Next Article in Journal
Effects of Catfish Egg Lectin on Cancer Cells Differ According to the Globotriaosylceramide Species They Express
Next Article in Special Issue
Persistent and Dose-Dependent Neural and Metabolic Gene Expression Changes Induced by Transient Citalopram Exposure in Zebrafish Embryos
Previous Article in Journal
Tetramethyl Bisphenol F: Organ- and System-Specific Toxicity, Current Status, and Perspectives
Previous Article in Special Issue
CRISPR/Cas9-Mediated Disruption of lrp6a Leads to Abnormal Median Fin Development and Somitogenesis in Goldfish (Carassius auratus)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Intergenic Variants Upstream of GADD45b Affect Survival of Micropterus salmoides Following LMBV Exposure

1
College of Fisheries and Life Science, Shanghai Ocean University, Shanghai 201306, China
2
Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Key Laboratory of Fishery Drug Development, Ministry of Agriculture and Rural Affairs, Guangdong Province Key Laboratory of Aquatic Animal Immune and Sustainable Aquaculture, Guangzhou 510380, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2025, 26(19), 9281; https://doi.org/10.3390/ijms26199281
Submission received: 16 July 2025 / Revised: 3 September 2025 / Accepted: 15 September 2025 / Published: 23 September 2025
(This article belongs to the Special Issue Fish Genomics and Developmental Biology, 2nd Edition)

Abstract

GADD45 (growth arrest and DNA damage inducible 45) is a crucial signaling regulator in cells and plays an important role in various biological processes, including cellular stress response, cell cycle control, DNA damage repair, apoptosis, and tumor suppression. Our previous studies identified GADD45b as a candidate gene associated with resistance to largemouth bass ranavirus (LMBV) infection in largemouth bass (Micropterus salmoides). In the present study, the upstream intergenic polymorphisms of GADD45b were investigated to explore their association with resistance/susceptibility to LMBV. We employed the kompetitive allele specific PCR (KASP) assay to genotype 118 resistant individuals and 122 susceptible individuals following LMBV infection. The results revealed that SNP38943374 C>A and SNP38943495 G>A were significantly associated with LMBV resistance/susceptibility (p < 0.01). Individuals with the CC genotype of SNP38943374 and the GG genotype of SNP38943495 were more prevalent in resistant groups and have advantages in survival time after LMBV infection. Linkage disequilibrium analysis indicated strong linkage among these two loci. The distinct dynamic expression patterns of GADD45b in different genotypes following LMBV infection suggest its functional role in viral infection. Additionally, dynamic expression levels of immune-related genes (IFN-γ, TNF-α, and IL-10) also varied among different genotypes. These results demonstrated that the two SNPs in GADD45b could be used as candidate markers for further investigation of selective breeding of resistant largemouth bass to LMBV.

1. Introduction

Aquatic animals are highly vulnerable to pathogens under farming conditions, and disease outbreaks often result in significant economic losses. Consequently, genetic improvement of disease resistance has become a major focus in aquaculture breeding programs. As a molecular marker-assisted breeding method, single nucleotide polymorphisms (SNPs) have been extensively utilized in aquaculture breeding [1]. In genetic studies of aquatic species, researchers have identified a large number of SNP loci closely associated with economically important traits, including stress resistance [2,3,4], growth traits [5,6,7,8], sex-related traits [9,10] and disease resistance [11,12,13].
The growth arrest and DNA damage inducible 45 (GADD45) family, including GADD45a, GADD45b, and GADD45g, is extensively involved in diverse biological pathways including cell cycle regulation, DNA repair, apoptosis, cellular stress response, and immune regulation [14,15]. GADD45b, also known as MyD118, contains conserved DNA elements including c-Rel, USF/N-myc, NF-Y, GC box, CCAAT box and TATA box [16]. Previous studies have reported the expression of GADD45b was modulated by the immune-related transcription factors NF-κB and p53 [16]. It has been revealed that GADD45b plays an important role in the process of viral infection. Human immunodeficiency virus (HIV)-1 and avian leukosis virus subgroup J (ALV-J) infection induced the expression of GADD45b, which contributed to apoptosis and autophagy [17,18,19]. Furthermore, overexpression of GADD45b was found to specifically inhibit HIV-1 promoter activity, whereas knockdown of GADD45b could activate the latent of HIV-1 [18]. On the other hand, GADD45b influences various biological processes by regulating immune-related signaling pathways. Studies have demonstrated that GADD45b regulates autophagy, apoptosis and cell differentiation through the p38 MAPK signaling pathway [20,21,22]. GADD45b regulated the chemotactic response of granulocytes and macrophages to LPS via the p38/JNK signaling pathway [23,24]. Previous studies have demonstrated that GADD45b mediated the activation of MAPK signaling in Th1 cells, thereby influencing interferon-gamma (IFN-γ) production [25]. Thus, Gadd45b functions as an essential feedback regulator that sustains both cognate and inflammatory signaling [25]. Given the critical role of GADD45b in viral infections and host immune responses, it is worth investigating the association between GADD45b gene polymorphisms and disease resistance.
The largemouth bass (Micropterus salmoides) is an economically important freshwater fish species in China. In intensive aquaculture systems, largemouth bass are frequently suffered by various diseases caused by viral, bacterial, and parasitic pathogens, resulting in substantial economic losses to the farming industry. Largemouth bass virus (LMBV) is a prevalent viral pathogen in largemouth bass aquaculture [26,27]. Infected fish typically present clinical signs including skin and muscle ulceration, as well as splenic and hepatic swelling [26]. To date, preventive and control measures against LMBV-induced diseases have primarily focused on vaccine development and drugs applications [28,29]. However, challenges persist due to antigenic variability in field LMBV strains and drug resistance development. This has stimulated the adoption of molecular marker-assisted disease-resistant breeding as an alternative solution.
In previous studies, we identified GADD45b as a candidate gene associated with LMBV resistance in largemouth bass through genome-wide association studies (GWAS) [30]. In the present study, SNPs of GADD45b were investigated to explore their association with resistance/susceptibility to LMBV. We compared the survival times of individuals of different genotypes after LMBV infection. We also investigated the dynamic expression patterns of GADD45b and immune-related genes in individuals of different genotypes after viral infection. These results could provide potential molecular markers for the breeding of largemouth bass resistant to LMBV.

