Astaxanthin Alleviates Oxidative Stress in Mouse Preantral Follicles and Enhances Follicular Development Through the AMPK Signaling Pathway
Abstract
1. Introduction
2. Results
2.1. Astaxanthin Enhances the In Vitro Development of Mouse Preantral Follicles
2.2. Astaxanthin Increases the Area of Follicle Adhesion and the Secretion of Estradiol
2.3. Astaxanthin Reduces Lipid Peroxidation and Enhances Antioxidant Capacity in Follicles
2.4. Astaxanthin Reduces the ROS Levels in Oocytes Likely Through the AMPK Signaling Pathway
2.5. Astaxanthin Upregulates the Expression Levels of Mitochondrial Biogenesis and Antioxidant Proteins Possibly Through the AMPK Signaling Pathway
2.6. Astaxanthin Enhances the Expression of Mitochondrial Genes in Oocytes Possibly Through the AMPK Signaling Pathway
2.7. Astaxanthin May Enhance the Mitophagy of Follicles Through the AMPK Signaling Pathway
2.8. Astaxanthin Increases the Mitochondrial Membrane Potential of Oocytes Potentially Through the AMPK Signaling Pathway
2.9. Astaxanthin Likely Regulates the Expression of Apoptosis Proteins in Follicles Through the AMPK Signaling Pathway
2.10. Astaxanthin Promotes the Secretion of Estradiol by Follicles Potentially Through the AMPK Signaling Pathway
3. Discussion
4. Materials and Methods
4.1. Study Animals
4.2. In Vitro Culture of Preantral Follicles
4.3. ELISA
4.4. Detection of MDA Levels in Follicles
4.5. qRT-PCR
4.6. ROS Level Detection in Oocytes
4.7. Western Blot
4.8. Mitochondrial Membrane Potential Analysis Using JC-1
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| ROS | Reactive oxygen species |
| AMPK | Adenosine monophosphate-activated protein kinase |
| PGC-1α | Peroxisome proliferator-activated receptor gamma coactivator 1α |
| SOD1 | Superoxide dismutase 1 |
| GSH | Glutathione |
| CO1 | Cytochrome c oxidase subunit 1 |
| CO2 | Cytochrome c oxidase subunit 2 |
| CO3 | Cytochrome c oxidase subunit 3 |
| ATP6 | ATP synthase F0 subunit 6 |
| ATP8 | ATP synthase F0 subunit 8 |
| TOM20 | Translocase of the outer membrane subunit 20 |
| MDA | Malondialdehyde |
| qRT-PCR | Quantitative real-time PCR |
| NRF1 | Nuclear factor erythroid-2-related factor 1 |
| TFAM | Mitochondrial transcription factor A |
| NRF2 | Nuclear factor erythroid-2-related factor 2 |
| HO-1 | Heme oxygenase-1 |
| StAR | Steroidogenic acute regulatory protein |
| P450scc | P4350 cholesterol side-chain cleavage enzyme |
References
- de Figueiredo, J.R.; de Lima, L.F.; Silva, J.R.V.; Santos, R.R. Control of growth and development of preantral follicle: Insights from in vitro culture. Anim. Reprod. 2018, 15 (Suppl. S1), 648–659. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Zelinski, M.B. Oocyte quality following in vitro follicle developmentdagger. Biol. Reprod. 2022, 106, 291–315. [Google Scholar] [CrossRef] [PubMed]
- Vabre, P.; Gatimel, N.; Moreau, J.; Gayrard, V.; Picard-Hagen, N.; Parinaud, J.; Leandri, R.D. Environmental pollutants, a possible etiology for premature ovarian insufficiency: A narrative review of animal and human data. Environ. Health 2017, 16, 37. [Google Scholar] [CrossRef] [PubMed]
