Establishment of Autoreactive CD4+CD8+ T Cell Hybridomas from Sjögren’s Disease Model, SATB1 Conditional Knockout Mice
Abstract
1. Introduction
2. Results
2.1. DP T Cells Preferentially Locate in the Salivary Glands of SATB1cKO Mice That Develop SjD-like Manifestations
2.2. Successful Generation of DP T Cell Hybridomas from T Cells in the cLNs of SATB1cKO Mice
2.3. Configuration of the TCR Genes in DP T Cell Hybridomas
2.4. The CDR3 Regions of the TCRβ Genes in DP T Cell Hybridomas Exhibit Characteristics of a Fetal Type
| CDR3 (β Chain) | Autoreactivity 1 | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Hybridoma | V Segment | V-D Junction | D Segment | D-J Junction | J Segment | Amino Acid Sequences | N Total | |||||
| P | N | P | P | N | P | |||||||
| F7 | GCCAGCTCTCTC | GA | T | GGA | GCCG | ATTCGCCCCTCTAC | ASSLDGADSPLY | 5 | Lost | |||
| G5-5B | GCCAGCAGTCTTTC | AGGG | C | GG | GCTGAGCAGTTC | ASSLSGRAEQF | 2 | + | ||||
| 5 | GCCAGCTCT | A | C | AG | CAAACACCGGGCAGCTCTAC | ASSTANTGQLY | 1 | + | ||||
| 35-10 | GCCTGGAGTC | CC | GGGACAGGG | AACTCCGACTACACC | AWSPGTGNSDYT | 0 | − | |||||
| 37-11 | GCCAGCTCTCAG | ACTGGGG | AG | GTGCAGAAACGCTGTAT | ASSQTGGGAETLY | 2 | + | |||||
| C9-12-12 | GCTAGCAGTAG | CTGGGG | AA | AAGACACCCAGTAC | ASSSWGKDTQY | 2 | + | |||||

2.5. Most DP T Cell Hybridoma Clones Are Autoreactive
3. Discussion
4. Materials and Methods
4.1. Mice
4.2. Flow Cytometry
4.3. Generation of T Cell Hybridomas
4.4. TCR Gene Cloning
4.5. Examination of Autoreactivity of T Cell Hybridoma Clones
4.6. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Correction Statement
Abbreviations
| SjD | Sjögren’s disease |
| SS | Sjögren’s syndrome |
| SATB1 | special AT-rich sequence binding protein-1 |
| APC | allophycocyanin |
| CDR3 | complementarity-determining region 3 |
| Cy7 | sulfo-cyanine 7 |
| cKO | conditional knockout |
| cLNs | cervical lymph nodes |
| DP | double positive |
| FACS | fluorescence-activated cell sorting |
| FITC | fluorescein isothiocyanate |
| IL-2 | interleukin-2 |
| MHC | major histocompatibility complex |
| P | palindrome |
| PE | phycoerythrin |
| RAG2 | recombination activating gene 2 |
| TCR | T cell receptor |
| TdT | terminal deoxynucleotidyl transferase |
| Treg | regulatory T cell |
| WT | wild type |
References
- Fox, R.I. Sjögren’s Syndrome. Lancet 2005, 366, 321–331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ramos-Casals, M.; Baer, A.N.; del Pilar Brito-Zerón, M.; Hammitt, K.M.; Bouillot, C.; Retamozo, S.; Mackey, A.; Yarowsky, D.; Turner, B.; Blanck, J.; et al. 2023 International Rome Consensus for the Nomenclature of Sjögren Disease. Nat. Rev. Rheumatol. 2025, 21, 426–437. [Google Scholar] [CrossRef] [Scilit]
- Kassan, S.S.; Moutsopoulos, H.M. Clinical Manifestations and Early Diagnosis of Sjögren Syndrome. Arch. Intern. Med. 2004, 164, 1275. [Google Scholar] [CrossRef] [Scilit]
- Davidson, A.; Diamond, B. Autoimmune Diseases. N. Engl. J. Med. 2001, 345, 340–350. [Google Scholar] [CrossRef] [Scilit]
- Suurmond, J.; Diamond, B. Autoantibodies in Systemic Autoimmune Diseases: Specificity and Pathogenicity. J. Clin. Investig. 2015, 125, 2194–2202. [Google Scholar] [CrossRef] [Scilit]
