Anti-Hair Loss Effect of Veratric Acid on Dermal Papilla Cells
Abstract
1. Introduction
2. Results
2.1. Veratric Acid Increases Proliferation of HFDPCs
2.2. Veratric Acid Promotes Expression of Growth Factors Involved in Hair Growth
2.3. Veratric Acid Improves Hair Inductivity
2.4. Veratric Acid Reduces Apoptosis of HFDPCs
2.5. Veratric Acid Inhibits Senescence in Replicative Senescent HFDPCs
2.6. Veratric Acid Alleviates Oxidative Stress-Induced Senescence of HFDPCs
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Ethical Statement
4.3. Cell Viability Assay
4.4. Cell Proliferation Assay
4.5. Quantitative Real-Time PCR
4.6. Western Blot Analysis
4.7. Aggregation Assay
4.8. Alkaline Phosphatase Staining
4.9. Apoptosis
4.10. Replicative and H2O2-Induced Senescence
4.11. SA β-Galactosidase Staining
4.12. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Phillips, T.G.; Slomiany, W.P.; Allison, R. Hair loss: Common causes and treatment. Am. Fam. Physician 2017, 96, 371–378. [Google Scholar] [PubMed]
- Teumer, J.; Cooley, J. Follicular Cell Implantation: An Emerging Cell Therapy for Hair Loss. Semin. Plast. Surg. 2005, 19, 193–200. [Google Scholar] [CrossRef]
- Poblet, E.; Jiménez, F.; Ortega, F. The contribution of the arrector pili muscle and sebaceous glands to the follicular unit structure. J. Am. Acad. Dermatol. 2004, 51, 217–222. [Google Scholar] [CrossRef] [PubMed]
- Rahmani, W.; Abbasi, S.; Hagner, A.; Raharjo, E.; Kumar, R.; Hotta, A.; Magness, S.; Metzger, D.; Biernaskie, J. Hair follicle dermal stem cells regenerate the dermal sheath, repopulate the dermal papilla, and modulate hair type. Dev. Cell. 2014, 31, 543–558. [Google Scholar] [CrossRef] [PubMed]
- Topouzi, H.; Logan, N.J.; Williams, G.; Higgins, C.A. Methods for the isolation and 3D culture of dermal papilla cells from human hair follicles. Exp. Dermatol. 2017, 26, 491–496. [Google Scholar] [CrossRef]
- Higgins, C.A.; Chen, J.C.; Cerise, J.E.; Jahoda, C.A.; Christiano, A.M. Microenvironmental reprogramming by three-dimensional culture enables dermal papilla cells to induce de novo human hair-follicle growth. Proc. Natl. Acad. Sci. USA 2013, 110, 19679–19688. [Google Scholar] [CrossRef]
- Kim, H.; Choi, N.; Kim, D.Y.; Kim, S.Y.; Song, S.Y.; Sung, J.H. TGF-β2 and collagen play pivotal roles in the spheroid formation and anti-aging of human dermal papilla cells. Aging 2021, 13, 19978–19995. [Google Scholar] [CrossRef]
- Wang, W.; Wang, H.; Long, Y.; Li, Z.; Li, J. Controlling Hair Loss by Regulating Apoptosis in Hair Follicles: A Comprehensive Overview. Biomolecules 2023, 14, 20. [Google Scholar] [CrossRef]
- Morgan, B.A. The dermal papilla: An instructive niche for epithelial stem and progenitor cells in development and regeneration of the hair follicle. Cold Spring Harb. Perspect. Med. 2014, 4, a015180. [Google Scholar] [CrossRef]
- Liu, F.; Liu, S.; Luo, X.; Fan, Z.; Huang, S.; Deng, F.; Liu, H.; Shi, G. Combatting ageing in dermal papilla cells and promoting hair follicle regeneration using exosomes from human hair follicle dermal sheath cup cells. Exp. Dermatol. 2024, 33, e14948. [Google Scholar] [CrossRef]