2. Results

2.1. Polymorphisms in GADD45b Gene and Their KASP-Based Genotyping Profiles

As shown in Figure 1A, SNP38943374 (C>A) and SNP38943495 (G>A) are located in the intergenic regions of the GADD45b gene. Using the KASP assay, the two markers were found to divide the population into three distinct groups, respectively (Figure 1B). Near the y-axis, the blue clusters indicate homozygous genotypes: the CC group in SNP38943374 and the GG group in SNP38943495 (Figure 1B). Positioned near the x-axis, the red clusters indicate another collection of homozygous genotypes, which in this case were the AA group for SNP38943374 and the AA group for SNP38943495 (Figure 1B). In the central region, the green clusters indicate heterozygous genotypes: AC for SNP38943374 and AG for SNP38943495 (Figure 1B).

2.2. Association of GADD45b SNPs with the Resistance/Susceptibility to LMBV

We genotyped two SNPs in 240 individuals (118 resistant and 122 susceptible) and performed detailed statistical analyses of the genotype and allele frequencies for each SNP (Figure 2). As shown in Table 1 and Table 2, SNP38943374 C>A and SNP38943495 G>A was significantly associated with the resistance/susceptibility to LMBV both in genotype and allele analysis (p < 0.01). In resistant groups, the CC, AC and AA genotype frequencies at SNP38943374 C>A were 77.1%, 20.3% and 2.5%, and the GG, AG and AA genotype frequencies at SNP38943495 G>A were 76.3%, 22.0% and 1.7%, respectively, while the corresponding frequency distributions in susceptible groups were 30.3%, 45.9% and 23.8% at SNP38943374 C>A, and 30.3%, 47.5% and 22.1% at SNP38943495 G>A, respectively.

2.3. Survival Time Variation Across Genotypes After LMBV Challenge

Analysis of genotyping results demonstrated significant differences in survival time across genotypes at two loci (SNP38943374 and SNP38943495) of GADD45b following LMBV infection (p < 0.01) (Figure 3). The survival time of individuals with the CC genotype at SNP38943374 and the GG genotype at SNP38943495 was significantly longer than that of the other two genotypes individuals (p < 0.01). Thus, SNP38943374 and SNP38943495 were significantly associated with resistance to LMBV infection in largemouth bass. There were no significant differences in survival time between individuals with the AC and AA genotypes at SNP38943374 or between those with the AG and AA genotypes at SNP38943495 (p > 0.05).

2.4. Linkage Disequilibrium Analysis of GADD45b Gene SNPs

Using Haploview 4.2 software, we analyzed the linkage disequilibrium between two SNPs in the GADD45b gene. The results showed a strong pairwise linkage disequilibrium (r2 = 0.86) between loci SNP38943374 C>A and SNP38943495 G>A (Figure 4A). The genotype distributions of these two SNPs are in Hardy–Weinberg equilibrium. Furthermore, haplotype analysis showed that the frequency of the haplotype CG (68.7%) was higher than that of the haplotype AA (28.3%) (Figure 4B).

2.5. GADD45b Expression in Different Genotypes After LMBV Infection

To examine the response of GADD45b gene to LMBV infection, the time-course expression of the GADD45b mRNA following LMBV infection was investigated. After LMBV infection, GADD45b levels increased across all genotype groups from 0 h to 48 h, then decreased from 48 h to 72 h (Figure 5). In the CC and AC genotypes, the expression level of GADD45b exhibited a gradual increase from 0 h to 48 h, peaking at 48 h with a 1.96-fold and 2.35-fold upregulation compared to the control group, respectively (p < 0.05). Differently, the AA group maintained consistently high GADD45b expression levels at 24 h, 48 h, and 72 h after viral infection, reaching 3.71-, 3.91-, and 3.82-fold of the control group, respectively (p < 0.05). Overall, the AA group exhibited higher GADD45b expression levels following viral infection compared to the CC and AC groups.

2.6. Immune Gene Expression Profiles Across Genotypes Following LMBV Infection

We further analyzed the expression changes of immune-related genes (including IFN-γ, TNF-α, and IL-10) in different genotypes following LMBV infection. As shown in Figure 6A, IFN-γ expression in the CC and AC groups peaked at 48 h post-viral infection, reaching levels 67.57-fold and 91.49-fold higher than the control group, respectively (p < 0.05). In contrast, the AA group exhibited peak IFN-γ expression at 72 h, with a 63.37-fold increase compared to the control group (p < 0.05). As shown in Figure 6B, TNF-α expression reached peak levels at 48 h, showing significant increases to 5.95-fold, 5.77-fold, and 4.75-fold of the control group in the CC, AC, and AA groups, respectively (p < 0.05). As demonstrated in Figure 6C, IL-10 expression decreased from 0 h to 24 h post-viral infection in all three groups. Subsequently, IL-10 levels in the CC and AC groups increased between 24 h and 48 h, followed by a decline from 48 h to 72 h. In contrast, the AA group exhibited a sustained increase in IL-10 expression from 24 h to 72 h (p > 0.05).

