Impact of Cold Stress on Hepatopancreas Transcriptomic and Metabolomic in Red Swamp Crayfish Procambarus clarkii
Abstract
1. Introduction
2. Results
2.1. Transcriptome Responses Under Cold Stress
2.2. Metabolome Responses Under Cold Stress
2.3. Correlation Between Transcriptome and Metabolome
3. Discussion
3.1. Cold Stress-Induced Alterations to Pathways Related to Metabolism
3.2. Cold Stress-Induced Alterations to Immune System
3.3. Cold Stress-Induced Alterations to Other Pathways
4. Materials and Methods
4.1. Cold Stress Treatment and Sample Collection
4.2. Transcriptome Analysis
4.2.1. RNA Extraction, Library Preparation, and Sequencing
4.2.2. Quality Control and Read Mapping
4.2.3. Differentially Expression Analysis and Functional Enrichment
4.2.4. Verification of the RNA-seq Results
4.3. Metabolomic Analysis
4.3.1. Metabolite Extraction
4.3.2. Quality Control Sample
4.3.3. LC-MS Analysis
4.3.4. Data Analyses
4.4. Correlation Between Transcriptome and Metabolome
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- FAO The State of World Fisheries and Aquaculture 2022; FAO: Rome, Italy, 2022.
- Bureau of Fisheries China Fishery Statistical Yearbook 2023; Chinese Agriculture Press: Beijing, China, 2023.
- Peruzza, L.; Piazza, F.; Manfrin, C.; Bonzi, L.; Battistella, S.; Giulianini, P. Reproductive Plasticity of a Procambarus clarkii Population Living 10 °C below Its Thermal Optimum. Aquat. Invasions 2015, 10, 199–208. [Google Scholar] [CrossRef]
- Ren, X.; Wang, Q.; Shao, H.; Xu, Y.; Liu, P.; Li, J. Effects of Low Temperature on Shrimp and Crab Physiology, Behavior, and Growth: A Review. Front. Mar. Sci. 2021, 8, 746177. [Google Scholar] [CrossRef]
- Wu, Z.; Yang, Y.; Zhou, L.; Chi, C.; Sun, X.; Wu, B.; Liu, Z.; Wang, Y. Transcriptome Sequencing Reveals the Response to Acute Thermal Stress in the Pacific Abalone, Haliotis discus Hannai. Aquac. Res. 2023, 2023, 1–12. [Google Scholar] [CrossRef]
- Huang, W.; Ren, C.; Li, H.; Huo, D.; Wang, Y.; Jiang, X.; Tian, Y.; Luo, P.; Chen, T.; Hu, C. Transcriptomic Analyses on Muscle Tissues of Litopenaeus vannamei Provide the First Profile Insight into the Response to Low Temperature Stress. PLoS ONE 2017, 12, e0178604. [Google Scholar] [CrossRef] [PubMed]
- Matheson, K.; Gagnon, P. Temperature Mediates Non-Competitive Foraging in Indigenous Rock (Cancer Irroratus Say) and Recently Introduced Green (Carcinus maenas L.) Crabs from Newfoundland and Labrador. J. Exp. Mar. Biol. Ecol. 2012, 415, 6–18. [Google Scholar] [CrossRef]
- Wu, D.; Huang, Y.; Chen, Q.; Jiang, Q.; Li, Y.; Zhao, Y. Effects and Transcriptional Responses in the Hepatopancreas of Red Claw Crayfish Cherax quadricarinatus under Cold Stress. J. Therm. Biol. 2019, 85, 102404. [Google Scholar] [CrossRef]
- Carmona-Osalde, C.; Rodriguez-Serna, M.; Olvera-Novoa, M.A.; Gutierrez-Yurrita, P.J. Gonadal Development, Spawning, Growth and Survival of the Crayfish Procambarus llamasi at Three Different Water Temperatures. Aquaculture 2004, 232, 305–316. [Google Scholar] [CrossRef]