- Huang, W.Y.; Huang, Y.C.; Huang, K.S.; Chan, C.C.; Chiu, H.Y.; Tsai, R.Y.; Chan, J.Y.; Lin, S.J. Stress-induced premature senescence of dermal papilla cells compromises hair follicle epithelial-mesenchymal interaction. J. Dermatol. Sci. 2017, 86, 114–122. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.Y.; Seguin, P.; Ahn, J.K.; Kim, J.J.; Chun, S.C.; Kim, E.H.; Seo, S.H.; Kang, E.Y.; Kim, S.L.; Park, Y.J.; et al. Phenolic compound concentration and antioxidant activities of edible and medicinal mushrooms from Korea. J. Agric. Food Chem. 2008, 56, 7265–7270. [Google Scholar] [CrossRef] [PubMed]
- Choi, W.S.; Shin, P.G.; Lee, J.H.; Kim, G.D. The regulatory effect of veratric acid on NO production in LPS-stimulated RAW264.7 macrophage cells. Cell Immunol. 2012, 280, 164–170. [Google Scholar] [CrossRef]
- Shin, S.W.; Jung, E.; Kim, S.; Lee, K.E.; Youm, J.K.; Park, D. Antagonist effects of veratric acid against UVB-induced cell damages. Molecules. 2013, 18, 5405–5419. [Google Scholar] [CrossRef]
- Ma, B.; Hottiger, M.O. Crosstalk between Wnt/β-Catenin and NF-κB Signaling Pathway during Inflammation. Front. Immunol. 2016, 7, 378. [Google Scholar] [CrossRef]
- Van Hove, L.; Toniolo, A.; Ghiasloo, M.; Lecomte, K.; Boone, F.; Ciers, M.; Raaijmakers, K.; Vandamme, N.; Roles, J.; Maschalidi, S.; et al. Autophagy critically controls skin inflammation and apoptosis-induced stem cell activation. Autophagy 2023, 19, 2958–2971. [Google Scholar] [CrossRef] [PubMed]
- Park, S.; Lim, Y.J.; Kim, H.S.; Shin, H.J.; Kim, J.S.; Lee, J.N.; Lee, J.H.; Bae, S. Phloroglucinol Enhances Anagen Signaling and Alleviates H2O2-Induced Oxidative Stress in Human Dermal Papilla Cells. J. Microbiol. Biotechnol. 2024, 34, 812–827. [Google Scholar] [CrossRef]
- Chen, J.; Fan, Z.X.; Zhu, D.C.; Guo, Y.L.; Ye, K.; Dai, D.; Guo, Z.; Hu, Z.Q.; Miao, Y.; Qu, Q. Emerging Role of Dermal White Adipose Tissue in Modulating Hair Follicle Development During Aging. Front. Cell Dev. Biol. 2021, 9, 728188. [Google Scholar] [CrossRef]
- Topacio, B.R.; Zatulovskiy, E.; Cristea, S.; Xie, S.; Tambo, C.S.; Rubin, S.M.; Sage, J.; Kõivomägi, M.; Skotheim, J.M. Cyclin D-Cdk4,6 drives cell-cycle progression via the retinoblastoma protein’s c-terminal helix. Mol. Cell. 2019, 74, 758–770.e4. [Google Scholar] [CrossRef]
- Enshell-Seijffers, D.; Lindon, C.; Kashiwagi, M.; Morgan, B.A. beta-catenin activity in the dermal papilla regulates morphogenesis and regeneration of hair. Dev. Cell. 2010, 18, 633–642. [Google Scholar] [CrossRef]
- Choi, B.Y. Targeting Wnt/β-Catenin Pathway for Developing Therapies for Hair Loss. Int. J. Mol. Sci. 2020, 21, 4915. [Google Scholar] [CrossRef]
- Iida, M.; Ihara, S.; Matsuzaki, T. Hair cycle-dependent changes of alkaline phosphatase activity in the mesenchyme and ep-ithelium in mouse vibrissal follicles. Dev. Growth Differ. 2007, 49, 185–195. [Google Scholar] [CrossRef] [PubMed]
- Botchkareva, N.V.; Ahluwalia, G.; Shander, D. Apoptosis in the hair follicle. J. Investig. Dermatol. 2006, 126, 258–264. [Google Scholar] [CrossRef] [PubMed]