3. Discussion

GADD45b is a pivotal cellular signaling regulator that has been documented to participate in multiple biological processes, including autophagy, apoptosis, and immune regulation [20,21,22,25]. The intensive culture of largemouth bass has been severely limited by recurrent outbreaks of LMBV. Selective breeding, especially genomic selection based on genetic variants, is considered an effective strategy to enhance the disease resistance of fish [31,32]. Currently, several new aquatic disease-resistant varieties have been successfully developed using genomic selection technology with molecular markers, including a red seabream strain resistant to red sea bream iridoviral disease (RSIVD) [33], a strain of Japanese flounder resistant to lymphocystis disease [34], and a strain of Cynoglossus semilaevis resistant to Vibrio harveyi [35]. In light of the critical function of GADD45b in viral infection and host immune regulation, it is valuable to explore the relationship between GADD45b gene polymorphisms and disease resistance in largemouth bass.
SNP markers are widely used as genetic markers in molecular marker-assisted selection in aquaculture species [36]. In recent years, the polymorphism of immune-related genes in an increasing number of aquaculture species has been demonstrated to be associated with resistance/susceptibility to various diseases, such as IL-6 in mandarin fish [11], TLR8b in grass carp [13], MHC IIα in Japanese flounder and golden pompano [12,37]. The discovery of these immune-related gene polymorphisms provides valuable molecular marker resources for disease-resistant breeding in fish. Nevertheless, research focusing on the characterization of GADD45b polymorphism in fish is limited.
To our knowledge, this is the first study to identify an association between GADD45b SNPs and disease susceptibility in fish. Currently, the main methods for SNP genotyping based on PCR technology include: amplification refractory mutation system PCR (ARMS-PCR) [38], high-resolution melting analysis (HRMA) [39], TaqMan probe method [40] and kompetitive allele specific PCR (KASP) [41]. Considering the advantages of the KASP method, including low cost, high accuracy and operational simplicity, we employed the KASP method for the first time to genotype two SNP loci in the GADD45b. And the statistical analyses indicated that the genotypes and alleles of SNP38943374 C>A and SNP38943495 G>A were significantly associated with largemouth bass resistance to LMBV (p < 0.05) (Table 1). In addition, the CC genotype of SNP38943374 C>A and the GG genotype of SNP38943495 G>A are more prevalent in resistant groups. Survival time is an important indicator used to analyze the association between genetic variants and traits. For example, through the analysis of survival time among individuals with different genotypes, the researchers validated the SNP (T/C) locus associated with ammonia nitrogen tolerance in Nile tilapia, as well as the SNP24194184 and SNP24101852 loci linked to low oxygen tolerance in golden pompano [4,42]. In this work, individuals with the CC genotype of SNP38943374 C>A and the GG genotype of SNP38943495 G>A had significantly longer survival times after viral infection compared to that of the other two genotypes individuals. Additionally, we observed a strong linkage disequilibrium between these two SNP loci, suggesting they may share common genetic associations and implying their equally important roles in resisting viral infections. And the haplotype analysis revealed that the CG and AA haplotypes are associated with LMBV resistance/susceptibility. These results suggested that the C allele of SNP38943374 C>A and the G allele of SNP38943495 G>A could be the genetic protective factors against LMBV infection.
Among the two SNP loci in the GADD45b, SNP38943374 (C>A) and SNP38943495 (G>A) are located in intergenic regions. For an extended period, intergenic genomic sequences have been conventionally characterized as “junk” DNA segments. However, researchers have discovered that intergenic regions containing SNP loci displayed transcriptional activity [43,44]. SNP loci located in intergenic regions may contribute to major depressive disorder susceptibility by modulating long non-coding RNA expression [45]. On the other hand, intergenic SNP loci exhibited strong linkage disequilibrium could serve as genetic markers for disease association studies [30], although they may not have a direct functional role. Previous studies have reported that intergenic regions upstream of GADD45b have been reported to harbor conserved regulatory elements, such as enhancers and transcription factor binding sites (e.g., p53, NF-κB) [16]. These regions may modulate stress-responsive transcriptional activity by facilitating chromatin remodeling or serving as docking sites for co-regulators. In this work, the disease-associated SNP38943374 and SNP38943495 in intergenic regions upstream of GADD45b may play functional roles in transcriptional activity regulation or serve as genetic markers for monitoring LMBV risk.
In the present work, GADD45b expression is upregulated in response to LMBV infection in different genotype individuals, aligning with the induction of GADD45b observed in HIV-1 and ALV-J viral infections [18,19]. Remarkably, compared to individuals with the other two genotypes, those with the AA genotype of SNP38943374 C>A or the AA genotype of SNP38943495 G>A showed higher expression levels of GADD45b following viral infection. These results indicated that individuals with the AA genotype show a more pronounced response to viral infection. Virus-induced differential expression of GADD45b among different genotype populations may implicate its involvement in the pathogenic mechanisms underlying LMBV. However, how GADD45b contributes to LMBV development remains elusive.
The antiviral functions of IFN-γ and TNF-α as pro-inflammatory cytokines have been investigated in various fish species [46,47,48,49]. In this study, we found that individuals with the AA genotype of SNP38943374 and SNP38943495 displayed lower overall expression levels of IFN-γ and TNF-α during the early phase of viral infection (from 0 h to 48 h) compared to those with the other two genotypes. This may be the reason why AA genotype individuals were susceptible to LMBV, as they were unable to clear the pathogen in the early stages of viral infection. Studies have demonstrated that GADD45b inhibits apoptosis mediated by TNF-α [50]. Based on the results showing that GADD45b is highly expressed after viral infection in combination with the AA genotype of SNP38943374 and SNP38943495, we speculate that upregulated GADD45b may play a regulatory role in viral infection by modulating TNF-α-mediated apoptosis. LMBV-induced GADD45b expression may suppress TNF-α-mediated apoptosis, thereby prolonging host cell survival and providing an extended ‘factory’ period for viral replication. Conversely, this delayed apoptosis allows more time for the virus to complete its replication, assembly, and release processes, ultimately leading to increased viral titers and promoting the spread of viral infection. Additionally, IL-10, as an anti-inflammatory cytokine, has been demonstrated to downregulate pro-inflammatory factors in fish, thereby inhibiting inflammatory responses and mitigating inflammation-induced tissue damage [51,52]. In our study, AC and CC genotype individuals showed a rapid increase in IL-10 expression during the early stages of viral infection, suggesting that these genotype individuals may be able to rapidly initiate IL-10 expression in response to the inflammatory response triggered by infection. In contrast, AA genotype individuals exhibited a sustained increase in IL-10 expression during the late stages of viral infection. The sustained increase in IL-10 expression may keep the host in a state of strong immune suppression during the later stages of infection, which may affect the efficiency of pathogen clearance and even lead to chronic infection or persistent infection.
Therefore, future studies on GADD45b should focus on clarifying its antiviral mechanisms, particularly how it modulates cellular signaling to induce antiviral factors and regulate host immune responses against LMBV. Further studies are also needed to investigate how intergenic SNPs regulate gene expression, particularly through experimental validation—such as dual-luciferase reporter assays or ATAC-seq—to establish causal relationships. On the other hand, given the genetic diversity of GADD45b and its association with LMBV resistance/susceptibility, selective breeding of individuals carrying resistance-associated genotypes could facilitate the development of a largemouth bass strain with enhanced resistance to LMBV, thereby mitigating the impact of viral disease in aquaculture. Additionally, it would be valuable to evaluate potential trade-offs in growth rate and reproductive performance in LMBV-resistant lines to ensure comprehensive breeding success.

4. Materials and Methods

4.1. Ethics Statement

All animal experiments were conducted in accordance with the ethical guidelines approved by the Pearl River Fisheries Research Institute’s Animal Ethics Committee (Approval No. LAEC-PRFRI-2024-02-01).