- Pampanini, V.; Wagner, M.; Asadi-Azarbaijani, B.; Oskam, I.C.; Sheikhi, M.; Sjodin, M.O.D.; Lindberg, J.; Hovatta, O.; Sahlin, L.; Bjorvang, R.D.; et al. Impact of first-line cancer treatment on the follicle quality in cryopreserved ovarian samples from girls and young women. Hum. Reprod. 2019, 34, 1674–1685. [Google Scholar] [CrossRef]
- Lee, J.; Kim, E.J.; Kong, H.S.; Youm, H.W.; Kim, S.K.; Lee, J.R.; Suh, C.S.; Kim, S.H. Comparison of the Oocyte Quality Derived from Two-Dimensional Follicle Culture Methods and Developmental Competence of In Vitro Grown and Matured Oocytes. Biomed. Res. Int. 2018, 2018, 7907092. [Google Scholar] [CrossRef]
- Zhang, T.; Chen, Y.; Yang, Y.; Wang, Z.; Pan, Q.; Xu, S.; Sun, Z. The potentiality of two-dimensional preantral follicle culture as an in vitro model in predicting premature ovarian failure. Exp. Toxicol. Pathol. 2017, 69, 477–484. [Google Scholar] [CrossRef]
- Koohestani, N.V.; Zavareh, S.; Lashkarbolouki, T.; Azimipour, F. Exposure to cell phone induce oxidative stress in mice preantral follicles during in vitro cultivation: An experimental study. Int. J. Reprod. Biomed. 2019, 17, 637–646. [Google Scholar] [CrossRef]
- Wang, Y.; Yang, C.; Elsheikh, N.A.H.; Li, C.; Yang, F.; Wang, G.; Li, L. HO-1 reduces heat stress-induced apoptosis in bovine granulosa cells by suppressing oxidative stress. Aging 2019, 11, 5535–5547. [Google Scholar] [CrossRef]
- Shi, X.Y.; Guan, Z.Q.; Yu, J.N.; Liu, H.L. Follicle Stimulating Hormone Inhibits the Expression of p53 Up-Regulated Modulator of Apoptosis Induced by Reactive Oxygen Species Through PI3K/Akt in Mouse Granulosa Cells. Physiol. Res. 2020, 69, 687–694. [Google Scholar] [CrossRef]
- Sztretye, M.; Dienes, B.; Gonczi, M.; Czirjak, T.; Csernoch, L.; Dux, L.; Szentesi, P.; Keller-Pinter, A. Astaxanthin: A Potential Mitochondrial-Targeted Antioxidant Treatment in Diseases and with Aging. Oxid. Med. Cell. Longev. 2019, 2019, 3849692. [Google Scholar] [CrossRef]
- Cajas, Y.N.; Canon-Beltran, K.; Ladron de Guevara, M.; Millan de la Blanca, M.G.; Ramos-Ibeas, P.; Gutierrez-Adan, A.; Rizos, D.; Gonzalez, E.M. Antioxidant Nobiletin Enhances Oocyte Maturation and Subsequent Embryo Development and Quality. Int. J. Mol. Sci. 2020, 21, 5340. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez-Varela, C.; Labarta, E. Clinical Application of Antioxidants to Improve Human Oocyte Mitochondrial Function: A Review. Antioxidants 2020, 9, 1197. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Li, L.; Fan, L.H.; Jing, Y.; Li, J.; Ouyang, Y.C.; Wang, Z.B.; Hou, Y.; Sun, Q.Y. N-acetyl-L-cysteine (NAC) delays post-ovulatory oocyte aging in mouse. Aging 2019, 11, 2020–2030. [Google Scholar] [CrossRef]
- Jia, B.Y.; Xiang, D.C.; Shao, Q.Y.; Zhang, B.; Liu, S.N.; Hong, Q.H.; Quan, G.B.; Wu, G.Q. Inhibitory effects of astaxanthin on postovulatory porcine oocyte aging in vitro. Sci. Rep. 2020, 10, 20217. [Google Scholar] [CrossRef] [PubMed]
- Babalola, J.A.; StraCke, A.; Loeffler, T.; Schilcher, I.; Sideromenos, S.; Flunkert, S.; Neddens, J.; Lignell, A.; Prokesch, M.; Pazenboeck, U.; et al. Effect of astaxanthin in type-2 diabetes-induced APPxhQC transgenic and NTG mice. Mol. Metab. 2024, 85, 101959. [Google Scholar] [CrossRef]