- Klein, L.; Kyewski, B.; Allen, P.M.; Hogquist, K.A. Positive and Negative Selection of the T Cell Repertoire: What Thymocytes See (and Don’t See). Nat. Rev. Immunol. 2014, 14, 377–391. [Google Scholar] [CrossRef] [Scilit]
- ElTanbouly, M.A.; Noelle, R.J. Rethinking Peripheral T Cell Tolerance: Checkpoints across a T Cell’s Journey. Nat. Rev. Immunol. 2021, 21, 257–267. [Google Scholar] [CrossRef] [Scilit]
- Dickinson, L.A.; Joh, T.; Kohwi, Y.; Kohwi-Shigematsu, T. A Tissue-Specific MAR/SAR DNA-Binding Protein with Unusual Binding Site Recognition. Cell 1992, 70, 631–645. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cai, S.; Lee, C.C.; Kohwi-Shigematsu, T. SATB1 Packages Densely Looped, Transcriptionally Active Chromatin for Coordinated Expression of Cytokine Genes. Nat. Genet. 2006, 38, 1278–1288. [Google Scholar] [CrossRef] [Scilit]
- Kondo, M.; Tanaka, Y.; Kuwabara, T.; Naito, T.; Kohwi-Shigematsu, T.; Watanabe, A. SATB1 Plays a Critical Role in Establishment of Immune Tolerance. J. Immunol. 2016, 196, 563–572, Erratum in J. Immunol. 2016, 196, 3495. https://doi.org/10.4049/jimmunol.1600293. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Naito, T.; Ise, M.; Tanaka, Y.; Kohwi-Shigematsu, T.; Kondo, M. Crucial Roles of SATB1 in Regulation of Thymocyte Migration after Positive Selection. J. Immunol. 2023, 211, 209–218. [Google Scholar] [CrossRef] [Scilit]
- Kitagawa, Y.; Ohkura, N.; Kidani, Y.; Vandenbon, A.; Hirota, K.; Kawakami, R.; Yasuda, K.; Motooka, D.; Nakamura, S.; Kondo, M.; et al. Guidance of Regulatory T Cell Development by Satb1-Dependent Super-Enhancer Establishment. Nat. Immunol. 2017, 18, 173–183, Erratum in Nat. Immunol. 2017, 18, 474. https://doi.org/10.1038/ni0417-474d. [Google Scholar] [CrossRef] [Scilit]
- Tanaka, Y.; Sotome, T.; Inoue, A.; Mukozu, T.; Kuwabara, T.; Mikami, T.; Kowhi-Shigematsu, T.; Kondo, M. SATB1 Conditional Knockout Results in Sjögren’s Syndrome in Mice. J. Immunol. 2017, 199, 4016–4022. [Google Scholar] [CrossRef] [Scilit]
- Tanaka, Y.; Onozato, M.; Mikami, T.; Kohwi-Shigematsu, T.; Fukushima, T.; Kondo, M. Increased Indoleamine 2,3-Dioxygenase Levels at the Onset of Sjögren’s Syndrome in SATB1-Conditional Knockout Mice. Int. J. Mol. Sci. 2021, 22, 10125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Akiba, Y.; Kuwabara, T.; Mukozu, T.; Mikami, T.; Kondo, M. Special AT-Rich Sequence Binding Protein 1 Is Required for Maintenance of T Cell Receptor Responsiveness and Development of Experimental Autoimmune Encephalomyelitis. Microbiol. Immunol. 2018, 62, 255–268. [Google Scholar] [CrossRef] [Scilit]
- Kuwabara, T.; Ishikawa, F.; Ikeda, M.; Ide, T.; Kohwi-Shigematsu, T.; Tanaka, Y.; Kondo, M. SATB1-Dependent Mitochondrial ROS Production Controls TCR Signaling in CD4 T Cells. Life Sci. Alliance 2021, 4. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gray, G.I.; Chukwuma, P.C.; Eldaly, B.; Perera, W.W.J.G.; Brambley, C.A.; Rosales, T.J.; Baker, B.M. The Evolving T Cell Receptor Recognition Code: The Rules Are More Like Guidelines. Immunol. Rev. 2025, 329, e13439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mosmann, T.R.; Cherwinski, H.; Bond, M.W.; Giedlin, M.A.; Coffman, R.L. Two Types of Murine Helper T Cell Clone. I. Definition According to Profiles of Lymphokine Activities and Secreted Proteins. J. Immunol. 2005, 175, 5–14. [Google Scholar] [CrossRef] [Scilit]