4.2. Experimental Animals and Virus

Juvenile largemouth bass (with a weight of about 5.33 g and a body length of about 6.10 cm) used in the study were collected from Foshan City, Guangdong Province, China. Prior to the experiment, all fish were maintained in a circulating aquaculture tank at 28 ± 0.5 °C with >6 mg/L dissolved oxygen, and fed commercial pellets (Yuequn, Jieyang, Guangdong, China) twice daily (2% body weight) for 14 days. Chinese perch brain (CPB) cell line sensitive to LMBV (strain 2007064) was established and maintained in our laboratory, cultured in L-15 medium (Gibco, Waltham, MA, USA) supplemented with 10% FBS at 28 °C [53]. LMBV was isolated and stored at −80 °C in our laboratory [26]. The virus was propagated in CPB cells at a temperature of 28 °C, and its titer was measured using the 50% tissue culture infectious dose (TCID50) assay.

4.3. LMBV Infection and Sample Collection

To verify the association between the polymorphism of the GADD45b gene in largemouth bass and LMBV resistance/susceptibility, we selected 240 fish infected with the virus as the study subjects. Largemouth bass that survived for more than 14 days after viral challenge were considered resistant individuals, while those that died within 14 days along with typical LMBV symptoms (e.g., body darkening, significant spleen/liver enlargement) were deemed susceptible [30]. For fish that succumbed to infection, caudal-fin tissue samples were collected immediately upon death and subjected to gross pathological examination, while survivors were sampled 14 days post-infection. In order to study dynamic gene expression profiles of different genotypes, 420 largemouth bass were used for virus infection experiments. For viral infection, the fish were anesthetized with MS-222 (Sigma, Burbank, CA, USA) before intraperitoneal injection. 400 individuals in the experimental group were injected intraperitoneally with 100 µL LMBV (3.98 × 105 TCID50/mL), suspended in PBS. 20 individuals in the control group were injected with PBS. Approximate 0.1 g liver tissue and caudal fin tissue were collected immediately at 0, 24, 48, and 72 h post-LMBV infection. For the genotype-survival correlation analysis, 296 fish were intraperitoneally injected with 100 µL LMBV (107 TCID50/mL) and the survival time of each fish after virus infection was recorded. In the genotype-survival correlation analysis experiment, all individuals exhibited 100% mortality under high-titer viral challenge. Approximate 0.1 g caudal fin tissue were collected for genotyping.

4.4. DNA/RNA Extraction and qRT-PCR Analysis

According to the manufacturer’s instructions, the genomic DNA was isolated by using the magnetic bead-based genomic DNA extraction kit (BayBio, Guangzhou, China) and the RNA was isolated by using the Animal Total RNA Isolation Kit (Foregene, Chengdu, China). The concentration and quality of the DNA/RNA were assessed using the microplate reader (BioTek, Shoreline, WA, USA). RNA quality was assessed via agarose gel electrophoresis. 1 μg of total RNA from each sample was used for cDNA synthesis using TransScript® Uni All-in-One First-Strand cDNA Synthesis SuperMix for qPCR kit (TransGen Biotech, Beijing, China). qPCR was performed under standard conditions (95 °C for 1 min, followed by 40 cycles of 95 °C for 5 s, 60 °C for 30 s) using SYBR Green (Accurate, Changsha, China). The Applied Biosystems® QuantStudio 6 platform (Thermo Fisher Scientific, Waltham, MA, USA) was employed for qRT-PCR analysis. 18S rRNA were utilized as internal reference genes for normalization and the expression levels were calculated using the 2−ΔΔCt method. Primer sequences are provided in Table 3. The primer validation is shown in Figure S1.

4.5. Genotyping SNPs in the GADD45b Gene with KASP

Kompetitive allele specific PCR (KASP) method is used to genotype SNPs in GADD45b gene. As shown in Table 3, KASP primers were designed for the two SNP loci (SNP38943374 C>A and SNP38943495 G>A) in GADD45b. The detailed information of these two SNP loci is presented in Table 4. For every SNP locus, the KASP primers included three sequences: a pair of allele-specific forward primers, one labeled with FAM and the other with HEX, along with a single common reverse primer (Table 3). The genotyping analysis was conducted using the KASP assay on the Applied Biosystems® QuantStudio 6 platform (Thermo Fisher Scientific, USA).

4.6. Association Analysis Between GADD45b SNPs and Resistance/Susceptibility to LMBV

We analyzed the genotyping results to calculate the genotype and allele frequencies for each SNP loci. The chi-square test (χ2 test) was used to evaluate genotype polymorphism and explore the association between GADD45b and LMBV resistance/susceptibility in largemouth bass. Statistical analysis was conducted using the chi-square test in SPSS 27.0.1 (Statistical Program for Social Science, SPSS Inc., Chicago, IL, USA). Additionally, we conducted linkage disequilibrium (LD) analysis and Hardy–Weinberg equilibrium (HWE) of SNP loci using HaploView 4.2 software. The extent of linkage disequilibrium between loci is determined by r2. When r2 > 0.33, it indicates a strong linkage relationship between loci [6].

4.7. Statistical Analysis

GraphPad Prism 10.1 (GraphPad Software, Inc., San Diego, CA, USA) was employed for statistical analysis of the data. Gene expression data are represented as mean ± standard error of the mean (SEM). We applied a one-way ANOVA to test for significant differences between the groups. * p < 0.05, ** p < 0.01.

5. Conclusions

In summary, we investigated the association between two SNP loci (SNP38943374 C>A and SNP38943495 G>A) in the GADD45b gene and the resistance or susceptibility of largemouth bass to LMBV. Individuals with the CC genotype of SNP38943374 and the GG genotype of SNP38943495 were more prevalent in resistant groups and have advantages in survival time after LMBV infection. These findings provide candidate markers for selective breeding of resistant largemouth bass against LMBV.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms26199281/s1.

Author Contributions

P.L.: Methodology, Investigation, and Writing—Original draft. X.L.: Conceptualization, Investigation, Methodology and Supervision. W.L.: Investigation, Validation. X.F.: Investigation and Methodology. Q.L.: Methodology and Resources. Y.N.: Resources and Validation. H.L.: Methodology and Software. B.M.: Validation and Software. W.X.: Methodology and Software. N.L.: Conceptualization and Writing-Reviewing and Editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Special-funds Project for Rural Revitalization Strategy of Guangdong Province (2022SPY00003), the Key Research and Development Program of Guangzhou City (2024B03J1263) and the Central Public-interest Scientific Institution Basal Research Fund, CAFS (NO. 2023XT048).

