Identification of Leaf Stripe Resistance Genes in Hulless Barley Landrace Teliteqingke from Qinghai-Tibet Plateau
Abstract
1. Introduction
2. Results
2.1. Genetic Analysis of Leaf Stripe Resistance in Teliteqingke
2.2. Identification of Genetic Loci Associated with Leaf Stripe Resistance in Teliteqingke Through BSA-SNP Array
2.3. Identification of Genetic Loci Associated with Leaf Stripe Resistance in Teliteqingke Through RNA-Seq
2.4. Co-Localization of Leaf Stripe Resistance-Associated Regions in Teliteqingke
2.5. Expression of the Candidate Genes in Response to P. graminea
3. Discussion
4. Materials and Methods
4.1. Plant and Fungal Materials
4.2. Assessment of Disease Resistance
4.3. Analysis of BSA-SNP Array
4.4. RNA-Seq Analysis
4.5. Screening and Verification of Genes Related to Leaf Stripe Resistance in Teliteqingke
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kang, S.H.; Zhao, K.; Hou, L. Hulless barley leaf stripe pathogen of genetic diversity and its pathogenic variance analysis. Mol. Plant Breed. 2022, 22, 5725–5735. [Google Scholar]
 - Hu, Z.W.; Yang, F.; Yan, J.H.; Hou, L.; Weng, H.; Yao, Q.H. Genetic diversity analysis of leaf stripe pathogen in Qinghai Province. Barley Cereal Sci. 2020, 37, 21–26. [Google Scholar]
 - Cui, G.C. Acute hulless barley stripe disease found in Tibet. Plant Prot. 1984, 10, 13. [Google Scholar]
 - Platenkamp, R. Investigations on the infection pathway of Drechslera graminea in germinating barley. In Royal Veterinary and Agricultural University Yearbook; Royal Veterinary and Agricultural University: Copenhagen, Denmark, 1976; pp. 49–64. [Google Scholar]
 - Haegi, A.; Bonardi, V.; Dall’Aglio, E.; Glissant, D.; Tumino, G.; Collins, N.; Bulgarelli, D.; Infantino, A.; Stanca, A.; Delledonne, M.; et al. Histological and molecular analysis of Rdg2a barley resistance to leaf stripe. Mol. Plant Pathol. 2008, 9, 463–478. [Google Scholar] [CrossRef] [PubMed]
 - Yang, X.; Yao, X.H.; An, L.K.; Yao, Y.H.; Bai, Y.X.; Wu, K.L. Cloning and expression analysis of NBS-LRR gene HvtRGA in hulless barley infected with leaf stripe pathogen. Acta Bot. Sin. 2020, 40, 1655–1662. [Google Scholar]
 - Thomsen, S.; Jensen, H.; Jensen, J.; Skou, J.; Jørgensen, J. Localization of a resistance gene and identification of sources of resistance to barley leaf stripe. Plant Breed. 1997, 116, 455–459. [Google Scholar] [CrossRef]
 - Biselli, C.; Urso, S.; Bernardo, L.; Tondelli, A.; Tacconi, G.; Martino, V.; Valè, G. Identification and mapping of the leaf stripe resistance gene Rdg1a in Hordeum spontaneum. Theor. Appl. Genet. 2010, 120, 1207–1218. [Google Scholar] [CrossRef]
 - Bulgarelli, D.; Collins, N.C.; Tacconi, G.; Dellaglio, E.; Brueggeman, R.; Valè, G. High-resolution genetic mapping of the leaf stripe resistance gene Rdg2a in barley. Theor. Appl. Genet. 2004, 108, 1401–1408. [Google Scholar] [CrossRef]
 - Si, E.J.; Zhang, Y.; Meng, Y.X.; Li, B.C.; Ma, X.L.; Wang, H.J. Localization of leaf stripe resistance genes in barley. J. Plant Protect. 2019, 46, 723–729. [Google Scholar]