- Chen, Z.; Xiao, J.; Liu, H.; Yao, K.; Hou, X.; Cao, Y.; Liu, X. Astaxanthin attenuates oxidative stress and immune impairment in D-galactose-induced aging in rats by activating the Nrf2/Keap1 pathway and suppressing the NF-kappaB pathway. Food Funct. 2020, 11, 8099–8111. [Google Scholar] [CrossRef]
- Abdel-Ghani, M.A.; Yanagawa, Y.; Balboula, A.Z.; Sakaguchi, K.; Kanno, C.; Katagiri, S.; Takahashi, M.; Nagano, M. Astaxanthin improves the developmental competence of in vitro-grown oocytes and modifies the steroidogenesis of granulosa cells derived from bovine early antral follicles. Reprod. Fertil. Dev. 2019, 31, 272–281. [Google Scholar] [CrossRef]
- Kuroki, T.; Ikeda, S.; Okada, T.; Maoka, T.; Kitamura, A.; Sugimoto, M.; Kume, S. Astaxanthin ameliorates heat stress-induced impairment of blastocyst development in vitro:–astaxanthin colocalization with and action on mitochondria–. J. Assist. Reprod. Genet. 2013, 30, 623–631. [Google Scholar] [CrossRef]
- Li, R.; Wu, H.; Zhuo, W.W.; Mao, Q.F.; Lan, H.; Zhang, Y.; Hua, S. Astaxanthin Normalizes Epigenetic Modifications of Bovine Somatic Cell Cloned Embryos and Decreases the Generation of Lipid Peroxidation. Reprod. Domest. Anim. 2015, 50, 793–799. [Google Scholar] [CrossRef]
- Li, Y.; Dong, Z.; Liu, S.; Gao, F.; Zhang, J.; Peng, Z.; Wang, L.; Pan, X. Astaxanthin improves the development of the follicles and oocytes through alleviating oxidative stress induced by BPA in cultured follicles. Sci. Rep. 2022, 12, 7853. [Google Scholar] [CrossRef]
- Nishida, Y.; Nawaz, A.; Hecht, K.; Tobe, K. Astaxanthin as a Novel Mitochondrial Regulator: A New Aspect of Carotenoids, beyond Antioxidants. Nutrients 2021, 14, 107. [Google Scholar] [CrossRef]
- Jang, M.; Park, R.; Yamamoto, A.; Park, Y.I.; Park, Y.; Lee, S.; Park, J. AMPK inhibitor, compound C, inhibits coronavirus replication in vitro. PLoS ONE 2023, 18, e0292309. [Google Scholar] [CrossRef]
- Ferguson, D.C.J.; Smerdon, G.R.; Harries, L.W.; Dodd, N.J.F.; Murphy, M.P.; Curnow, A.; Winyard, P.G. Altered cellular redox homeostasis and redox responses under standard oxygen cell culture conditions versus physioxia. Free Radic. Biol. Med. 2018, 126, 322–333. [Google Scholar] [CrossRef]
- Santos, J.M.S.; Monte, A.P.O.; Lins, T.; Barberino, R.S.; Menezes, V.G.; Gouveia, B.B.; Macedo, T.J.S.; Oliveira Junior, J.L.; Donfack, N.J.; Matos, M.H.T. Kaempferol can be used as the single antioxidant in the in vitro culture medium, stimulating sheep secondary follicle development through the phosphatidylinositol 3-kinase signaling pathway. Theriogenology 2019, 136, 86–94. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Li, C.; Wen, D.; Li, R.; Lu, S.; Xu, R.; Tang, Y.; Sun, Y.; Zhao, X.; Pan, M.; et al. Melatonin improves the quality of maternally aged oocytes by maintaining intercellular communication and antioxidant metabolite supply. Redox Biol. 2022, 49, 102215. [Google Scholar] [CrossRef] [PubMed]