Institutional Review Board Statement

The study was approved by the Ethics Committee for Laboratory Animals of the Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences, with the ethics approval number LAEC-PRFRI-2024-02-01 (approved on 5 February 2024).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Rasal, K.D.; Chakrapani, V.; Pandey, A.K.; Rasal, A.R.; Sundaray, J.K.; Ninawe, A.; Jayasankar, P. Status and future perspectives of single nucleotide polymorphisms (SNPs) markers in farmed fishes: Way ahead using next generation sequencing. Gene Rep. 2017, 6, 81–86. [Google Scholar] [CrossRef]
  2. Jiang, D.L.; Gu, X.H.; Li, B.J.; Zhu, Z.X.; Qin, H.; Meng, Z.; Lin, H.R.; Xia, J.H. Identifying a long QTL cluster across chrLG18 associated with salt tolerance in tilapia using GWAS and QTL-Seq. Mar. Biotechnol. 2019, 21, 250–261. [Google Scholar] [CrossRef]
  3. Jin, Y.; Zhou, T.; Geng, X.; Liu, S.; Chen, A.; Yao, J.; Jiang, C.; Tan, S.; Su, B.; Liu, Z. A Genome-wide association study of heat stress-associated SNPs in catfish. Anim. Genet. 2017, 48, 233–236. [Google Scholar] [CrossRef]
  4. San, L.-Z.; Liu, B.-S.; Liu, B.; Zhu, K.-C.; Guo, L.; Guo, H.-Y.; Zhang, N.; Jiang, S.-G.; Zhang, D.-C. Genome-wide association study reveals multiple novel SNPs and putative candidate genes associated with low oxygen tolerance in golden pompano Trachinotus ovatus (Linnaeus 1758). Aquaculture 2021, 544, 737098. [Google Scholar] [CrossRef]
  5. Hua, J.; Zhong, C.; Chen, W.; Fu, J.; Wang, J.; Wang, Q.; Zhu, G.; Li, Y.; Tao, Y.; Zhang, M.; et al. Single nucleotide polymorphism SNP19140160 A>C is a potential breeding locus for fast-growth largemouth bass (Micropterus salmoides). BMC Genom. 2024, 25, 64. [Google Scholar] [CrossRef] [PubMed]
  6. Jiang, L.-S.; Ruan, Z.-H.; Lu, Z.-Q.; Li, Y.-F.; Luo, Y.-Y.; Zhang, X.-Q.; Liu, W.-S. Novel SNPs in the 3′UTR region of GHRb gene associated with growth traits in striped catfish (Pangasianodon hypophthalmus), a valuable aquaculture species. Fishes 2022, 7, 230. [Google Scholar] [CrossRef]
  7. Özcan Gökçek, E.; Işık, R. Associations between genetic variants of the insulin-like growth factor I (IGF-I) gene and growth traits in European sea bass (Dicentrarchus labrax, L.). Fish Physiol. Biochem. 2020, 46, 1131–1138. [Google Scholar] [CrossRef]
  8. Tran, T.T.H.; Tran, H.S.; Le, B.T.N.; Van Nguyen, S.; Vu, H.-A.; Kim, O.T.P. Novel single nucleotide polymorphisms of insulin-like growth factor-binding protein 7 (IGFBP7) gene significantly associated with growth traits in striped catfish (Pangasianodon hypophthalmus Sauvage, 1878). Mol. Genet. Genom. 2023, 298, 883–893. [Google Scholar] [CrossRef]
  9. Cáceres, G.; López, M.E.; Cádiz, M.I.; Yoshida, G.M.; Jedlicki, A.; Palma-Véjares, R.; Travisany, D.; Díaz-Domínguez, D.; Maass, A.; Lhorente, J.P.; et al. Fine mapping using whole-genome sequencing confirms anti-müllerian hormone as a major gene for sex determination in farmed nile tilapia (Oreochromis niloticus L.). G3 Genes Genomes Genet. 2019, 9, 3213–3223. [Google Scholar] [CrossRef]
  10. Gabián, M.; Morán, P.; Fernández, A.I.; Villanueva, B.; Chtioui, A.; Kent, M.P.; Covelo-Soto, L.; Fernández, A.; Saura, M. Identification of genomic regions regulating sex determination in Atlantic salmon using high density SNP data. BMC Genom. 2019, 20, 764. [Google Scholar] [CrossRef]
  11. Jin, R.-M.; Huang, H.-Z.; Zhou, Y.; Wang, Y.-Y.; Fu, H.-C.; Li, Z.; Fu, X.-Z.; Li, N.-Q. Characterization of mandarin fish (Siniperca chuatsi) IL-6 and IL-6 signal transducer and the association between their SNPs and resistance to ISKNV disease. Fish Shellfish Immunol. 2021, 113, 139–147. [Google Scholar] [CrossRef]
  12. Xu, T.; Chen, S.; Zhang, Y. MHC class IIα gene polymorphism and its association with resistance/susceptibility to Vibrio anguillarum in Japanese flounder (Paralichthys olivaceus). Dev. Comp. Immunol. 2010, 34, 1042–1050. [Google Scholar] [CrossRef]
  13. Xu, Y.; Liang, B.; Zhang, J.; Tang, B.; Su, J. Association study on single nucleotide polymorphisms in the Ctenopharyngodon idella TLR8b gene with resistance/susceptibility to grass carp reovirus. Aquaculture 2025, 599, 742124. [Google Scholar] [CrossRef]
  14. Ju, S.; Zhu, Y.; Liu, L.; Dai, S.; Li, C.; Chen, E.; He, Y.; Zhang, X.; Lu, B. Gadd45b and Gadd45g are important for anti-tumor immune responses. Eur. J. Immunol. 2009, 39, 3010–3018. [Google Scholar] [CrossRef]
  15. Tamura, R.E.; de Vasconcellos, J.F.; Sarkar, D.; Fisher, P.B.; Zerbini, L.F. GADD45 Proteins: Central Players in Tumorigenesis. Curr. Mol. Med. 2012, 12, 634–651. [Google Scholar] [CrossRef] [PubMed]
  16. Balliet, A.G.; Hatton, K.S.; Hoffman, B.; Liebermann, D.A. Comparative analysis of the genetic structure and chromosomal location of the murine MyD118 (GADD45b) gene. DNA Cell Biol. 2001, 20, 239–247. [Google Scholar] [CrossRef] [PubMed]