- Han, J.H.; Kwon, O.S.; Chung, J.H.; Cho, K.H.; Eun, H.C.; Kim, K.H. Effect of minoxidil on proliferation and apoptosis in dermal papilla cells of human hair follicle. J. Dermatol. Sci. 2004, 34, 91–98. [Google Scholar] [CrossRef]
- Kalkavan, H.; Green, D.R. MOMP, cell suicide as a BCL-2 family business. Cell Death Differ. 2018, 25, 46–55. [Google Scholar] [CrossRef]
- Campisi, J. Replicative senescence: An old lives’ tale? Cell 1996, 84, 497–500. [Google Scholar] [CrossRef]
- Coppé, J.P.; Desprez, P.Y.; Krtolica, A.; Campisi, J. The senescence-associated secretory phenotype: The dark side of tumor suppression. Annu. Rev. Pathol. 2010, 5, 99–118. [Google Scholar] [CrossRef] [PubMed]
- Sarkar, D.; Lebedeva, I.V.; Emdad, L.; Kang, D.C.; Baldwin, A.S., Jr.; Fisher, P.B. Human polynucleotide phosphorylase (hPNPaseold-35): A potential link between aging and inflammation. Cancer Res. 2004, 64, 7473–7478. [Google Scholar] [CrossRef]
- Kwack, M.H.; Ahn, J.S.; Kim, M.K.; Kim, J.C.; Sung, Y.K. Dihydrotestosterone-inducible IL-6 inhibits elongation of human hair shafts by suppressing matrix cell proliferation and promotes regression of hair follicles in mice. J. Investig. Dermatol. 2012, 132, 43–49. [Google Scholar] [CrossRef]
- Shin, H.; Yoo, H.G.; Inui, S.; Itami, S.; Kim, I.G.; Cho, A.R.; Lee, D.H.; Park, W.S.; Kwon, O.; Cho, K.H.; et al. Induction of transforming growth factor-beta 1 by androgen is mediated by reactive oxygen species in hair follicle dermal papilla cells. BMB Rep. 2013, 46, 460–464. [Google Scholar] [CrossRef]
- Inui, S.; Fukuzato, Y.; Nakajima, T.; Yoshikawa, K.; Itami, S. Androgen-inducible TGF-beta1 from balding dermal papilla cells inhibits epithelial cell growth: A clue to understand paradoxical effects of androgen on human hair growth. FASEB J. 2002, 16, 1967–1969. [Google Scholar] [CrossRef] [PubMed]
- Yan, J.; Chen, S.; Yi, Z.; Zhao, R.; Zhu, J.; Ding, S.; Wu, J. The role of p21 in cellular senescence and aging-related diseases. Mol. Cells. 2024, 47, 100113. [Google Scholar] [CrossRef]
- Park, B.; Kim, D.; Lee, Y.; Choi, S.; Park, H.; Lee, S.; Hwang, J. The Inhibition of Oxidative Stress-Mediated Cell Apoptosis by the Caspase Inhibitor (S)-3-((S)-2-(6-(2,3-dihydrobenzo[b][1,4]dioxin-6-yl)-1-oxoisoindolin-2-yl)butanamido)-4-oxo-5-(2,3,5,6-tetrafluorophenoxy)pentanoic Acid in Human Dermal Papilla Cells. Cosmetics 2024, 11, 105. [Google Scholar] [CrossRef]
- Van Scott, E.J.; Ekel, T.M. Geometric relationships between the matrix of the hair bulb and its dermal papilla in normal and alopecic scalp. J. Investig. Dermatol. 1958, 31, 281–287. [Google Scholar] [CrossRef] [PubMed]
- Chi, W.; Wu, E.; Morgan, B.A. Dermal papilla cell number specifies hair size, shape and cycling and its reduction causes follicular decline. Development 2013, 140, 1676–1683. [Google Scholar] [CrossRef]
- Shtutman, M.; Zhurinsky, J.; Simcha, I.; Albanese, C.; D’Amico, M.; Pestell, R.; Ben-Ze’ev, A. The cyclin D1 gene is a target of the beta-catenin/LEF-1 pathway. Proc. Natl. Acad. Sci. USA 1999, 96, 5522–5527. [Google Scholar] [CrossRef] [PubMed]