- White, J.; O’Brien, R.L.; Born, W.K. BW5147 and Derivatives for the Study of T Cells and Their Antigen Receptors. Arch. Immunol. Ther. Exp. 2020, 68, 15. [Google Scholar] [CrossRef] [Scilit]
- Canaday, D.H. Production of CD4+ and CD8+ T Cell Hybridomas. In Antigen Processing; Van Endert, P., Ed.; Methods in Molecular Biology; Humana Press: Totowa, NJ, USA, 2013; Volume 960; pp. 297–307. ISBN 978-1-62703-217-9. Erratum in Methods Mol. Biol. 2013, 960, E1. [Google Scholar] [CrossRef] [Scilit]
- Kakugawa, K.; Kojo, S.; Tanaka, H.; Seo, W.; Endo, T.A.; Kitagawa, Y.; Muroi, S.; Tenno, M.; Yasmin, N.; Kohwi, Y.; et al. Essential Roles of SATB1 in Specifying T Lymphocyte Subsets. Cell Rep. 2017, 19, 1176–1188. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Y.; Nguyen, P.; Vogel, P.; Li, B.; Jones, L.L.; Geiger, T.L. Autoimmune Susceptibility Imposed by Public TCRβ Chains. Sci. Rep. 2016, 6, 37543. [Google Scholar] [CrossRef] [Scilit]
- Hao, B.; Naik, A.K.; Watanabe, A.; Tanaka, H.; Chen, L.; Richards, H.W.; Kondo, M.; Taniuchi, I.; Kohwi, Y.; Kohwi-Shigematsu, T.; et al. An Anti-Silencer– and SATB1-Dependent Chromatin Hub Regulates Rag1 and Rag2 Gene Expression during Thymocyte Development. J. Exp. Med. 2015, 212, 809–824. [Google Scholar] [CrossRef] [Scilit]
- Elliott, J.I.; Altmann, D.M. Dual T Cell Receptor Alpha Chain T Cells in Autoimmunity. J. Exp. Med. 1995, 182, 953–959. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ji, Q.; Perchellet, A.; Goverman, J.M. Viral Infection Triggers Central Nervous System Autoimmunity Via Activation of Dual TCR-Expressing CD8+ T Cells. Nat. Immunol. 2010, 11, 628–634. [Google Scholar] [CrossRef] [Scilit]
- Bogue, M.; Gilfillan, S.; Benoist, C.; Mathis, D. Regulation of N-Region Diversity in Antigen Receptors through Thymocyte Differentiation and Thymus Ontogeny. Proc. Natl. Acad. Sci. USA 1992, 89, 11011–11015. [Google Scholar] [CrossRef] [Scilit]
- Sanromán, Á.F.; Joshi, K.; Au, L.; Chain, B.; Turajlic, S. TCR Sequencing: Applications in Immuno-Oncology Research. Immuno-Oncol. Technol. 2023, 17, 100373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lieber, M.R. The Mechanism of V(D)J Recombination: A Balance of Diversity, Specificity, and Stability. Cell 1992, 70, 873–876. [Google Scholar] [CrossRef] [Scilit]
- Bassing, C.H.; Swat, W.; Alt, F.W. The Mechanism and Regulation of Chromosomal V(D)J Recombination. Cell 2002, 109, S45–S55. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Komori, T.; Okada, A.; Stewart, V.; Alt, F.W. Lack of N Regions in Antigen Receptor Variable Region Genes of TdT-Deficient Lymphocytes. Science 1993, 261, 1171–1175. [Google Scholar] [CrossRef] [Scilit]
- Gilfillan, S.; Dierich, A.; Lemeur, M.; Benoist, C.; Mathis, D. Mice Lacking TdT: Mature Animals with an Immature Lymphocyte Repertoire. Science 1993, 261, 1175–1178, Erratum in Science 1993, 262, 1957. [Google Scholar] [CrossRef] [Scilit]
