Alshamiri, M.Q.; Altaradi, H.; Rangarajan, S.; Yusuf, S. Demographic, behavioral, and cardiovascular disease risk factors in the Saudi population: Results from the Prospective Urban Rural Epidemiology study (PURE-Saudi). BMC Public Health 2020, 20, 1213. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Violán, C.; Bejarano-Rivera, N.; Foguet-Boreu, Q.; Roso Llorach, A.; Pons-Vigués, M.; Martin Mateo, M.; Pujol-Ribera, E. The burden of cardiovascular morbidity in a European Mediterranean population with multimorbidity: A cross-sectional study. BMC Fam. Pract. 2016, 17, 150. [Google Scholar] [CrossRef] [Scilit]
- Zeng, Q.; Xu, T.; Luo, Z.; Zhou, H.; Duan, Z.; Xiong, X.; Huang, M.; Li, W. Effect of inflammatory factors on myocardial infarction. BMC Cardiovasc. Disord. 2024, 24, 538. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frangogiannis, N.G.; Smith, C.W.; Entman, M.L. The inflammatory response in myocardial infarction. Cardiovasc. Res. 2002, 53, 31–47. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oliveira, J.B.; Soares, A.A.S.M.; Sposito, A.C. Chapter Two-Inflammatory Response During Myocardial Infarction. In Advances in Clinical Chemistry; Makowski, G.S., Ed.; Elsevier: Amsterdam, The Netherlands, 2018; Volume 84, pp. 39–79. [Google Scholar]
- Fiordelisi, A.; Iaccarino, G.; Morisco, C.; Coscioni, E.; Sorriento, D. NFkappaB is a Key Player in the Crosstalk between Inflammation and Cardiovascular Diseases. Int. J. Mol. Sci. 2019, 20, 1599. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.-C. NF-κB signaling in inflammation. Signal Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef] [Scilit]
- Komolov, K.E.; Bhardwaj, A.; Benovic, J.L. Atomic Structure of GRK5 Reveals Distinct Structural Features Novel for G Protein-coupled Receptor Kinases. J. Biol. Chem. 2015, 290, 20629–20647. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hendrickx, J.O.; van Gastel, J.; Leysen, H.; Santos-Otte, P.; Premont, R.T.; Martin, B.; Maudsley, S. GRK5—A Functional Bridge Between Cardiovascular and Neurodegenerative Disorders. Front. Pharmacol. 2018, 9, 1484. [Google Scholar] [CrossRef] [Scilit]
- Traynham, C.J.; Hullmann, J.; Koch, W.J. Canonical and non-canonical actions of GRK5 in the heart. J. Mol. Cell. Cardiol. 2016, 92, 196–202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gold, J.I.; Martini, J.S.; Hullmann, J.; Gao, E.; Chuprun, J.K.; Lee, L.; Tilley, D.G.; Rabinowitz, J.E.; Bossuyt, J.; Bers, D.M.; et al. Nuclear translocation of cardiac G protein-Coupled Receptor kinase 5 downstream of select Gq-activating hypertrophic ligands is a calmodulin-dependent process. PLoS ONE 2013, 8, e57324. [Google Scholar] [CrossRef] [Scilit]
- Islam, K.N.; Bae, J.W.; Gao, E.; Koch, W.J. Regulation of nuclear factor κB (NF-κB) in the nucleus of cardiomyocytes by G protein-coupled receptor kinase 5 (GRK5). J. Biol. Chem. 2013, 288, 35683–35689. [Google Scholar] [CrossRef] [Scilit]
- Johnson, L.R.; Robinson, J.D.; Lester, K.N.; Pitcher, J.A. Distinct Structural Features of G Protein-Coupled Receptor Kinase 5 (GRK5) Regulate Its Nuclear Localization and DNA-Binding Ability. PLoS ONE 2013, 8, e62508. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hullmann, J.E.; Grisanti, L.A.; Makarewich, C.A.; Gao, E.; Gold, J.I.; Chuprun, J.K.; Tilley, D.G.; Houser, S.R.; Koch, W.J. GRK5-Mediated Exacerbation of Pathological Cardiac Hypertrophy Involves Facilitation of Nuclear NFAT Activity. Circ. Res. 2014, 115, 976–985. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagasaka, A.; Terawaki, T.; Noda, M.; Takashima, M.; Fujino, M.; Yamauchi, Y.; Arawaka, S.; Kato, T.; Nakaya, M. GRK5-mediated inflammation and fibrosis exert cardioprotective effects during the acute phase of myocardial infarction. FEBS Open Bio 2023, 13, 380–391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Lucia, C.; Grisanti, L.A.; Borghetti, G.; Piedepalumbo, M.; Ibetti, J.; Lucchese, A.M.; Barr, E.W.; Roy, R.; Okyere, A.D.; Murphy, H.C.; et al. G protein-coupled receptor kinase 5 (GRK5) contributes to impaired cardiac function and immune cell recruitment in post-ischemic heart failure. Cardiovasc. Res. 2022, 118, 169–183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Homan, K.T.; Wu, E.; Cannavo, A.; Koch, W.J.; Tesmer, J.J. Identification and characterization of amlexanox as a G protein-coupled receptor kinase 5 inhibitor. Molecules 2014, 19, 16937–16949. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, W.C.; Mihlbachler, K.A.; Bleecker, E.R.; Weiss, S.T.; Liggett, S.B. A polymorphism of G-protein coupled receptor kinase5 alters agonist-promoted desensitization of beta2-adrenergic receptors. Pharmacogenet Genom. 2008, 18, 729–732. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Q.; Wang, L.; Wang, S.; Cheng, H.; Xu, L.; Pei, G.; Wang, Y.; Fu, C.; Jiang, Y.; He, C.; et al. Signaling pathways and targeted therapy for myocardial infarction. Signal Transduct. Target. Ther. 2022, 7, 78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fonseca, F.A.; Izar, M.C. Role of Inflammation in Cardiac Remodeling After Acute Myocardial Infarction. Front. Physiol. 2022, 13, 927163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Forte, E.; Panahi, M.; Baxan, N.; Ng, F.S.; Boyle, J.J.; Branca, J.; Bedard, O.; Hasham, M.G.; Benson, L.; Harding, S.E.; et al. Type 2 MI induced by a single high dose of isoproterenol in C57BL/6J mice triggers a persistent adaptive immune response against the heart. J. Cell Mol. Med. 2021, 25, 229–243. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, L.; Srilakshmi, M.; Wu, Y.; Saleem, T.S.M. Sulforaphane Attenuates Isoproterenol-Induced Myocardial Injury in Mice. BioMed Res. Int. 2020, 2020, 3610285. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Horwich, T.B.; Patel, J.; MacLellan, W.R.; Fonarow, G.C. Cardiac troponin I is associated with impaired hemodynamics, progressive left ventricular dysfunction, and increased mortality rates in advanced heart failure. Circulation 2003, 108, 833–838. [Google Scholar] [CrossRef] [Scilit]
- La Vecchia, L.; Mezzena, G.; Zanolla, L.; Paccanaro, M.; Varotto, L.; Bonanno, C.; Ometto, R. Cardiac troponin I as diagnostic and prognostic marker in severe heart failure. J. Heart Lung Transpl. 2000, 19, 644–652. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, M.I.; Abdelrazek, H.M.A.; Moustafa, Y.M.; Alshawwa, S.Z.; Mobasher, M.A.; Abdel-Wahab, B.A.; Abdelgawad, F.E.; Khodeer, D.M. Cardioprotective Effect of Flibanserin against Isoproterenol-Induced Myocardial Infarction in Female Rats: Role of Cardiac 5-HT2A Receptor Gene/5-HT/Ca2+ Pathway. Pharmaceuticals 2023, 16, 502. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sanchez, V.C.D.; Velasco-Loyden, G.; Yañez-Maldonado, L.; Vidrio-Gómez, S.; Martínez, L.; Suárez, J.; Aranda-Fraustro, A.; Torres, J.C. Role of Nitric Oxide in Isoproterenol-Induced Myocardial Infarction. In Cardiotoxicity of Oncologic Treatments; Fiuza, M., Ed.; IntechOpen: London, UK, 2012. [Google Scholar]