- Ren, Z.; Huang, J.; Zhou, C.; Jia, L.; Li, M.; Liang, X.; Zeng, H. Transferrin and antioxidants partly prevented mouse oocyte oxidative damage induced by exposure of cumulus-oocyte complexes to endometrioma fluid. J. Ovarian Res. 2020, 13, 139. [Google Scholar] [CrossRef] [PubMed]
- Jang, H.Y.; Ji, S.J.; Kim, Y.H.; Lee, H.Y.; Shin, J.S.; Cheong, H.T.; Kim, J.T.; Park, I.C.; Kong, H.S.; Park, C.K.; et al. Antioxidative effects of astaxanthin against nitric oxide-induced oxidative stress on cell viability and gene expression in bovine oviduct epithelial cell and the developmental competence of bovine IVM/IVF embryos. Reprod. Domest. Anim. 2010, 45, 967–974. [Google Scholar] [CrossRef]
- Taghiyar, S.; Pourrajab, F.; Aarabi, M.H. Astaxanthin improves fatty acid dysregulation in diabetes by controlling the AMPK-SIRT1 pathway. EXCLI J. 2023, 22, 502–515. [Google Scholar] [CrossRef]
- Nishida, Y.; Nawaz, A.; Kado, T.; Takikawa, A.; Igarashi, Y.; Onogi, Y.; Wada, T.; Sasaoka, T.; Yamamoto, S.; Sasahara, M.; et al. Astaxanthin stimulates mitochondrial biogenesis in insulin resistant muscle via activation of AMPK pathway. J. Cachexia Sarcopenia Muscle 2020, 11, 241–258. [Google Scholar] [CrossRef]
- Hardie, D.G. Adenosine monophosphate-activated protein kinase: A central regulator of metabolism with roles in diabetes, cancer, and viral infection. Cold Spring Harb. Symp. Quant. Biol. 2011, 76, 155–164. [Google Scholar] [CrossRef]
- Canto, C.; Auwerx, J. AMP-activated protein kinase and its downstream transcriptional pathways. Cell. Mol. Life Sci. 2010, 67, 3407–3423. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Chen, X.; Baker, J.S.; Davison, G.W.; Xu, S.; Zhou, Y.; Bao, X. Astaxanthin promotes mitochondrial biogenesis and antioxidant capacity in chronic high-intensity interval training. Eur. J. Nutr. 2023, 62, 1453–1466. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Zhang, X.; Xiao, J.; Song, M.; Cao, Y.; Xiao, H.; Liu, X. Astaxanthin attenuates d-galactose-induced brain aging in rats by ameliorating oxidative stress, mitochondrial dysfunction, and regulating metabolic markers. Food Funct. 2020, 11, 4103–4113. [Google Scholar] [CrossRef]
- Li, H.; Yang, L. Molecular regulatory mechanism of Nrf2 antioxidant. Chin. J. Bioinform. 2018, 16, 1–6. [Google Scholar]
- Yu, T.; Dohl, J.; Park, Y.M.; Brown, L.L.; Costello, R.B.; Chen, Y.; Deuster, P.A. Protective effects of dietary curcumin and astaxanthin against heat-induced ROS production and skeletal muscle injury in male and female C57BL/6J mice. Life Sci. 2022, 288, 120160. [Google Scholar] [CrossRef]
- Yu, T.; Dohl, J.; Chen, Y.; Gasier, H.G.; Deuster, P.A. Astaxanthin but not quercetin preserves mitochondrial integrity and function, ameliorates oxidative stress, and reduces heat-induced skeletal muscle injury. J. Cell. Physiol. 2019, 234, 13292–13302. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Gao, S.; Jia, Z. The Role of AMPK in Mitochondria Quality Control. Chin. J. Cell Biol. 2020, 42, 881–887. [Google Scholar]
- Seabright, A.P.; Fine, N.H.F.; Barlow, J.P.; Lord, S.O.; Musa, I.; Gray, A.; Bryant, J.A.; Banzhaf, M.; Lavery, G.G.; Hardie, D.G.; et al. AMPK activation induces mitophagy and promotes mitochondrial fission while activating TBK1 in a PINK1-Parkin independent manner. FASEB J. 2020, 34, 6284–6301. [Google Scholar] [CrossRef]