 - Pecchioni, N.; Faccioli, P.; Toubia-Rahme, H.; Valè, G.; Terzi, V. Quantitative resistance to barley leaf stripe (Pyrenophora graminea) is dominated by one major locus. Theor. Appl. Genet. 1996, 93, 97–101. [Google Scholar] [CrossRef]
 - Arru, L.; Niks, R.E.; Lindhout, P.; Valè, G.; Francia, E.; Pecchioni, N. Genomic regions determining resistance to leaf stripe (Pyrenophora graminea) in barley. Genome 2002, 45, 460–466. [Google Scholar] [CrossRef] [PubMed]
 - Arru, L.; Francia, E.; Pecchioni, N. Isolate-specific QTLs of resistance to leaf stripe (Pyrenophora graminea) in the ‘Steptoe’ × ‘Morex’ spring barley cross. Theor. Appl. Genet. 2003, 106, 668–675. [Google Scholar] [CrossRef]
 - Si, E.J.; Meng, Y.X.; Li, B.C.; Ma, X.L.; Zhang, Y.; Wang, H.J. Correlation analysis of barley leaf stripe resistance and SSR markers. Plant Protect. J. 2019, 46, 1073–1085. [Google Scholar]
 - Si, E.J.; Lai, Y.; Meng, Y.X.; Li, B.C.; Ma, X.L.; Shang, X.W.; Wang, H.J. Analysis of genetic diversity and correlation between SSR markers and barley leaf stripe resistance. Chin. J. Agric. Biotechnol. 2015, 23, 193–202. [Google Scholar]
 - Yang, X. Mapping and Candidate Gene Screening of Hulless Barley Leaf Stripe Resistance Genes Based on BSR-Seq. Master’s Thesis, Qinghai University, Xining, China, 2021. [Google Scholar]
 - Kang, S.H.; Hou, L. Identification of resistance of hulless barley germplasm resources to leaf stripe disease. Plant Protect. 2024, 50, 286–294. [Google Scholar]
 - Long, Y.; Zhao, K.; Hou, L. Identification of leaf stripe resistance and molecular detection of resistance genes of hulless barley germplasm accessions. Sichuan Agric. 2024, 42, 296–305. [Google Scholar]
 - Zhao, K.; Li, Q.R.; Hou, L.; Bai, Y.X.; Jiang, L.L.; Wei, Y.H.; Guo, Q.Y. Genetic analysis of stripe rust resistance genes in adult stage of two spring wheat germplasm resources. J. Zhejiang Agric. Sci. 2021, 33, 595–601. [Google Scholar]
 - Hou, L.; Fang, S.Y.; Kang, S.H. Identification Method of Liquid Infection of Leaf Barley Pathogen. CN114375716A, 19 January 2022. [Google Scholar]
 - Boulif, M.; Wilcoxson, R.D. Inheritance of resistance to Pyrenophora graminea in barley. Plant Dis. 1988, 72, 233–238. [Google Scholar] [CrossRef]
 - Gao, S.; Mo, H.J.; Shi, H.R.; Wang, Z.Q.; Lin, Y.; Wu, F.K.; Zheng, Y.L. Construction of wheat genetic map and QTL analysis of important agronomic traits using SNP gene chip technology. Chin. J. Appl. Environ. Biol. 2016, 22, 85–94. [Google Scholar]
 - Jia, X.P. Expression Profile Analysis of Resistance to Fusarium of Wheat Variety Wangshuibai Based on Gene Chip Technology and Cloning of a Non-Specific Lipid Transfer Protein Gene. Ph.D. Thesis, Nanjing Agricultural University, Nanjing, China, 2012. [Google Scholar]
 - Ma, Q.L.; Chen, L.J.; Yang, L.G.; Xia, X.M.; Ma, F.Q.; Fang, M. Preliminary report on identification of local barley varieties resistant to leaf stripe disease in Gansu. Crop Variety Resour. 1991, 3, 28–30. [Google Scholar]