- Zhang, B.; Wang, H.; Yang, Z.; Cao, M.; Wang, K.; Wang, G.; Zhao, Y. Protective effect of alpha-pinene against isoproterenol-induced myocardial infarction through NF-κB signaling pathway. Hum. Exp. Toxicol. 2020, 39, 1596–1606. [Google Scholar] [CrossRef] [Scilit]
- Adzika, G.K.; Hou, H.; Adekunle, A.O.; Rizvi, R.; Adzraku, S.Y.; Li, K.; Deng, Q.-M.; Mprah, R.; Ndzie Noah, M.L.; Adu-Amankwaah, J.; et al. Amlexanox and Forskolin Prevents Isoproterenol-Induced Cardiomyopathy by Subduing Cardiomyocyte Hypertrophy and Maladaptive Inflammatory Responses. Front. Cell Dev. Biol. 2021, 9, 719351. [Google Scholar] [CrossRef] [Scilit]
- Adzika, G.K.; Hou, H.; Adekunle, A.O.; Rizvi, R.; Adu-Amankwaah, J.; Shang, W.; Li, K.; Deng, Q.-M.; Mprah, R.; Ndzie Noah, M.L.; et al. Isoproterenol-Induced Cardiomyopathy Recovery Intervention: Amlexanox and Forskolin Enhances the Resolution of Catecholamine Stress-Induced Maladaptive Myocardial Remodeling. Front. Cardiovasc. Med. 2021, 8, 719805. [Google Scholar] [CrossRef] [Scilit]
- Dong, P.; Liu, K.; Han, H. The Role of NF-κB in Myocardial Ischemia/Reperfusion Injury. Curr. Protein Pept. Sci. 2022, 23, 535–547. [Google Scholar] [CrossRef] [Scilit]
- Alonazi, A.S.; Bin Dayel, A.F.; Albuaijan, D.A.; Bin Osfur, A.S.; Hakami, F.M.; Alzayed, S.S.; Almotairi, A.R.; Khan, M.R.; Alharbi, H.M.; Ali, R.A.; et al. Cardioprotective Effects of the GRK2 Inhibitor Paroxetine on Isoproterenol-Induced Cardiac Remodeling by Modulating NF-κB Mediated Prohypertrophic and Profibrotic Gene Expression. Int. J. Mol. Sci. 2023, 24, 17270. [Google Scholar] [CrossRef] [Scilit]
- Han, Y.; Hou, R.; Zhang, X.; Liu, H.; Gao, Y.; Li, X.; Qi, R.; Cai, R.; Qi, Y. Amlexanox exerts anti-inflammatory actions by targeting phosphodiesterase 4B in lipopolysaccharide-activated macrophages. Biochim. Biophys. Acta Mol. Cell Res. 2020, 1867, 118766. [Google Scholar] [CrossRef] [Scilit]
- Panda, S.; Kar, A.; Biswas, S. Preventive effect of Agnucastoside C against Isoproterenol-induced myocardial injury. Sci. Rep. 2017, 7, 16146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Obeidat, H.M.; Althunibat, O.Y.; Alfwuaires, M.A.; Aladaileh, S.H.; Algefare, A.I.; Almuqati, A.F.; Alasmari, F.; Aldal’in, H.K.; Alanezi, A.A.; Alsuwayt, B.; et al. Cardioprotective Effect of Taxifolin against Isoproterenol-Induced Cardiac Injury through Decreasing Oxidative Stress, Inflammation, and Cell Death, and Activating Nrf2/HO-1 in Mice. Biomolecules 2022, 12, 1546. [Google Scholar] [CrossRef] [Scilit]
- Phan Van, T.; Huyen Ton Nu Bao, T.; Leya, M.; Zhou, Z.; Jeong, H.; Lim, C.W.; Kim, B. Amlexanox attenuates LPS-induced neuroinflammatory responses in microglial cells via inhibition of NF-κB and STAT3 signaling pathways. Sci. Rep. 2024, 14, 2744. [Google Scholar] [CrossRef] [Scilit]
- Dosanjh, A.; Won, C.Y. Amlexanox: A Novel Therapeutic for Atopic, Metabolic, and Inflammatory Disease. Yale J. Biol. Med. 2020, 93, 759–763. [Google Scholar]
- Ninh, V.K.; Barlow, M.; Aydin, S.; Brand, C.S.; Yu, J.; Smith, J.; Francisco, J.; Daneman, R.; King, K.R.; Miyamoto, S.; et al. Cardiomyocyte YAP represses myocardial inflammation and fibrosis and restrains MEF2-regulated gene expression. Am. J. Physiol. Heart Circ. Physiol. 2025, 329, H774–H787. [Google Scholar] [CrossRef] [Scilit]