- Yamamoto, T.; Jinbo, T.; Hamasaki, K. Intrinsic Optimum Temperature for the Development of Decapod Crustacean Larvae Based on a Thermodynamic Model. J. Crustac. Biol. 2017, 37, 272–277. [Google Scholar] [CrossRef]
- Xu, Z.; Regenstein, J.M.; Xie, D.; Lu, W.; Ren, X.; Yuan, J.; Mao, L. The Oxidative Stress and Antioxidant Responses of Litopenaeus vannamei to Low Temperature and Air Exposure. Fish Shellfish Immunol. 2018, 72, 564–571. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Wang, L.; Ma, X.; Guan, T.; Shi, W.; Zhu, C.; Wang, H.; Li, J. Response of Antioxidation and Immunity to Combined Influences of Ammonia and Temperature in Red Swamp Crayfish (Procambarus clarkii). Aquaculture 2023, 563, 738906. [Google Scholar] [CrossRef]
- Qiu, J.; Wang, W.-N.; Wang, L.; Liu, Y.-F.; Wang, A.-L. Oxidative Stress, DNA Damage and Osmolality in the Pacific White Shrimp, Litopenaeus vannamei Exposed to Acute Low Temperature Stress. Comp. Biochem. Phys. C 2011, 154, 36–41. [Google Scholar] [CrossRef]
- Wang, Z.; Liao, G.; Chen, B.; Fan, L. Impacts of Acute Cold-Stress in Pacific White Shrimp Litopenaeus vannamei: Investigating the Tissue-Specific Stress Resistance Response. Aquacult. Int. 2023, 31, 2649–2663. [Google Scholar] [CrossRef]
- Dai, X.; Shen, L. Advances and Trends in Omics Technology Development. Front. Med. 2022, 9, 911861. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.; Zhao, Y.; Sun, N.; Li, C.; Jiang, Q.; Zhang, Y.; Wei, H.; Li, Y.; Hu, Q.; Li, X. Comparison of the Gut Microbiota and Untargeted Gut Tissue Metabolome of Chinese Mitten Crabs (Eriocheir sinensis) with Different Shell Colors. Front. Microbiol. 2023, 14, 1218152. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.; Yi, S.; Yang, G.; Wang, W. Integrated Analysis of Transcriptomic and Physiological Responses to Cold Stress in Macrobrachium rosenbergii. Aquacult. Rep. 2024, 36, 102042. [Google Scholar] [CrossRef]
- Zhu, J.; Shi, W.; Zhao, R.; Gu, C.; Li, H.; Wang, L.; Wan, X. Effects of Cold Stress on the Hemolymph of the Pacific White Shrimp Penaeus vannamei. Fishes 2024, 9, 36. [Google Scholar] [CrossRef]
- Zhang, R.; Shi, X.; Guo, J.; Mao, X.; Fan, B. Acute Stress Response in Hepatopancreas of Pacific White Shrimp Litopenaeus vannamei to High Alkalinity. Aquacul. Rep. 2024, 35, 101981. [Google Scholar] [CrossRef]
- Ren, X.; Yu, Z.; Xu, Y.; Zhang, Y.; Mu, C.; Liu, P.; Li, J. Integrated Transcriptomic and Metabolomic Responses in the Hepatopancreas of Kuruma Shrimp (Marsupenaeus japonicus) under Cold Stress. Ecotoxicol. Environ. Saf. 2020, 206, 111360. [Google Scholar] [CrossRef] [PubMed]
- Haubrock, P.J.; Kubec, J.; Veselý, L.; Buřič, M.; Tricarico, E.; Kouba, A. Water Temperature as a Hindrance, but Not Limiting Factor for the Survival of Warm Water Invasive Crayfish Introduced in Cold Periods. J. Great Lakes Res. 2019, 45, 788–794. [Google Scholar] [CrossRef]
- Sato, D.X.; Matsuda, Y.; Usio, N.; Funayama, R.; Nakayama, K.; Makino, T. Genomic Adaptive Potential to Cold Environments in the Invasive Red Swamp Crayfish. iScience 2023, 26, 107267. [Google Scholar] [CrossRef] [PubMed]