  17. Imbeault, M.; Giguère, K.; Ouellet, M.; Tremblay, M.J. Exon level transcriptomic profiling of HIV-1-infected CD4+ T cells reveals virus-induced genes and host environment favorable for viral replication. PLoS Pathog. 2012, 8, e1002861. [Google Scholar] [CrossRef] [PubMed]
  18. Liang, Z.; Liu, R.; Zhang, H.; Zhang, S.; Hu, X.; Tan, J.; Liang, C.; Qiao, W. GADD45 proteins inhibit HIV-1 replication through specific suppression of HIV-1 transcription. Virology 2016, 493, 1–11. [Google Scholar] [CrossRef]
  19. Liao, Z.; Zhang, X.; Song, C.; Lin, W.; Cheng, Y.; Xie, Z.; Chen, S.; Nie, Y.; Li, A.; Zhang, H.; et al. ALV-J inhibits autophagy through the GADD45β/MEKK4/P38MAPK signaling pathway and mediates apoptosis following autophagy. Cell Death Dis. 2020, 11, 684. [Google Scholar] [CrossRef]
  20. Deng, K.; Fan, Y.; Liang, Y.; Cai, Y.; Zhang, G.; Deng, M.; Wang, Z.; Lu, J.; Shi, J.; Wang, F.; et al. FTO-mediated demethylation of GADD45B promotes myogenesis through the activation of P38 MAPK pathway. Mol. Ther. Nucleic Acids 2021, 26, 34–48. [Google Scholar] [CrossRef]
  21. Keil, E.; Höcker, R.; Schuster, M.; Essmann, F.; Ueffing, N.; Hoffman, B.; Liebermann, D.A.; Pfeffer, K.; Schulze-Osthoff, K.; Schmitz, I. Phosphorylation of Atg5 by the Gadd45β–MEKK4-P38 pathway inhibits autophagy. Cell Death Differ. 2013, 20, 321–332. [Google Scholar] [CrossRef] [PubMed]
  22. Xue, M.; Sun, H.; Xu, R.; Wang, Y.; Guo, J.; Li, X.; Cheng, Y.; Xu, C.; Tang, C.; Sun, B.; et al. GADD45B promotes glucose-induced renal tubular epithelial-mesenchymal transition and apoptosis via the P38 MAPK and JNK signaling pathways. Front. Physiol. 2020, 11, 1074. [Google Scholar] [CrossRef] [PubMed]
  23. Salerno, D.M.; Tront, J.S.; Hoffman, B.; Liebermann, D.A. Gadd45a and Gadd45b modulate innate immune functions of granulocytes and macrophages by differential regulation of P38 and JNK Signaling. J. Cell. Physiol. 2012, 227, 3613–3620. [Google Scholar] [CrossRef] [PubMed]
  24. Ueda, T.; Kohama, Y.; Kuge, A.; Kido, E.; Sakurai, H. GADD45 family proteins suppress JNK signaling by targeting MKK7. Arch. Biochem. Biophys. 2017, 635, 1–7. [Google Scholar] [CrossRef]
  25. Lu, B.; Ferrandino, A.F.; Flavell, R.A. Gadd45β is important for perpetuating cognate and inflammatory signals in T cells. Nat. Immunol. 2004, 5, 38–44. [Google Scholar] [CrossRef]
  26. Luo, X.; Wang, R.; Ma, B.; Chang, O.; Fu, X.; Liang, H.; Niu, Y.; Lin, Q.; Liu, L.; Lv, A.; et al. Inactivated LMBV vaccine with nano-aluminum adjuvant provided immune protection in largemouth bass (Micropterus salmoides). Aquaculture 2025, 595, 741634. [Google Scholar] [CrossRef]
  27. Zhao, R.; Geng, Y.; Qin, Z.; Wang, K.; Ouyang, P.; Chen, D.; Huang, X.; Zuo, Z.; He, C.; Guo, H.; et al. A New ranavirus of the santee-cooper group invades largemouth bass (Micropterus salmoides) culture in southwest China. Aquaculture 2020, 526, 735363. [Google Scholar] [CrossRef]
  28. Niu, Y.; Fu, X.; Lin, Q.; Liang, H.; Luo, X.; Zuo, S.; Liu, L.; Li, N. In vivo and in vitro, antiviral effects of two mixture of Chinese herbal drug active monomers against MSRV and LMBV in Largemouth bass (Micropterus salmoides). Aquaculture 2023, 577, 739977. [Google Scholar] [CrossRef]
  29. Yi, W.; Zhang, X.; Zeng, K.; Xie, D.; Song, C.; Tam, K.; Liu, Z.; Zhou, T.; Li, W. Construction of a DNA vaccine and its protective effect on largemouth bass (Micropterus salmoides) challenged with largemouth bass virus (LMBV). Fish Shellfish Immunol. 2020, 106, 103–109. [Google Scholar] [CrossRef]
  30. Li, P.; Luo, X.; Zuo, S.; Fu, X.; Lin, Q.; Niu, Y.; Liang, H.; Ma, B.; Li, N. Genome-wide association study of resistance to largemouth bass ranavirus (LMBV) in Micropterus salmoides. IJMS 2024, 25, 10036. [Google Scholar] [CrossRef]
  31. Yue, G.H. Recent advances of genome mapping and marker-assisted selection in aquaculture. Fish Fish. 2014, 15, 376–396. [Google Scholar] [CrossRef]
  32. Zenger, K.R.; Khatkar, M.S.; Jones, D.B.; Khalilisamani, N.; Jerry, D.R.; Raadsma, H.W. Genomic selection in aquaculture: Application, limitations and opportunities with special reference to marine shrimp and pearl oysters. Front. Genet. 2019, 9, 693. [Google Scholar] [CrossRef]
  33. Sawayama, E.; Kitamura, S.-I.; Nakayama, K.; Ohta, K.; Okamoto, H.; Ozaki, A.; Takagi, M. Development of a novel RSIVD-resistant strain of red sea bream (Pagrus major) by marker-assisted selection combined with DNA-based family selection. Aquaculture 2019, 506, 188–192. [Google Scholar] [CrossRef]
  34. Fuji, K.; Hasegawa, O.; Honda, K.; Kumasaka, K.; Sakamoto, T.; Okamoto, N. Marker-assisted breeding of a lymphocystis disease-resistant Japanese flounder (Paralichthys olivaceus). Aquaculture 2007, 272, 291–295. [Google Scholar] [CrossRef]
  35. Lu, S.; Li, Y.Z.; Wang, L.; Liu, Y.; Cheng, X.M.; Zhou, Q.; Yang, Y.M.; Zheng, W.W.; Chen, S.L. Application of genomic selection in the breeding of new variety of Chinese tongue sole (Cynoglossus semilaevis) “Tayou No. 1” . J. Fish. China 2022, 46, 1305–1312. (In Chinese) [Google Scholar] [CrossRef]