 - Wu, Q.H.; Chen, Y.X.; Li, D.; Wang, Z.Z.; Zhang, Y.; Yuan, C.G.; Liu, Z.Y. Large-scale mapping of wheat powdery mildew resistance genes by SNP chip and BSA. Acta Cropol. Sin. 2018, 44, 1–14. [Google Scholar]
 - Bulli, P.; Zhang, J.L.; Chao, S.M.; Chen, X.M.; Pumphrey, M. Genetic architecture of resistance to stripe rust in a global winter wheat germplasm collection. G3-Genes Genom. Genet. 2016, 6, 2237–2253. [Google Scholar] [CrossRef] [PubMed]
 - Nan, Y.; Xie, Y.; He, H.; Wu, H.; Gao, L.; Atif, A.; Zhang, Y.; Tian, H.; Hui, J.; Gao, Y. Integrated BSA-seq and RNA-seq analysis to identify candidate genes associated with nitrogen utilization efficiency (NUtE) in rapeseed (Brassica napus L.). Int. J. Biol. Macromol. 2024, 254, 127771. [Google Scholar] [CrossRef] [PubMed]
 - Liu, Y.; Chen, P.; Li, W.; Liu, X.; Yu, G.; Zhao, H.; Zeng, S.; Li, M.; Sun, G.; Feng, Z. Conjunctive analyses of BSA-Seq and BSR-Seq to identify candidate genes controlling the black lemma and pericarp trait in Barley. Int. J. Mol. Sci. 2023, 24, 9473. [Google Scholar] [CrossRef] [PubMed]
 - Wang, H.; Pang, Z.; Wang, L.; Tian, G.; Li, F.; Pan, Y.; Ding, K. Localization of potato browning resistance genes based on BSA-seq technology. Peer J. 2024, 12, e17831. [Google Scholar] [CrossRef] [PubMed]
 - Zhao, Y.; Sun, Y.; Cao, K.; Zhang, X.; Bian, J.; Han, C.; Jiang, Y.; Xu, L.; Wang, X. Combined use of specific length amplified fragment sequencing (SLAF-seq) and bulked segregant analysis (BSA) for rapid identification of genes influencing fiber content of hemp (Cannabis sativa L.). BMC Plant Biol. 2022, 22, 250. [Google Scholar] [CrossRef]
 - Hu, H.; Yi, L.; Wu, D.; Zhang, L.; Zhou, X.; Wu, Y.; Shi, H.; Wei, Y.; Hou, J. Identification of candidate genes associating with soybean cyst nematode in soybean (Glycine max L.) using BSA-seq. PeerJ. 2024, 12, e18252. [Google Scholar] [CrossRef]
 - Geng, L.L. Transcriptome Analysis of Cultivated and Wild Tomato Based on RNA-Seq Technique. Master’s Thesis, Zhejiang Sci-Tech. University, Hangzhou, China, 2017. [Google Scholar]
 - Zhang, N. Research on differential EXPRESSION Gene Detection Algorithm Based on RNA-Seq Data. Master’s Thesis, Dalian Maritime University, Dalian, China, 2017. [Google Scholar]
 - Xu, Y.B.; Yang, Q.N.; Zheng, H.J.; Xu, Y.F.; Sang, Z.Q.; Guo, Z.F.; Zhang, J.N. Genotyping by target sequencing (GBTS) and its applications. Sci. Agric. Sin. 2020, 53, 2983–3004. [Google Scholar]
 - Soltani, O.; Jöst, M.; Hoffie, I.; Hensel, G.; Kappel, C.; Prag, G.; McKim, S.; Kumlehn, J.; Lenhard, M. RING/U-box E3 protein BIR1 interacts with and ubiquitinates barley growth repressor BROAD LEAF1. Plant Physiol. 2024, 196, 228–243. [Google Scholar] [CrossRef]
 - Zhang, Z.L.; Xu, M.M.; Guo, Y.F. Ring/U-Box protein AtUSR1 functions in promoting leaf senescence through JA signaling pathway in Arabidopsis. Front. Plant Sci. 2020, 11, 608589. [Google Scholar] [CrossRef]