- Meissner, C.; Lorenz, H.; Weihofen, A.; Selkoe, D.J.; Lemberg, M.K. The mitochondrial intramembrane protease PARL cleaves human Pink1 to regulate Pink1 trafficking. J. Neurochem. 2011, 117, 856–867. [Google Scholar] [CrossRef]
- Sarraf, S.A.; Raman, M.; Guarani-Pereira, V.; Sowa, M.E.; Huttlin, E.L.; Gygi, S.P.; Harper, J.W. Landscape of the PARKIN-dependent ubiquitylome in response to mitochondrial depolarization. Nature 2013, 496, 372–376. [Google Scholar] [CrossRef]
- Gladkova, C.; Maslen, S.L.; Skehel, J.M.; Komander, D. Mechanism of parkin activation by PINK1. Nature 2018, 559, 410–414. [Google Scholar] [CrossRef] [PubMed]
- Lazarou, M.; Sliter, D.A.; Kane, L.A.; Sarraf, S.A.; Wang, C.; Burman, J.L.; Sideris, D.P.; Fogel, A.I.; Youle, R.J. The ubiquitin kinase PINK1 recruits autophagy receptors to induce mitophagy. Nature 2015, 524, 309–314. [Google Scholar] [CrossRef]
- Kroemer, G.; Mariño, G.; Beth, L. Autophagy and the integrated stress response. Mol. Cell. 2010, 40, 280–293. [Google Scholar] [CrossRef]
- Wu, L.; Wang, J.; Bi, X. Effect of Astaxanthin on Exercise-induced Skeletal Muscle Damage in Rats through AMPK/mTOR/ULK1 Autophagy Pathway. J. Shandong Sport Univ. 2024, 40, 114–126. [Google Scholar]
- Chen, Y.; Li, S.; Guo, Y.; Yu, H.; Bao, Y.; Xin, X.; Yang, H.; Ni, X.; Wu, N.; Jia, D. Astaxanthin Attenuates Hypertensive Vascular Remodeling by Protecting Vascular Smooth Muscle Cells from Oxidative Stress-Induced Mitochondrial Dysfunction. Oxid. Med. Cell. Longev. 2020, 2020, 4629189. [Google Scholar] [CrossRef]
- Liu, L.; Li, Y.; Chen, G.; Chen, Q. Crosstalk between mitochondrial biogenesis and mitophagy to maintain mitochondrial homeostasis. J. Biomed. Sci. 2023, 30, 86. [Google Scholar] [CrossRef]
- Lewis Luján, L.M.; McCarty, M.F.; Di Nicolantonio, J.J.; Gálvez Ruiz, J.C.; Rosas-Burgos, E.C.; Plascencia-Jatomea, M.; Iloki Assanga, S.B. Nutraceuticals/drugs promoting mitophagy and mitochondrial biogenesis may combat the mitochondrial dysfunction driving progression of dry age-related macular degeneration. Nutrients 2022, 14, 1985. [Google Scholar] [CrossRef] [PubMed]
- Figueiredo-Pereira, C.; Villarejo-Zori, B.; Cipriano, P.C.; Tavares, D.; Ramírez-Pardo, I.; Boya, P.; Vieira, H.L.A. Carbon Monoxide Stimulates Both Mitophagy And Mitochondrial Biogenesis to Mediate Protection Against Oxidative Stress in Astrocytes. Mol. Neurobiol. 2023, 60, 851–863. [Google Scholar] [CrossRef]
- Zhang, Q.; Luo, C.; Li, Z.; Huang, W.; Zheng, S.; Liu, C.; Shi, X.; Ma, Y.; Ni, Q.; Tan, W.; et al. Astaxanthin activates the Nrf2/Keap1/HO-1 pathway to inhibit oxidative stress and ferroptosis, reducing triphenyl phosphate (TPhP)-induced neurodevelopmental toxicity. Ecotoxicol. Environ. Saf. 2024, 271, 115960. [Google Scholar] [CrossRef]
- Li, Y.; Hu, Y.; Yu, Y.Y.; Jia, Y.P. Astaxanthin regulates the AMPK-SIRT1 pathway on the effect of sevoflurane-induced HT22 nerve cell injury. Mod. Drug Clin. 2021, 36, 645–651. [Google Scholar]