- Veselý, L.; Buřič, M.; Kouba, A. Hardy Exotics Species in Temperate Zone: Can “Warm Water” Crayfish Invaders Establish Regardless of Low Temperatures? Sci. Rep. 2015, 5, 16340. [Google Scholar] [CrossRef] [PubMed]
- Timson, D.J. Fructose 1,6-Bisphosphatase: Getting the Message Across. Biosci. Rep. 2019, 39, BSR20190124. [Google Scholar] [CrossRef]
- Ziveri, J.; Tros, F.; Guerrera, I.C.; Chhuon, C.; Audry, M.; Dupuis, M.; Barel, M.; Korniotis, S.; Fillatreau, S.; Gales, L.; et al. The Metabolic Enzyme Fructose-1,6-Bisphosphate Aldolase Acts as a Transcriptional Regulator in Pathogenic Francisella. Nat. Commun. 2017, 8, 853. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.; Shi, W.; Zhao, R.; Gu, C.; Shen, H.; Li, H.; Wang, L.; Cheng, J.; Wan, X. Integrated Physiological, Transcriptome, and Metabolome Analyses of the Hepatopancreas of Litopenaeus vannamei under Cold Stress. Comp. Biochem. Phys. D 2024, 49, 101196. [Google Scholar] [CrossRef] [PubMed]
- Wu, D.; Liu, Z.; Yu, P.; Huang, Y.; Cai, M.; Zhang, M.; Zhao, Y. Cold Stress Regulates Lipid Metabolism via AMPK Signalling in Cherax quadricarinatus. J. Therm. Biol. 2020, 92, 102693. [Google Scholar] [CrossRef]
- Wu, D.; Huang, Y.; Liu, Z.; Yu, P.; Gu, P.; Fan, B.; Zhao, Y. Molecular Cloning, Tissue Expression and Regulation of Nutrition and Temperature on Δ6 Fatty Acyl Desaturase-like Gene in the Red Claw Crayfish (Cherax quadricarinatus). Comp. Biochem. Phys. B 2018, 225, 58–66. [Google Scholar] [CrossRef]
- Hsieh, S.L.; Chen, Y.N.; Kuo, C.M. Physiological Responses, Desaturase Activity, and Fatty Acid Composition in Milkfish (Chanos chanos) under Cold Acclimation. Aquaculture 2003, 220, 903–918. [Google Scholar] [CrossRef]
- Zerai, D.B.; Fitzsimmons, K.M.; Collier, R.J. Transcriptional Response of Delta-9-Desaturase Gene to Acute and Chronic Cold Stress in Nile Tilapia, Oreochromis niloticus. J. World Aquacult. Soc. 2010, 41, 800–806. [Google Scholar] [CrossRef]
- Uno, T.; Ishizuka, M.; Itakura, T. Cytochrome P450 (CYP) in Fish. Environ. Toxicol. Phar. 2012, 34, 1–13. [Google Scholar] [CrossRef]
- Cheng, C.; Zhang, S.; Ma, H.; Liu, G.; Fan, S.; Deng, Y.; Jiang, J.; Feng, J.; Guo, Z. Essential Role of the Cytochrome P450 2 (CYP2) in the Mud Crab Scylla Paramamosain Antioxidant Defense and Immune Responses. Fish Shellfish Immunol. 2023, 135, 108674. [Google Scholar] [CrossRef]
- Tu, H.; Peng, X.; Yao, X.; Tang, Q.; Xia, Z.; Li, J.; Yang, G.; Yi, S. Integrated Transcriptomic and Metabolomic Analyses Reveal Low-Temperature Tolerance Mechanism in Giant Freshwater Prawn Macrobrachium rosenbergii. Animals 2023, 13, 1605. [Google Scholar] [CrossRef]
- Chu, P.; Wang, T.; Sun, Y.R.; Chu, M.X.; Wang, H.Y.; Zheng, X.; Yin, S. Effect of Cold Stress on the MAPK Pathway and Lipidomics on Muscle of Takifugu fasciatus. Aquaculture 2021, 540, 736691. [Google Scholar] [CrossRef]
- Nong, X.; Zhang, C.; Wang, J.; Ding, P.; Ji, G.; Wu, T. The Mechanism of Branched-Chain Amino Acid Transferases in Different Diseases: Research Progress and Future Prospects. Front. Oncol. 2022, 12, 988290. [Google Scholar] [CrossRef]