  36. You, X.; Shan, X.; Shi, Q. Research advances in the genomics and applications for molecular breeding of aquaculture animals. Aquaculture 2020, 526, 735357. [Google Scholar] [CrossRef]
  37. Cao, Z.; Liu, X.; Xiang, Y.; Wang, L.; Sun, Y.; Zhou, Y. Genetic polymorphism of MHC class IIα alleles and its association with resistance/susceptibility to viral nervous necrosis virus (VNNV) in golden pompano (Trachinotus ovatus). Aquaculture 2019, 501, 144–152. [Google Scholar] [CrossRef]
  38. Lee, H.B.; Schwab, T.L.; Koleilat, A.; Ata, H.; Daby, C.L.; Cervera, R.L.; McNulty, M.S.; Bostwick, H.S.; Clark, K.J. Allele-specific quantitative PCR for accurate, rapid, and cost-effective genotyping. Hum. Gene Ther. 2016, 27, 425–435. [Google Scholar] [CrossRef]
  39. Vossen, R.H.A.M. Genotyping DNA variants with high-resolution melting analysis. In Genotyping: Methods and Protocols; White, S.J., Cantsilieris, S., Eds.; Springer: New York, NY, USA, 2017; pp. 17–28. ISBN 978-1-4939-6442-0. [Google Scholar]
  40. Yu, S.; Li, X.; Liu, X.; Wang, Y.; Yu, F.; Xue, Y.; Mao, Z.; Wang, C.; Li, W. Characteristic and influencing factors of taqman genotyping calling error. Clin. Lab. Anal. 2018, 32, e22613. [Google Scholar] [CrossRef]
  41. Majeed, U.; Darwish, E.; Rehman, S.U.; Zhang, X. Kompetitive allele specific PCR (KASP): A singleplex genotyping platform and its application. JAS 2018, 11, 11. [Google Scholar] [CrossRef]
  42. Zhu, Z.X.; Lin, Y.L.; Qin, H.; Xiong, Y.Y.; Jiang, D.L.; Lin, H.R.; Yu, Z.L.; Xia, J.H. Identifying a Genome-Wide QTL interval controlling for ammonia-nitrogen tolerance on chrLG1 of nile tilapia. Aquaculture 2021, 543, 736946. [Google Scholar] [CrossRef]
  43. Bartonicek, N.; Clark, M.B.; Quek, X.C.; Torpy, J.R.; Pritchard, A.L.; Maag, J.L.V.; Gloss, B.S.; Crawford, J.; Taft, R.J.; Hayward, N.K.; et al. Intergenic disease-associated regions are abundant in novel transcripts. Genome Biol. 2017, 18, 241. [Google Scholar] [CrossRef] [PubMed]
  44. Maurano, M.T.; Humbert, R.; Rynes, E.; Thurman, R.E.; Haugen, E.; Wang, H.; Reynolds, A.P.; Sandstrom, R.; Qu, H.; Brody, J.; et al. Systematic localization of common disease-associated variation in regulatory DNA. Science 2012, 337, 1190–1195. [Google Scholar] [CrossRef] [PubMed]
  45. Ye, N.; Rao, S.; Du, T.; Hu, H.; Liu, Z.; Shen, Y.; Xu, Q. Intergenic variants may predispose to major depression disorder through regulation of long non-coding RNA expression. Gene 2017, 601, 21–26. [Google Scholar] [CrossRef]
  46. Baloch, A.A.; Abdelsalam, E.E.E.; Piačková, V. Cytokines studied in carp (Cyprinus carpio L.) in response to important diseases. Fishes 2022, 7, 3. [Google Scholar] [CrossRef]
  47. Ding, G.; Zheng, C.; Wang, B.; Zhang, L.; Deng, D.; Li, Q.; Guo, H.; Zhang, S.; Xu, Q. Transcriptome sequencing reveals the antiviral innate immunity by IFN-γ in Chinese sturgeon macrophages. Front. Immunol. 2022, 13, 854689. [Google Scholar] [CrossRef]
  48. Kalaichelvan, A.; Nadarajapillai, K.; Sellaththurai, S.R.; Arachchi, U.P.E.; Kim, M.-J.; Jung, S.; Lee, J. CRISPR/Cas9-induced knockout of tumor necrosis factor-alpha-type I augments viral infection in zebrafish. Fish. Shellfish Immunol. 2025, 157, 110092. [Google Scholar] [CrossRef]
  49. Yang, S.; Ma, Y.; Lou, X.; Zhou, Z.; Zhang, H.; Yi, S.; Cheng, Y.; Qian, S.; Huang, M.; Fei, H. The role of TNF-α in the phagocytosis of largemouth bass (Micropterus salmoides) leukocytes. Fish. Shellfish Immunol. 2023, 132, 108488. [Google Scholar] [CrossRef]
  50. De Smaele, E.; Zazzeroni, F.; Papa, S.; Nguyen, D.U.; Jin, R.; Jones, J.; Cong, R.; Franzoso, G. Induction of Gadd45β by NF-κB downregulates pro-apoptotic JNK signaling. Nature 2001, 414, 308–313. [Google Scholar] [CrossRef]
  51. Grayfer, L.; Hodgkinson, J.W.; Hitchen, S.J.; Belosevic, M. Characterization and functional analysis of goldfish (Carassius auratus L.) interleukin-10. Mol. Immunol. 2011, 48, 563–571. [Google Scholar] [CrossRef]
  52. Huo, H.J.; Chen, S.N.; Li, L.; Nie, P. Functional characterization of IL-10 and its receptor subunits in a perciform fish, the mandarin fish, Siniperca chuatsi. Dev. Comp. Immunol. 2019, 97, 64–75. [Google Scholar] [CrossRef]
  53. Fu, X.; Li, N.; Lai, Y.; Luo, X.; Wang, Y.; Shi, C.; Huang, Z.; Wu, S.; Su, J. A novel fish cell line derived from the brain of Chinese perch Siniperca chuatsi: Development and characterization. J. Fish Biol. 2015, 86, 32–45. [Google Scholar] [CrossRef]
Figure 1. Genetic variations in GADD45b and KASP genotyping. (A) The genomic structure and positions of SNPs in GADD45b gene. The SNP loci associated with resistance/susceptibility to LMBV were markerd. (B) KASP analysis results for GADD45b genetic variants. Homozygous is indicated by blue and red dots, and heterozygous is shown with green dots.
Figure 1. Genetic variations in GADD45b and KASP genotyping. (A) The genomic structure and positions of SNPs in GADD45b gene. The SNP loci associated with resistance/susceptibility to LMBV were markerd. (B) KASP analysis results for GADD45b genetic variants. Homozygous is indicated by blue and red dots, and heterozygous is shown with green dots.