- Pfanner, N.; Warscheid, B.; Wiedemann, N. Author Correction: Mitochondrial proteins: From biogenesis to functional networks. Nat. Rev. Mol. Cell. Biol. 2021, 22, 367. [Google Scholar] [CrossRef] [PubMed]
- Kadenbach, B. Complex IV—The regulatory center of mitochondrial oxidative phosphorylation. Mitochondrion 2021, 58, 296–302. [Google Scholar] [CrossRef]
- Mansilla, N.; Racca, S.; Gras, D.E.; Gonzalez, D.H.; Welchen, E. The Complexity of Mitochondrial Complex IV: An Update of Cytochrome c Oxidase Biogenesis in Plants. Int. J. Mol. Sci. 2018, 19, 662. [Google Scholar] [CrossRef]
- Randi, E.B.; Zuhra, K.; Pecze, L.; Panagaki, T.; Szabo, C. Physiological concentrations of cyanide stimulate mitochondrial Complex IV and enhance cellular bioenergetics. Proc. Natl. Acad. Sci. USA 2021, 118, e2026245118. [Google Scholar] [CrossRef]
- Del Dotto, V.; Musiani, F.; Baracca, A.; Solaini, G. Variants in Human ATP Synthase Mitochondrial Genes: Biochemical Dysfunctions, Associated Diseases, and Therapies. Int. J. Mol. Sci. 2024, 25, 2239. [Google Scholar] [CrossRef]
- Galber, C.; Carissimi, S.; Baracca, A.; Giorgio, V. The ATP synthase deficiency in human diseases. Life 2021, 11, 325. [Google Scholar] [CrossRef] [PubMed]
- Zheng, X.; Shao, C.; Zhu, J.; Zhang, L.; Huang, Q. Study of the antioxidant capacity of astaxanthin in cells against radiation-induced strong oxidative stress. Aquac. Int. 2023, 31, 2705–2725. [Google Scholar] [CrossRef]
- Li, Y.; Liu, J.; Ye, B.; Cui, Y.; Geng, R.; Liu, S.; Zhang, Y.; Guo, W.; Fu, S. Astaxanthin Alleviates Nonalcoholic Fatty Liver Disease by Regulating the Intestinal Flora and Targeting the AMPK/Nrf2 Signal Axis. J. Agric. Food Chem. 2022, 70, 10620–10634. [Google Scholar] [CrossRef]
- Xiao, F.; Qin, Y.; Chen, J.; Li, C.; Qin, Y.; Wei, Y.; Xie, Y. The propofol-induced mitochondrial damage in fetal rat hippocampal neurons via the AMPK/P53 signaling pathway. Ann. Transl. Med. 2022, 10, 1106. [Google Scholar] [CrossRef]
- Liu, Y.; Gong, S.; Li, K.; Wu, G.; Zheng, X.; Zheng, J.; Lu, X.; Zhang, L.; Li, J.; Su, Z.; et al. Coptisine protects against hyperuricemic nephropathy through alleviating inflammation, oxidative stress and mitochondrial apoptosis via PI3K/Akt signaling pathway. Biomed. Pharmacother. 2022, 156, 113941. [Google Scholar] [CrossRef]
- Chen, S.; Zhao, L.; Sherchan, P.; Ding, Y.; Yu, J.; Nowrangi, D.; Tang, J.; Xia, Y.; Zhang, J.H. Activation of melanocortin receptor 4 with RO27-3225 attenuates neuroinflammation through AMPK/JNK/p38 MAPK pathway after intracerebral hemorrhage in mice. J. Neuroinflamm. 2018, 15, 106. [Google Scholar] [CrossRef] [PubMed]
- Lou, T.; Ma, J.; Xie, Y.; Yao, G.; Fan, Y.; Ma, S.; Zou, X. Nuanxin capsule enhances cardiac function by inhibiting oxidative stress-induced mitochondrial dependent apoptosis through AMPK/JNK signaling pathway. Biomed. Pharmacother. 2021, 135, 111188. [Google Scholar] [CrossRef] [PubMed]
- Du, Y. The Effect of Estrogen and Related Inflammatory Factors on the Development of Follicle; Fudan University: Shanghai, China, 2012. [Google Scholar]
- Miller, W.L.; Strauss, J.F., 3rd. Molecular pathology and mechanism of action of the steroidogenic acute regulatory protein, StAR. J. Steroid Biochem. Mol. Biol. 1999, 69, 131–141. [Google Scholar] [CrossRef]