 - Cheng, X.Y.; Sun, T.; Wang, S.S.; Xie, W.P.; Yang, Q.; Cai, T.C.; Zhu, W.T.; Zhuang, W.H. Cloning and expression analysis of NBS-LRR resistance gene AhRRLLS1 and its promoter in peanut. J. Agric. Biotechnol. 2023, 31, 1147–1158. [Google Scholar]
 - Geng, Y.F.; Lv, M.F. Research progress on cysteine-rich receptor kinase families in plants. Zhejiang J. Agric. Sci. 2020, 32, 2303–2312. [Google Scholar]
 - Zhang, F.J. Functional Study of Apple Ankyrin MdANK2B in Salt Stress and ABA Response. Master’s Thesis, Shandong Agricultural University, Tai’an, China, 2021. [Google Scholar]
 - Mahalingam, R.; Walling, G.J. Genomic survey of RNA recognition motif (RRM) containing RNA binding proteins from barley (Hordeum vulgare ssp. vulgare). Genomics 2020, 112, 1829–1839. [Google Scholar] [CrossRef]
 - Li, X.Y. Functional Study of Anther Development and Stress-Resistance Related Genes in Wheat bZIP Transcription Factor Family. Ph.D. Thesis, Northwest A&F University, Xianyang, China, 2016. [Google Scholar]
 - Li, B.; Ruotti, V.; Stewart, R.M. RNA-Seq gene expression estimation with read mapping uncertainty. Bioinformatics 2010, 26, 493–500. [Google Scholar] [CrossRef] [PubMed]
 - McKenna, A.; Hanna, M.; Banks, E.; Sivachenko, A.; Cibulskis, K.; Kernytsky, A.; Garimella, k.; Altshuler, D.; Gabriel, S.; Daly, M.; et al. The Genome Analysis Toolkit: A MapReduce framework for analyzing next generation DNA sequencing data. Genome Res. 2010, 20, 1297–1303. [Google Scholar] [CrossRef] [PubMed]
 - Hill, J.T.; Demarest, B.L.; Bisgrove, B.W.; Gorsi, B.; Su, Y.C.; Yost, H.J. MMAPPR: Mutation mapping analysis pipeline for pooled RNA-seq. Genome Res. 2013, 23, 687–697. [Google Scholar] [CrossRef]
 - Qi, X.; Yang, R.; Zhao, F.K.; Wang, J.L.; Wang, S.H.; Cheng, J.H. Validation of stem loop qRT-PCR method for tomato miRNA. Mol. Plant Breed. 2015, 13, 1867–1871. [Google Scholar]
 





| Parents and Cross | Generations | Total Number of Plants/Lines | No. of Resistant Plants/Lines | No. of Susceptible Plants/Lines | Expected Ratio | χ2 | p-Value | |
|---|---|---|---|---|---|---|---|---|
| Teliteqingke | P1 | 15 | ||||||
| Dulihuang | P2 | 15 | ||||||
| P1 × P2 | F3 | 155 | 141 | 14 | 15 | 1 | 1.60 | 0.15 | 
| P1 × P2 | F3 | 155 | 137 | 18 | 15 | 1 | 0.05 | 0.74 | 
| Sample | No. of Raw Reads | No. of Clean Reads | Raw Bases (bp) | Clean Bases (bp) | Effective Rate (%) | Q20 (%) | Q30 (%) | 
|---|---|---|---|---|---|---|---|
| Teliteqingke | 23,712,526 | 23,675,688 | 3,556,878,900 | 3,134,944,054 | 88.14 | 97.65 | 93.00 | 
| Dulihuang | 20,508,626 | 20,484,396 | 3,076,293,900 | 2,672,254,594 | 86.87 | 97.67 | 93.10 | 
| BulkR | 23,028,646 | 22,986,476 | 3,454,296,900 | 3,122,676,470 | 90.40 | 97.41 | 92.32 | 
| BulkS | 18,231,610 | 18,206,664 | 2,734,741,500 | 2,502,101,400 | 91.49 | 97.42 | 92.32 | 
| Sample | Raw Reads | Clean Reads | Clean Bases (Gb) | Error Rate (%) | Q20 (%) | Q30 (%) | GC Content (%) | Alignment Rate (%) | 