- Soma, T.; Fujiwara, S.; Shirakata, Y.; Hashimoto, K.; Kishimoto, J. Hair-Inducing Ability of Human Dermal Papilla Cells Cultured Under Wnt/Beta-Catenin Signalling Activation. Exp. Dermatol. 2012, 21, 307–309. [Google Scholar] [CrossRef]
- Chen, D.; Jarrell, A.; Guo, C.; Lang, R.; Atit, R. Dermal β-catenin activity in response to epidermal Wnt ligands is required for fibroblast proliferation and hair follicle initiation. Development 2012, 139, 1522–1533. [Google Scholar] [CrossRef]
- Li, W.; Man, X.Y.; Li, C.M.; Chen, J.Q.; Zhou, J.; Cai, S.Q.; Lu, Z.F.; Zheng, M. VEGF induces proliferation of human hair follicle dermal papilla cells through VEGFR-2-mediated activation of ERK. Exp. Cell Res. 2012, 318, 1633–1640. [Google Scholar] [CrossRef]
- Zhang, H.; Nan, W.; Wang, S.; Zhang, T.; Si, H.; Wang, D.; Yang, F.; Li, G. Epidermal growth factor promotes proliferation of dermal papilla cells via Notch signaling pathway. Biochimie 2016, 127, 10–18. [Google Scholar] [CrossRef]
- Zhang, H.; Nan, W.; Wang, S.; Zhang, T.; Si, H.; Yang, F.; Li, G. Epidermal Growth Factor Promotes Proliferation and Migration of Follicular Outer Root Sheath Cells via Wnt/β-Catenin Signaling. Cell. Physiol. Biochem. 2016, 39, 360–370. [Google Scholar] [CrossRef] [PubMed]
- Ahn, S.Y.; Pi, L.Q.; Hwang, S.T.; Lee, W.S. Effect of IGF-I on Hair Growth Is Related to the Anti-Apoptotic Effect of IGF-I and Up-Regulation of PDGF-A and PDGF-B. Ann. Dermatol. 2012, 24, 26–31. [Google Scholar] [CrossRef]
- Lee, Y.R.; Yamazaki, M.; Mitsui, S.; Tsuboi, R.; Ogawa, H. Hepatocyte growth factor (HGF) activator expressed in hair follicles is involved in in vitro HGF-dependent hair follicle elongation. J. Dermatol. Sci. 2001, 25, 156–163. [Google Scholar] [CrossRef] [PubMed]
- Osada, A.; Iwabuchi, T.; Kishimoto, J.; Hamazaki, T.S.; Okochi, H. Long-term culture of mouse vibrissal dermal papilla cells and de novo hair follicle induction. Tissue Eng. 2007, 13, 975–982. [Google Scholar] [CrossRef]
- McElwee, K.J.; Kissling, S.; Wenzel, E.; Huth, A.; Hoffmann, R. Cultured peribulbar dermal sheath cells can induce hair follicle development and contribute to the dermal sheath and dermal papilla. J. Investig. Dermatol. 2003, 121, 1267–1275. [Google Scholar] [CrossRef] [PubMed]
- Jahoda, C.A.; Oliver, R.F. Vibrissa dermal papilla cell aggregative behaviour in vivo and in vitro. J. Embryol. Exp. Morphol. 1984, 79, 211–224. [Google Scholar] [CrossRef]
- Kwack, M.H.; Jang, Y.J.; Won, G.H.; Kim, M.K.; Kim, J.C.; Sung, Y.K. Overexpression of alkaline phosphatase improves the hair-inductive capacity of cultured human dermal papilla spheres. J. Dermatol. Sci. 2019, 95, 126–129. [Google Scholar] [CrossRef]
- Kang, B.M.; Kwack, M.H.; Kim, M.K.; Kim, J.C.; Sung, Y.K. Sphere formation increases the ability of cultured human dermal papilla cells to induce hair follicles from mouse epidermal cells in a reconstitution assay. J. Investig. Dermatol. 2012, 132, 237–239. [Google Scholar] [CrossRef]
- Soma, T.; Ogo, M.; Suzuki, J.; Takahashi, T.; Hibino, T. Analysis of apoptotic cell death in human hair follicles in vivo and in vitro. J. Investig. Dermatol. 1998, 111, 948–954. [Google Scholar] [CrossRef]