- Sethna, Z.; Elhanati, Y.; Dudgeon, C.R.; Callan, C.G.; Levine, A.J.; Mora, T.; Walczak, A.M. Insights into Immune System Development and Function from Mouse T-Cell Repertoires. Proc. Natl. Acad. Sci. USA 2017, 114, 2253–2258, Erratum in Proc Natl Acad Sci USA 2017, 114, E2798. https://doi.org/10.1073/pnas.1702795114. [Google Scholar] [CrossRef] [Scilit]
- Rudolph, M.G.; Stanfield, R.L.; Wilson, I.A. How TCRs Bind MHCs, Peptides, and Coreceptors. Annu. Rev. Immunol. 2006, 24, 419–466. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kappler, J.W.; Skidmore, B.; White, J.; Marrack, P. Antigen-Inducible, H-2-Restricted, Interleukin-2-Producing T Cell Hybridomas. Lack of Independent Antigen and H-2 Recognition. J. Exp. Med. 1981, 153, 1198–1214. [Google Scholar] [CrossRef] [PubMed]
- Carbone, A.M.; Marrack, P.; Kappler, J.W. Remethylation at Sites 5′ of the Murine Lyt-2 Gene in Association with Shutdown of Lyt-2 Expression. J. Immunol. 1988, 141, 1369–1375. [Google Scholar] [CrossRef] [Scilit]



| Hybridoma | α Chain | β Chain | |||||
|---|---|---|---|---|---|---|---|
| V Segment | J Segment | C Segment | V Segment | D Segment | J Segment | C Segment | |
| F7 | TRAV13-4/TRDV 7 | TRAJ26 | TRAC | TRBV12-1 | TRBD1 | TRBJ1-6 | TRBC1 |
| TRAV3-4 | TRAJ56 | TRAC | |||||
| G5-5B | TRAV21/TRDV12 | TRAJ53 | TRAC | TRBV26 | TRBD1 | TRBJ2-1 | TRBC2 |
| 5 | TRAV16 | TRAJ58 | TRAC | TRBV12-1 | TRBD1 | TRBJ2-2 | TRBC2 |
| 35-10 | TRAV7-3 | TRAJ49 | TRAC | TRBV31 | TRBD1 | TRBJ1-2 | TRBC1 |
| TRAV6-7/TRDV9 | TRAJ48 | TRAC | |||||
| 37-11 | TRAV7D-3 | TRAJ50 | TRAC | TRBV12-1 | TRBD2 | TRBJ2-3 | TRBC2 |
| TRAV6-6 | TRAJ48 | TRAC | |||||
| C-9-12-12 | TRAV4-4/TRDV10 | TRAJ53 | TRAC | TRBV17 | TRBD2 | TRBJ2-5 | TRBC2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Mashimo, S.; Arita, M.; Kuwabara, T.; Naito, T.; Takizawa, S.; Inoue, A.; Ishiko, A.; Kondo, M.; Tanaka, Y. Establishment of Autoreactive CD4+CD8+ T Cell Hybridomas from Sjögren’s Disease Model, SATB1 Conditional Knockout Mice. Int. J. Mol. Sci. 2026, 27, 414. https://doi.org/10.3390/ijms27010414
Mashimo S, Arita M, Kuwabara T, Naito T, Takizawa S, Inoue A, Ishiko A, Kondo M, Tanaka Y. Establishment of Autoreactive CD4+CD8+ T Cell Hybridomas from Sjögren’s Disease Model, SATB1 Conditional Knockout Mice. International Journal of Molecular Sciences. 2026; 27(1):414. https://doi.org/10.3390/ijms27010414
Chicago/Turabian StyleMashimo, Shuhei, Michitsune Arita, Taku Kuwabara, Taku Naito, Sakurako Takizawa, Akiko Inoue, Akira Ishiko, Motonari Kondo, and Yuriko Tanaka. 2026. "Establishment of Autoreactive CD4+CD8+ T Cell Hybridomas from Sjögren’s Disease Model, SATB1 Conditional Knockout Mice" International Journal of Molecular Sciences 27, no. 1: 414. https://doi.org/10.3390/ijms27010414
APA StyleMashimo, S., Arita, M., Kuwabara, T., Naito, T., Takizawa, S., Inoue, A., Ishiko, A., Kondo, M., & Tanaka, Y. (2026). Establishment of Autoreactive CD4+CD8+ T Cell Hybridomas from Sjögren’s Disease Model, SATB1 Conditional Knockout Mice. International Journal of Molecular Sciences, 27(1), 414. https://doi.org/10.3390/ijms27010414