- Li, H.; Li, W.; Su, J.; Zhou, Z.; Miao, Y.; Tian, X.; Tao, M.; Zhang, C.; Zhou, Y.; Qin, Q.; et al. Integration of Transcriptome and Metabolome Reveals Molecular Mechanisms Responsive to Cold Stress in Gynogenetic Mrigal Carp (Cirrhinus mrigala). Aquaculture 2024, 579, 740200. [Google Scholar] [CrossRef]
- Zhang, Z.; Zhou, C.; Fan, K.; Zhang, L.; Liu, Y.; Liu, P. Metabolomics Analysis of the Effects of Temperature on the Growth and Development of Juvenile European Seabass (Dicentrarchus labrax). Sci. Total Environ. 2021, 769, 145155. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Zhao, H.; Wang, G.; Sun, Y.; Wang, L. Energy Consumption and Intestinal Microbiome Disorders of Yellow Catfish (Pelteobagrus fulvidraco) under Cold Stress. Front. Physiol. 2022, 13, 985046. [Google Scholar] [CrossRef]
- Yang, C.; Jiang, M.; Wu, F.; Yu, L.; Tian, J.; Liu, W.; Lu, X.; Wen, H. Identification of a C-Type Lectin from Tilapia (Oreochromis niloticus) and Its Functional Characterization under Low-Temperature Stress. Fish Shellfish Immunol. 2016, 58, 631–640. [Google Scholar] [CrossRef] [PubMed]
- Jin, X.; Li, S.; Guo, X.; Cheng, L.; Wu, M.; Tan, S.; Zhu, Y.; Yu, A.; Li, W.; Wang, Q. Two Antibacterial C-Type Lectins from Crustacean, Eriocheir Sinensis, Stimulated Cellular Encapsulation in Vitro. Dev. Comp. Immunol. 2013, 41, 544–552. [Google Scholar] [CrossRef]
- Zhang, X.; Man, X.; Huang, X.; Wang, Y.; Song, Q.; Hui, K.-M.; Zhang, H. Identification of a C-Type Lectin Possessing Both Antibacterial and Antiviral Activities from Red Swamp Crayfish. Fish Shellfish Immunol. 2018, 77, 22–30. [Google Scholar] [CrossRef]
- Zhang, X.; Liu, Y.; Mu, Y.; Ren, Q.; Zhao, X.; Wang, J. Overexpression of a C-Type Lectin Enhances Bacterial Resistance in Red Swamp Crayfish Procambarus clarkii. Fish Shellfish Immunol. 2013, 34, 1112–1118. [Google Scholar] [CrossRef]
- Zhang, L.; Chen, H.; Cui, C.; Liang, L.; Ge, H.; Meng, L.; Zhang, C. Effects of Oocyte Vitrification on Gene Expression in the Liver and Kidney Tissues of Adult Offspring. J. Assist. Reprod. Genet. 2022, 39, 2635–2646. [Google Scholar] [CrossRef]
- Zhu, W.; Li, Q.; Peng, M.; Yang, C.; Chen, X.; Feng, P.; Liu, Q.; Zhang, B.; Zeng, D.; Zhao, Y. Biochemical Indicators, Cell Apoptosis, and Metabolomic Analyses of the Low-Temperature Stress Response and Cold Tolerance Mechanisms in Litopenaeus vannamei. Sci. Rep. 2024, 14, 15242. [Google Scholar] [CrossRef]
- Zhou, T.; Gui, L.; Liu, M.; Li, W.; Hu, P.; Duarte, D.F.C.; Niu, H.; Chen, L. Transcriptomic Responses to Low Temperature Stress in the Nile Tilapia, Oreochromis niloticus. Fish Shellfish Immunol. 2019, 84, 1145–1156. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Comish, P.B.; Tang, D.; Kang, R. Characteristics and Biomarkers of Ferroptosis. Front. Cell Dev. Biol. 2021, 9, 637162. [Google Scholar] [CrossRef] [PubMed]