- Miller, W.L. Steroid hormone synthesis in mitochondria. Mol. Cell. Endocrinol. 2013, 379, 62–73. [Google Scholar] [CrossRef] [PubMed]
- Winter, E.; Chiaradia, L.D.; de Cordova, C.A.S.; Nunes, R.J.; Yunes, R.A.; Creczynski-Pasa, T.B. Naphthylchalcones induce apoptosis and caspase activation in a leukemia cell line: The relationship between mitochondrial damage, oxidative stress, and cell death. Bioorg. Med. Chem. 2010, 18, 8026–8034. [Google Scholar] [CrossRef]
- Wang, D.; Zhang, T.; Miao, Z. Mitochondrial oxidative stress in vascular endothelial cells and atherosclerosis. J. Pharm. Pract. Serv. 2023, 41, 329–334+388. [Google Scholar] [CrossRef]
- Chou, Y.C.; Chen, Y.C.; Chen, M.J.; Chang, C.W.; Lai, G.L.; Tzeng, C.R. Exposure to Mono-n-Butyl Phthalate in Women with Endometriosis and Its Association with the Biological Effects on Human Granulosa Cells. Int. J. Mol. Sci. 2020, 21, 1794. [Google Scholar] [CrossRef] [PubMed]
- Klinge, C.M. Estrogens regulate life and death in mitochondria. J. Bioenergy Biomembr. 2017, 49, 307–324. [Google Scholar] [CrossRef]
- Sreerangaraja Urs, D.B.; Wu, W.H.; Komrskova, K.; Postlerova, P.; Lin, Y.F.; Tzeng, C.R.; Kao, S.H. Mitochondrial Function in Modulating Human Granulosa Cell Steroidogenesis and Female Fertility. Int. J. Mol. Sci. 2020, 21, 3592. [Google Scholar] [CrossRef]
- Rostami, S.; Alyasin, A.; Saedi, M.; Nekoonam, S.; Khodarahmian, M.; Moeini, A.; Amidi, F. Astaxanthin ameliorates inflammation, oxidative stress, and reproductive outcomes in endometriosis patients undergoing assisted reproduction: A randomized, triple-blind placebo-controlled clinical trial. Front. Endocrinol. 2023, 14, 1144323. [Google Scholar] [CrossRef]
- Jabarpour, M.; Aleyasin, A.; Nashtaei, M.S.; Lotfi, S.; Amidi, F. Astaxanthin treatment ameliorates ER stress in polycystic ovary syndrome patients: A randomized clinical trial. Sci. Rep. 2023, 13, 3376. [Google Scholar] [CrossRef] [PubMed]
- Gharaei, R.; Alyasin, A.; Mahdavinezhad, F.; Samadian, E.; Ashrafnezhad, Z.; Amidi, F. Randomized controlled trial of astaxanthin impacts on antioxidant status and assisted reproductive technology outcomes in women with polycystic ovarian syndrome. J. Assist. Reprod. Genet. 2022, 39, 995–1008. [Google Scholar] [CrossRef] [PubMed]
- Fu, X.; Cao, W.; Ye, F.; Bei, J.; Du, Y.; Wang, L. Astaxanthin compound nutrient improved insulin resistance, hormone levels, embryo quality and pregnancy outcomes in polycystic ovary syndrome patients undergoing in vitro fertilization/intracytoplasmic sperm injection. Drug Discov. Ther. 2024, 18, 296–302. [Google Scholar] [CrossRef]
- Shafie, A.; Aleyasin, A.; Saffari, M.; Saedi, M.; Rostami, S.; Rezayi, S.; Mohammadi, S.D.; Amidi, F. Astaxanthin improves assisted reproductive technology outcomes in poor ovarian responders through alleviating oxidative stress, inflammation, and apoptosis: A randomized clinical trial. J. Ovarian Res. 2024, 17, 212. [Google Scholar] [CrossRef]