- Cheng, Y.; Zhao, J.; Tse, H.F.; Le, X.C.; Rong, J. Plant Natural Products Calycosin and Gallic Acid Synergistically Attenuate Neutrophil Infiltration and Subsequent Injury in Isoproterenol-Induced Myocardial Infarction: A Possible Role for Leukotriene B4 12-Hydroxydehydrogenase? Oxidative Med. Cell. Longev. 2015, 2015, 434052. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Conlee, K.M.; Stephens, M.L.; Rowan, A.N.; King, L.A. Carbon dioxide for euthanasia: Concerns regarding pain and distress, with special reference to mice and rats. Lab. Anim. 2005, 39, 137–161. [Google Scholar] [CrossRef] [Scilit]
- Lund, M.; Krudtaa Dahle, M.; Timmerhaus, G.; Alarcon, M.; Powell, M.; Aspehaug, V.; Rimstad, E.; Jørgensen, S.M. Hypoxia tolerance and responses to hypoxic stress during heart and skeletal muscle inflammation in Atlantic salmon (Salmo salar). PLoS ONE 2017, 12, e0181109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.N.; Tan, Y.; Xiao, X.C.; Li, Q.; Wu, Q.; Peng, Y.Y.; Ren, J.; Dong, M.L. Deletion of TLR4 attenuates lipopolysaccharide-induced acute liver injury by inhibiting inflammation and apoptosis. Acta Pharmacol. Sin. 2021, 42, 1610–1619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Medrano, J.L.; Naya, F.J. The transcription factor MEF2A fine-tunes gene expression in the atrial and ventricular chambers of the adult heart. J. Biol. Chem. 2017, 292, 20975–20988. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Gene | Forward | Reverse |
|---|---|---|
| GRK5 | CAAGGAGCTGAATGTGTTCGGAC | GCTGCTTCCAGTGGAGTTTGAAT |
| NF-κB(p65) | CAAGTGCCTTAATAGCAGGGCAAA | AGAGCTAGAAAGAGCAAGAGTCCA AT |
| NF-κB | ATGGCAGACGATGATCCCTAC | TGTTGACAGTGGTATTTCTGGTG |
| MEF2α | ACACGCATAATGGATGAGAGGAACCGAC | CAACGATATCCGAGTTCGTCCTGCTTTC |
| GAPDH | GGTTGTCTCCTGCGACTTCA | TGGTCCAGGTTTCTTACTCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Alonazi, A.S.; Bin Dayel, A.F.; Alkhathlan, B.A.; Alkaff, L.M.; Alrashed, A.T.; Bin Klaib, R.A.; Elnagar, D.M.; Alamin, M.A.; Ali, R.A.; Alameen, A.A.; et al. Potential Cardioprotective Effect of a GRK5 Inhibitor Against NF-κB-Mediated Inflammation in an Animal Model of Isoproterenol-Induced Myocardial Infarction. Int. J. Mol. Sci. 2026, 27, 53. https://doi.org/10.3390/ijms27010053
Alonazi AS, Bin Dayel AF, Alkhathlan BA, Alkaff LM, Alrashed AT, Bin Klaib RA, Elnagar DM, Alamin MA, Ali RA, Alameen AA, et al. Potential Cardioprotective Effect of a GRK5 Inhibitor Against NF-κB-Mediated Inflammation in an Animal Model of Isoproterenol-Induced Myocardial Infarction. International Journal of Molecular Sciences. 2026; 27(1):53. https://doi.org/10.3390/ijms27010053
Chicago/Turabian StyleAlonazi, Asma S., Anfal F. Bin Dayel, Bashayer A. Alkhathlan, Lulu M. Alkaff, Ahad T. Alrashed, Reema A. Bin Klaib, Doaa M. Elnagar, Maha A. Alamin, Rehab A. Ali, Alaa Alnoor Alameen, and et al. 2026. "Potential Cardioprotective Effect of a GRK5 Inhibitor Against NF-κB-Mediated Inflammation in an Animal Model of Isoproterenol-Induced Myocardial Infarction" International Journal of Molecular Sciences 27, no. 1: 53. https://doi.org/10.3390/ijms27010053
APA StyleAlonazi, A. S., Bin Dayel, A. F., Alkhathlan, B. A., Alkaff, L. M., Alrashed, A. T., Bin Klaib, R. A., Elnagar, D. M., Alamin, M. A., Ali, R. A., Alameen, A. A., & Alrasheed, N. M. (2026). Potential Cardioprotective Effect of a GRK5 Inhibitor Against NF-κB-Mediated Inflammation in an Animal Model of Isoproterenol-Induced Myocardial Infarction. International Journal of Molecular Sciences, 27(1), 53. https://doi.org/10.3390/ijms27010053