- Jia, B.; Li, J.; Song, Y.; Luo, C. ACSL4-Mediated Ferroptosis and Its Potential Role in Central Nervous System Diseases and Injuries. Int. J. Mol. Sci. 2023, 24, 10021. [Google Scholar] [CrossRef] [PubMed]
- Doll, S.; Proneth, B.; Tyurina, Y.Y.; Panzilius, E.; Kobayashi, S.; Ingold, I.; Irmler, M.; Beckers, J.; Aichler, M.; Walch, A.; et al. ACSL4 Dictates Ferroptosis Sensitivity by Shaping Cellular Lipid Composition. Nat. Chem. Biol. 2017, 13, 91–98. [Google Scholar] [CrossRef] [PubMed]
- Xia, X.; Cheng, Z.; He, B.; Liu, H.; Liu, M.; Hu, J.; Lei, L.; Wang, L.; Bai, Y. Ferroptosis in Aquaculture Research. Aquaculture 2021, 541, 736760. [Google Scholar] [CrossRef]
- Geng, N.; Shi, B.-J.; Li, S.-L.; Zhong, Z.-Y.; Li, Y.-C.; Xua, W.-L.; Zhou, H.; Cai, J.-H. Knockdown of Ferroportin Accelerates Erastin-Induced Ferroptosis in Neuroblastoma Cells. Eur. Rev. Med. Pharmacol. Sci. 2018, 22, 3826–3836. [Google Scholar] [CrossRef]
- Song, Z.; Xiang, X.; Li, J.; Deng, J.; Fang, Z.; Zhang, L.; Xiong, J. Ruscogenin Induces Ferroptosis in Pancreatic Cancer Cells. Oncol. Rep. 2019, 43, 516–524. [Google Scholar] [CrossRef]
- Lu, S.; Song, Y.; Luo, R.; Li, S.; Li, G.; Wang, K.; Liao, Z.; Wang, B.; Ke, W.; Xiang, Q.; et al. Ferroportin-dependent Iron Homeostasis Protects against Oxidative Stress-induced Nucleus Pulposus Cell Ferroptosis and Ameliorates Intervertebral Disc Degeneration in Vivo. Oxid. Med. Cell. Longev. 2021, 6670497. [Google Scholar] [CrossRef] [PubMed]
- Abdel-Ghany, H.M.; El-Sayed, A.-F.M.; Ezzat, A.A.; Essa, M.A.; Helal, A.M. Dietary Lipid Sources Affect Cold Tolerance of Nile Tilapia (Oreochromis niloticus). J. Therm. Biol. 2019, 79, 50–55. [Google Scholar] [CrossRef] [PubMed]
- Huo, Y.; Jin, M.; Sun, P.; Hou, Y.; Li, Y.; Qiu, H.; Zhou, Q. Effect of Dietary Leucine on Growth Performance, Hemolymph and Hepatopancreas Enzyme Activities of Swimming Crab, Portunus trituberculatus. Aquacult. Nutr. 2017, 23, 1341–1350. [Google Scholar] [CrossRef]
- Wei, Z.; Zhuang, Y.; Liu, X.; Zou, D.; Mai, K.; Sun, Z.; Ye, C. Leucine Promotes Protein Synthesis of Juvenile White Shrimp Litopenaeus vannamei through TOR Signaling Pathway. Aquaculture 2023, 564, 739060. [Google Scholar] [CrossRef]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. Fastp: An Ultra-Fast All-in-One FASTQ Preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef]
- Xu, Z.; Gao, T.; Xu, Y.; Li, X.; Li, J.; Lin, H.; Yan, W.; Pan, J.; Tang, J. A Chromosome-Level Reference Genome of Red Swamp Crayfish Procambarus clarkii Provides Insights into the Gene Families Regarding Growth or Development in Crustaceans. Genomics 2021, 113, 3274–3284. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A Fast Spliced Aligner with Low Memory Requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef]
- Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.-C.; Mendell, J.T.; Salzberg, S.L. StringTie Enables Improved Reconstruction of a Transcriptome from RNA-Seq Reads. Nat. Biotechnol. 2015, 33, 290–295. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Dewey, C.N. RSEM: Accurate Transcript Quantification from RNA-Seq Data with or without a Reference Genome. BMC Bioinform. 2011, 12, 323. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated Estimation of Fold Change and Dispersion for RNA-Seq Data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Feng, Z.; Wang, X.; Wang, X.; Zhang, X. DEGseq: An R Package for Identifying Differentially Expressed Genes from RNA-Seq Data. Bioinformatics 2010, 26, 136–138. [Google Scholar] [CrossRef]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A Tool to Design Target-Specific Primers for Polymerase Chain Reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [PubMed]
- Guo, K.; Ruan, G.; Fan, W.; Wang, Q.; Fang, L.; Luo, J.; Liu, Y. Immune Response to Acute Heat Stress in the Intestine of the Red Swamp Crayfish, Procambarus clarkii. Fish Shellfish Immunol. 2020, 100, 146–151. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Ren, Y.; Yu, G.; Shi, C.; Liu, L.; Guo, Q.; Han, C.; Zhang, D.; Zhang, L.; Liu, B.; Gao, H.; et al. Majorbio Cloud: A One-stop, Comprehensive Bioinformatic Platform for Multiomics Analyses. iMeta 2022, 1, e12. [Google Scholar] [CrossRef]
Sample | Raw Reads | Clean Reads | Clean Read (%) | Q20 (%) | Q30 (%) | GC (%) | Total Mapped (%) |
---|---|---|---|---|---|---|---|
T22-1 | 45880024 | 45542106 | 99.26 | 98.66 | 95.77 | 48.01 | 43019610 (94.46%) |
T22-2 | 57686400 | 57274276 | 99.29 | 98.64 | 95.77 | 45.97 | 53716548 (93.79%) |
T22-3 | 54019958 | 53610324 | 99.24 | 98.63 | 95.74 | 46.01 | 49694951 (92.7%) |
T4-1 | 50656502 | 50267000 | 99.23 | 98.57 | 95.61 | 43.35 | 46344494 (92.2%) |
T4-2 | 56267340 | 55850560 | 99.26 | 98.62 | 95.76 | 45.14 | 51419269 (92.07%) |
T4-3 | 47082160 | 46718294 | 99.23 | 98.63 | 95.74 | 47.29 | 43361392 (92.81%) |
Category | Pathway | Gene/Metabolite | Description | Up/Down |
---|---|---|---|---|
Immune system | C-type lectin receptor signaling pathway | LOC123748590 (CLEC17A) | C-type lectin domain family 17, member A-like | down |
LOC123774641 (MINCLE) | galactose-specific lectin nattectin-like | down | ||
LOC123755747 (DC-SIGN) | CD209 antigen-like protein 2 | down | ||
LOC123755745 (BRA-3) | lectin BRA-3-like | down | ||
LOC123750066 (ASGR1) | asialoglycoprotein receptor 1-like | down | ||
LOC123750185 (MBL) | C-type lectin mannose-binding isoform-like | down | ||
LOC123750192 (CLEC7A) | C-type lectin domain family 7 member A-like | down | ||
LOC123751783 (TN) | tetranectin-like, transcript variant X1 | down | ||
Carbohydrate metabolism | Glycolysis/gluconeogenesis | LOC123773396 (TPI) | triosephosphate isomerase-like | up |
LOC123760072 (FBP) | fructose-1,6-bisphosphatase 1-like | down | ||
LOC123768117 (FBA) | fructose-bisphosphate aldolase-like | down | ||
Lipid metabolism | Sphingolipid metabolism | LOC123771454 (ARSA) | arylsulfatase A-like | down |
LOC123762036 (CEGT) | ceramide glucosyltransferase-like | up | ||
LOC123773128 (DES1) | sphingolipid delta (4)-desaturase DES1-like | up | ||
LOC123759095 (GBA) | lysosomal acid glucosylceramidase-like | down | ||
LOC123745757 (SGMS) | phosphatidylcholine/ceramide cholinephosphotransferase 2-like | up | ||