- Ogrodnik, M. Cellular aging beyond cellular senescence: Markers of senescence prior to cell cycle arrest in vitro and in vivo. Aging Cell. 2021, 20, e13338. [Google Scholar] [CrossRef]
- Salminen, A.; Kauppinen, A.; Kaarniranta, K. Emerging role of NF-κB signaling in the induction of senescence-associated secretory phenotype (SASP). Cell Signal. 2012, 24, 835–845. [Google Scholar] [CrossRef] [PubMed]
- Ueda, S.; Tominaga, T.; Ochi, A.; Sakurai, A.; Nishimura, K.; Shibata, E.; Wakino, S.; Tamaki, M.; Nagai, K. TGF-β1 is involved in senescence-related pathways in glomerular endothelial cells via p16 translocation and p21 induction. Sci. Rep. 2021, 11, 21643. [Google Scholar] [CrossRef] [PubMed]
- Upton, J.H.; Hannen, R.F.; Bahta, A.W.; Farjo, N.; Farjo, B.; Philpott, M.P. Oxidative stress-associated senescence in dermal papilla cells of men with androgenetic alopecia. J. Investig. Dermatol. 2015, 135, 1244–1252. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.Y.; Gupta, B.; Park, H.G.; Son, M.; Jun, J.H.; Yong, C.S.; Kim, J.A.; Kim, J.O. Preclinical and clinical studies demonstrate that the proprietary herbal extract DA-5512 effectively stimulates hair growth and promotes hair health. Evid. Based Complement. Alternat. Med. 2017, 2017, 4395638. [Google Scholar] [CrossRef]







| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| EGF | TGCCAGCTGCACAAATACAGA | TCTTACGGAATAGTGGTGGTCATC |
| HGF | GAGAGTTGGGTTCTTACTGCACG | CTCATCTCCTCTTCCGTGGACA |
| IGF1 | AGGAAGTACATTTGAAGAACGCAACT | CCTGCGGTGGCATGTCA |
| VEGFA | TTGCCTTGCTGCTCTACCTCCA | GATGGCAGTAGCTGCGCTGATA |
| CCND1 | TCTACACCGACAACTCCATCCG | TCTGGCATTTTGGAGAGGAAGTG |
| LEF1 | CTACCCATCCTCACTGTCAGTC | GGATGTTCCTGTTTGACCTGAGG |
| TGFB1 | TACAACCCGTGTTGCTCTC | GTTGCTGAGGTATCGCCAGGAA |
| TGFB2 | AAGAAGCGTGCTTTGGATGCGG | ATGCTCCAGCACAGAAGTTGGC |
| BCL2 | ATCGCCCTGTGGATGACTGAGT | GCCAGGAGAAATCAAACAGAGGC |
| BAX | TCAGGATGCGTCCACCAAGAAG | TGTGTCCACGGCGGCAATCATC |
| IL6 | AGACAGCCACTCACCTCTTCAG | TTCTGCCAGTGCCTCTTTGCTG |
| P21 | AGGTGGACCTGGAGACTCTCAG | TCCTCTTGGAGAAGATCAGCCG |
| GAPDH | GTCTCCTCTGACTTCAACAGCG | ACCACCCTGTTGCTGTAGCCAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
You, J.; Jang, Y.; Sim, J.; Ryu, D.; Cho, E.; Park, D.; Jung, E. Anti-Hair Loss Effect of Veratric Acid on Dermal Papilla Cells. Int. J. Mol. Sci. 2025, 26, 2240. https://doi.org/10.3390/ijms26052240
You J, Jang Y, Sim J, Ryu D, Cho E, Park D, Jung E. Anti-Hair Loss Effect of Veratric Acid on Dermal Papilla Cells. International Journal of Molecular Sciences. 2025; 26(5):2240. https://doi.org/10.3390/ijms26052240
Chicago/Turabian StyleYou, Jiyoung, Youngsu Jang, Junbo Sim, Dehun Ryu, Eunae Cho, Deokhoon Park, and Eunsun Jung. 2025. "Anti-Hair Loss Effect of Veratric Acid on Dermal Papilla Cells" International Journal of Molecular Sciences 26, no. 5: 2240. https://doi.org/10.3390/ijms26052240
APA StyleYou, J., Jang, Y., Sim, J., Ryu, D., Cho, E., Park, D., & Jung, E. (2025). Anti-Hair Loss Effect of Veratric Acid on Dermal Papilla Cells. International Journal of Molecular Sciences, 26(5), 2240. https://doi.org/10.3390/ijms26052240