- Tana, C.; Somsak, P.; Piromlertamorn, W.; Sanmee, U. Effects of astaxanthin supplementation in fertilization medium and/or culture medium on the fertilization and development of mouse oocytes. Clin. Exp. Reprod. Med. 2022, 49, 26–32. [Google Scholar] [CrossRef]
- Yang, X.; Zhou, D.; Gao, L.; Wang, Y.; Wang, Y.; Jia, R.; Bai, Y.; Shi, D.; Lu, F. Effects of Astaxanthin on the Physiological State of Porcine Ovarian Granulose Cells Cultured In Vitro. Antioxidants 2024, 13, 1185. [Google Scholar] [CrossRef]
- Pedersen, T.; Peters, H. Proposal for a classification of oocytes and follicles in the mouse ovary. J. Reprod. Fertil. 1968, 17, 555–557. [Google Scholar] [CrossRef] [PubMed]









| Groups | Number of Oocytes | Survival Rate (%) | Antrum Formation Rate (%) | Maturation Rate (%) |
|---|---|---|---|---|
| Control | 180 | 178 (98.89 ± 0.96) | 153 (85.96 ± 5.15) | 121 (79.15 ± 1.84) |
| DMSO | 180 | 177 (98.33 ± 1.67) | 154 (86.99 ± 2.69) | 120 (77.96 ± 1.43) |
| 0.25 nM astaxanthin | 180 | 176 (97.77 ± 1.93) | 156 (88.64 ± 0.72) | 125 (79.62 ± 0.78) |
| 2.5 nM astaxanthin | 180 | 178 (98.89 ± 1.93) | 168 (94.38 ± 0.91) *# | 143 (85.12 ± 0.80) *# |
| 25 nM astaxanthin | 180 | 175 (97.21 ± 0.96) | 128 (73.16 ± 3.30) *#■ | 64 (49.89 ± 6.00) *#■ |
| Gene Name | Primer Sequences (5′ to 3′) | Product Size (bp) | Annealing Temperature (°C) | |
|---|---|---|---|---|
| Forward | Reverse | |||
| GSH | GAGAGCGTCAACAGGGAGATG | CCAGCCTCCGTTATCCTGGA | 249 | 59 |
| SOD1 | ATGCCCATGCTACAGAGGAG | AGACTGGCCCTTCTTGGTCT | 143 | 59 |
| CO1 | TCCAACTCATCCCTTGACATCGTGC | TGGCGAAGTGGGCTTTTGCTCA | 172 | 59 |
| CO2 | ATTGCCCTCCCCTCTCTACGCATT | CCAGGTTTTAGGTCGTTTGTTGGGA | 167 | 58 |
| CO3 | ACTGGAGCCTTTTCAGCCCTCCTT | AGTGTGGTGGCCTTGGTAGGTT | 162 | 58 |
| ATP6 | AAGCTCACTCGCCCACTTCCTT | TGTAAGCCGGACTGCTAATGCCA | 118 | 58 |
| ATP8 | TCCCACTAGCACCTTCACCA | TGTTGGGGTAATGAATGAGGCAA | 103 | 57 |
| TOM20 | AGATGTGGGGCTTTGGCACTGT | AGGTGAGCTGGGGTGCAACATT | 198 | 58 |
| β-actin | TGTTACCAACTGGGACGACA | CTGGGTCATCTTTTCACGGT | 146 | 59 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
He, J.; Zhong, Y.; Li, Y.; Liu, S.; Pan, X. Astaxanthin Alleviates Oxidative Stress in Mouse Preantral Follicles and Enhances Follicular Development Through the AMPK Signaling Pathway. Int. J. Mol. Sci. 2025, 26, 2241. https://doi.org/10.3390/ijms26052241
He J, Zhong Y, Li Y, Liu S, Pan X. Astaxanthin Alleviates Oxidative Stress in Mouse Preantral Follicles and Enhances Follicular Development Through the AMPK Signaling Pathway. International Journal of Molecular Sciences. 2025; 26(5):2241. https://doi.org/10.3390/ijms26052241
Chicago/Turabian StyleHe, Jiaqi, Yue Zhong, Yaqiu Li, Sitong Liu, and Xiaoyan Pan. 2025. "Astaxanthin Alleviates Oxidative Stress in Mouse Preantral Follicles and Enhances Follicular Development Through the AMPK Signaling Pathway" International Journal of Molecular Sciences 26, no. 5: 2241. https://doi.org/10.3390/ijms26052241
APA StyleHe, J., Zhong, Y., Li, Y., Liu, S., & Pan, X. (2025). Astaxanthin Alleviates Oxidative Stress in Mouse Preantral Follicles and Enhances Follicular Development Through the AMPK Signaling Pathway. International Journal of Molecular Sciences, 26(5), 2241. https://doi.org/10.3390/ijms26052241