Arachidonic acid metabolism | LOC123760576 (15-PGDH) | 15-hydroxyprostaglandin dehydrogenase [NAD (+)]-like | down | |
LOC123767752 (CYP2) | cytochrome P450 2L1-like | down | ||
LOC123746626 (HPGDS) | hematopoietic prostaglandin D synthase-like | down | ||
LOC123765799 (PTGR1) | prostaglandin reductase 1-like | up | ||
Glycerophospholipid metabolism | HMDB0112860 | PS (22:5(7Z,10Z,13Z,16Z,19Z)/22:5(4Z,7Z,10Z,13Z,16Z)) | down | |
HMDB0114400 | PE-NMe2(20:5(5Z,8Z,11Z,14Z,17Z)/20:5(5Z,8Z,11Z,14Z,17Z)) | down | ||
HMDB0012330 | PS (14:0/14:0) | down | ||
HMDB0115412 | PA (22:6(4Z,7Z,10Z,13Z,16Z,19Z)/18:4(6Z,9Z,12Z,15Z)) | down | ||
HMDB0115811 | PA (i-14:0/a-13:0) | down | ||
HMDB0112486 | PS (18:4(6Z,9Z,12Z,15Z)/14:1(9Z)) | down | ||
HMDB0114974 | PA (18:3(6Z,9Z,12Z)/14:1(9Z)) | down | ||
Amino acid metabolism | Valine, leucine, and isoleucine biosynthesis | LOC123765728 (BCAT2) | branched-chain amino acid aminotransferase | up |
Glycine, serine, and threonine metabolism | HMDB0112860 | PS (22:5(7Z,10Z,13Z,16Z,19Z)/22:5(4Z,7Z,10Z,13Z,16Z)) | down | |
HMDB0000043 | betaine | up | ||
HMDB0012330 | PS (14:0/14:0) | down | ||
HMDB0112486 | PS (18:4(6Z,9Z,12Z,15Z)/14:1(9Z)) | down | ||
Histidine metabolism | HMDB0003905 | imidazole-4-acetaldehyde | down | |
HMDB0003431 | L-Histidinol | down | ||
HMDB0253418 | imidazole lactic acid | down | ||
Nucleotide metabolism | Purine metabolism | LOC123745620 (NT5E) | 5′-nucleotidase | up |
LOC123761741 (ADK) | adenosine kinase-like | up | ||
LOC123767745 (ENTPD5_6) | ectonucleoside triphosphate diphosphohydrolase 5-like | up | ||
LOC123769025 (XDH) | xanthine dehydrogenase/oxidase-like | down | ||
LOC123765068 (GMPR) | GMP reductase 2-like | up | ||
Pyrimidine metabolism | LOC123762660 (UDP) | uridine phosphorylase 1-like | up | |
Signaling molecules and interaction | Cell adhesion molecules | LOC123769373 (NRXN1) | neurexin-1-like | down |
LOC123756722 (ITGB) | integrin beta pat-3-like | up | ||
LOC123746350 (ITGA5) | integrin alpha-5-like | down | ||
LOC123761742 (NRXN4) | neurexin-4-like | up | ||
LOC123770063 (ITGA8) | integrin alpha-8-like | up | ||
LOC123766564 (NRXN4) | neurexin-4-like | up | ||
ECM-receptor interaction | LOC123756722 (ITGB) | integrin beta pat-3-like | up | |
LOC123746350 (ITGA5) | integrin alpha-5-like | down | ||
LOC123764756 (AGRN) | agrin-like | down | ||
LOC123770063 (ITGA8) | integrin alpha-8-like | up | ||
LOC123763235 (COL9A) | collagen alpha-1(IX) chain-like | down | ||
LOC123772781 (COL4A) | collagen alpha-2(IV) chain-like | down | ||
LOC123772701 (COL4A) | collagen alpha-1(IV) chain-like | down | ||
LOC123760044 (COL2A) | collagen alpha-1(I) chain-like | down | ||
Membrane transport | ABC transporters | HMDB0255932 | oleandomycin | down |
HMDB0000043 | betaine | up | ||
HMDB0041627 | lactose | up | ||
HMDB0038852 | maltotriose | up | ||
Cellular processes | Ferroptosis | LOC123768078 (STEAP4) | metalloreductase STEAP4-like | down |
LOC123760415 (STEAP3) | metalloreductase STEAP3-like | up | ||