|---|---|---|---|---|---|---|---|---|
| Dulihuang | 91,293,194 | 90,303,276 | 13.55 | 0.03 | 97.81 | 93.62 | 54.32 | 95.84 | 
| Teliteqingke | 90,722,940 | 90,073,344 | 13.51 | 0.03 | 97.84 | 93.72 | 56.32 | 95.55 | 
| BulkS | 96,945,580 | 96,231,078 | 14.43 | 0.03 | 97.62 | 93.13 | 56.17 | 95.31 | 
| BulkR | 92,230,542 | 91,393,264 | 13.71 | 0.03 | 97.72 | 93.39 | 53.22 | 95.45 | 
| Gene ID | Start | End | Description | 
|---|---|---|---|
| HORVU.MOREX.r3.3HG0232110.1 | 2,841,496 | 284,145,536 | RING/U-box superfamily protein | 
| HORVU.MOREX.r3.3HG0232120.1 | 28,429,178 | 28,431,928 | NBS-LRR disease resistance protein | 
| HORVU.MOREX.r3.3HG0232140.1 | 28,461,280 | 28,455,885 | Ankyrin repeat protein family-like protein | 
| HORVU.MOREX.r3.3HG0232180.1 | 28,520,789 | 28,515,702 | RNA recognition motif (RRM) containing protein | 
| HORVU.MOREX.r3.3HG0232220.1 | 28,691,124 | 28,689,091 | Protease HtpX | 
| HORVU.MOREX.r3.3HG0232410.1 | 28,902,070 | 28,897,759 | bZIP transcription factor; putative (DUF1664) | 
| HORVU.MOREX.r3.3HG0232550.1 | 29,213,059 | 29,213,793 | Cysteine-rich receptor kinase | 
| Gene ID | Forward Primer (5′-3′) | Reverse Primer (3′-5′) | 
|---|---|---|
| HORVU.MOREX.r3.3HG0232110.1 | GATGATAAGCCCGCCATAGA | CCGATGTCCACATGGTAAGA | 
| HORVU.MOREX.r3.3HG0232120.1 | CCAAGCACTCAAGCCAATTTC | CTTCCCATGACCCTGGAATATC | 
| HORVU.MOREX.r3.3HG0232140.1 | GGAGGTTCACTCACATGCTTAT | CACAACACCACAAGAGGACTAA | 
| HORVU.MOREX.r3.3HG0232180.1 | GCGGATGAAACTGGTACAGATA | CATTAATGTCGGACACGGTAGA | 
| HORVU.MOREX.r3.3HG0232220.1 | GTCACCTCAAGTGCGATCAT | AAGGAACCCAGCAACCATAC | 
| HORVU.MOREX.r3.3HG0232410.1 | CGTGTCTCCTGTAGCTCAATC | CTCAGTCCTGATGCTGATATGG | 
| HORVU.MOREX.r3.3HG0232550.1 | ATCTGACCACTACACCAAACC | CTCACCTTTCGTAGCCTTGAA | 
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.  | 
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tan, Z.; Zhang, S.; Qu, Y.; Kang, S.; Fang, S.; Hou, L. Identification of Leaf Stripe Resistance Genes in Hulless Barley Landrace Teliteqingke from Qinghai-Tibet Plateau. Int. J. Mol. Sci. 2025, 26, 1133. https://doi.org/10.3390/ijms26031133
Tan Z, Zhang S, Qu Y, Kang S, Fang S, Hou L. Identification of Leaf Stripe Resistance Genes in Hulless Barley Landrace Teliteqingke from Qinghai-Tibet Plateau. International Journal of Molecular Sciences. 2025; 26(3):1133. https://doi.org/10.3390/ijms26031133
Chicago/Turabian StyleTan, Zemin, Sai Zhang, Yunfeng Qu, Shenghua Kang, Shiyu Fang, and Lu Hou. 2025. "Identification of Leaf Stripe Resistance Genes in Hulless Barley Landrace Teliteqingke from Qinghai-Tibet Plateau" International Journal of Molecular Sciences 26, no. 3: 1133. https://doi.org/10.3390/ijms26031133
APA StyleTan, Z., Zhang, S., Qu, Y., Kang, S., Fang, S., & Hou, L. (2025). Identification of Leaf Stripe Resistance Genes in Hulless Barley Landrace Teliteqingke from Qinghai-Tibet Plateau. International Journal of Molecular Sciences, 26(3), 1133. https://doi.org/10.3390/ijms26031133
        