LOC123767749 (ACSL4) | long-chain fatty-acid--CoA ligase 4-like | up | ||
LOC123760010 (SLC40A1) | solute carrier family 40 member 1-like | up |
Gene ID | Gene | Description | Primer Sequence (5′-3′) | Product Size (bp) |
---|---|---|---|---|
LOC123762112 | cptp | ceramide-1-phosphate transfer protein-like | F: CAGGACGCTGCTACGACTAC | 116 |
R: GTCCGTACAGCTCTGACACC | ||||
LOC123746821 | se1L2 | protein sel-1 homolog 2-like | F: CTACGGTGATGGTGCCAAGT | 103 |
R: CCTCGCCTTGGTGATGTTCT | ||||
LOC123747344 | - | uncharacterized, transcript variant X2 | F: GCCCGCATTTGTCGTGTC | 80 |
R: GCAGAAGCCTACACTGGAAAA | ||||
LOC123772978 | rfx1 | RFX-like DNA-binding protein RFX1, transcript variant X1 | F: GTGTCATGCCCTTGTTCTCTG | 147 |
R: ATTTTGCATCCGTGTTCCTGG | ||||
LOC123773128 | des1 | sphingolipid delta (4)-desaturase DES1-like | F: GACCAGCGGGTGAGAGAAAA | 87 |
R: CACCAATCCCAGTACCCACC | ||||
LOC123765728 | bcat | branched-chain amino acid transaminase | F: GTGAGGACGCTCGGGATTTT | 87 |
R: ATCATCACTCCCAACCCGTC | ||||
LOC123756263 | hsc70 | heat shock 70 kDa protein cognate 4-like | F: CCACTTACTCGGATACCAGCC | 89 |
R: ATTGTGCAGGTTTGTCAGCC | ||||
LOC123764726 | elp4 | elongator complex protein 4-like | F: GACTTGCCTGCCTCAACAGA | 117 |
R: AACAGAAGTTGTGGGCTGGG | ||||
LOC123750192 | clec7a | C-type lectin domain family 7 member A-like | F: CCCCAAAGATCACCGAGAGG | 122 |
R: GGAGCAGCGTGTTGGATAGA | ||||
LOC123750126 | clec17a | C-type lectin domain family 17, member A-like, transcript variant X2 | F: TTCAGCATGGCTCGCTTGT | 128 |
R: TTCATGGGCGTGTCGTGG | ||||
LOC123767752 | cyp2 | cytochrome P450 2L1-like | F: CTGTTCATTGGTGGGACGGA | 77 |
R: ACCTCAGGGTACTGAGCCAT | ||||
LOC123769025 | xdh | xanthine dehydrogenase/oxidase-like | F: GAGGGACTTGCTTTCCCTCA | 78 |
R: GGTGTGGGCAGGTATCTTGT | ||||
AF436001.1 | 18s | 18S ribosomal RNA | F: CTGTGATGCCCTTAGATGTT | 259 |
R: GCGAGGGGTAGAACATCCAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, X.; Peng, A.; Zou, Y.; Li, Y.; Wei, H.; Zheng, X.; Zhao, Y. Impact of Cold Stress on Hepatopancreas Transcriptomic and Metabolomic in Red Swamp Crayfish Procambarus clarkii. Int. J. Mol. Sci. 2025, 26, 1221. https://doi.org/10.3390/ijms26031221
Zhu X, Peng A, Zou Y, Li Y, Wei H, Zheng X, Zhao Y. Impact of Cold Stress on Hepatopancreas Transcriptomic and Metabolomic in Red Swamp Crayfish Procambarus clarkii. International Journal of Molecular Sciences. 2025; 26(3):1221. https://doi.org/10.3390/ijms26031221
Chicago/Turabian StyleZhu, Xiaochen, Aidi Peng, Yueying Zou, Yingdong Li, Hua Wei, Xianhu Zheng, and Yingying Zhao. 2025. "Impact of Cold Stress on Hepatopancreas Transcriptomic and Metabolomic in Red Swamp Crayfish Procambarus clarkii" International Journal of Molecular Sciences 26, no. 3: 1221. https://doi.org/10.3390/ijms26031221
APA StyleZhu, X., Peng, A., Zou, Y., Li, Y., Wei, H., Zheng, X., & Zhao, Y. (2025). Impact of Cold Stress on Hepatopancreas Transcriptomic and Metabolomic in Red Swamp Crayfish Procambarus clarkii. International Journal of Molecular Sciences, 26(3), 1221. https://doi.org/10.3390/ijms26031221