Ijms 26 09281 g001
Figure 2. Distribution of genotype and allele frequencies at the two GADD45b SNPs across resistant and susceptible groups. (A) Genotype frequency of SNP38943374 C>A and SNP38943495 G>A. (B) Allele frequency of SNP38943374 C>A and SNP38943495 G>A.
Figure 2. Distribution of genotype and allele frequencies at the two GADD45b SNPs across resistant and susceptible groups. (A) Genotype frequency of SNP38943374 C>A and SNP38943495 G>A. (B) Allele frequency of SNP38943374 C>A and SNP38943495 G>A.
Ijms 26 09281 g002
Figure 3. Kaplan–Meier survival analysis of individuals with different genotypes following LMBV challenge. (A) In SNP38943374, the number of individuals with the CC genotype is 71, those with the AC genotype is 151, and those with the AA genotype is 74. (B) In SNP38943495, the number of individuals with the GG genotype is 71, those with the AG genotype is 151, and those with the AA genotype is 74. p value was calculated by the log-rank (Mantel–Cox) test.
Figure 3. Kaplan–Meier survival analysis of individuals with different genotypes following LMBV challenge. (A) In SNP38943374, the number of individuals with the CC genotype is 71, those with the AC genotype is 151, and those with the AA genotype is 74. (B) In SNP38943495, the number of individuals with the GG genotype is 71, those with the AG genotype is 151, and those with the AA genotype is 74. p value was calculated by the log-rank (Mantel–Cox) test.
Ijms 26 09281 g003
Figure 4. Linkage disequilibrium and haplotype analysis of two SNPs in the GADD45b. (A) The values inside the squares indicate the LD values (r2) of the two SNPs. The number within each square indicates the r2 value multiplied by 100. (B) Haplotype frequency distribution of GADD45b gene.
Figure 4. Linkage disequilibrium and haplotype analysis of two SNPs in the GADD45b. (A) The values inside the squares indicate the LD values (r2) of the two SNPs. The number within each square indicates the r2 value multiplied by 100. (B) Haplotype frequency distribution of GADD45b gene.
Ijms 26 09281 g004
Figure 5. Dynamics expression of GADD45b in different genotypes following LMBV infection. The figure shows GADD45b expression levels post-viral infection across genotypes: CC (equivalent to GG in SNP38943495), AC (equivalent to AG in SNP38943495), and AA (same in both SNPs) of SNP38943374. The data are presented as mean ± SEM (N = 8). * p < 0.05.
Figure 5. Dynamics expression of GADD45b in different genotypes following LMBV infection. The figure shows GADD45b expression levels post-viral infection across genotypes: CC (equivalent to GG in SNP38943495), AC (equivalent to AG in SNP38943495), and AA (same in both SNPs) of SNP38943374. The data are presented as mean ± SEM (N = 8). * p < 0.05.
Ijms 26 09281 g005
Figure 6. Dynamics expression of IFN-γ, TNF-α and IL-10 in different genotypes after LMBV infection. qRT-PCR was performed to analyze the expression levels of IFN-γ (A), TNF-α (B) and IL-10 (C). CC group: individuals with the genotype of SNP38943374, as well as individuals with the GG genotype of SNP38943495. AC group: individuals with the genotype of SNP38943374, as well as individuals with the AG genotype of SNP38943495. AA group: individuals with the genotype of SNP38943374, as well as individuals with the AA genotype of SNP38943495. The data are presented as mean ± SEM (N = 8). * p < 0.05.
Figure 6. Dynamics expression of IFN-γ, TNF-α and IL-10 in different genotypes after LMBV infection. qRT-PCR was performed to analyze the expression levels of IFN-γ (A), TNF-α (B) and IL-10 (C). CC group: individuals with the genotype of SNP38943374, as well as individuals with the GG genotype of SNP38943495. AC group: individuals with the genotype of SNP38943374, as well as individuals with the AG genotype of SNP38943495. AA group: individuals with the genotype of SNP38943374, as well as individuals with the AA genotype of SNP38943495. The data are presented as mean ± SEM (N = 8). * p < 0.05.
Ijms 26 09281 g006
Table 1. The genotype frequency distribution of GADD45b gene polymorphisms in resistant and susceptible groups.
Table 1. The genotype frequency distribution of GADD45b gene polymorphisms in resistant and susceptible groups.
LocusGenotypeResistant Groups
No. (%)
Susceptible Groups
No. (%)
χ2
(p)
SNP38943374 C>ACC91 (0.771)37 (0.303)56.655
(p < 0.01)
AC24 (0.203)56 (0.459)
AA3 (0.025)29 (0.238)
SNP38943495 G>AGG90 (0.763)37 (0.303)55.809
(p < 0.01)
AG26 (0.220)58 (0.475)
AA2 (0.017)27 (0.221)
Table 2. The allele frequency distribution of GADD45b gene polymorphisms in resistant and susceptible groups.
Table 2. The allele frequency distribution of GADD45b gene polymorphisms in resistant and susceptible groups.
LocusAlleleResistant Groups
No. (%)
Susceptible Groups
No. (%)
χ2
(p)
SNP38943374 C>AC206 (0.873)130 (0.533)66.075
(p < 0.01)
A30 (0.127)114 (0.467)
SNP38943495 G>AG206 (0.873)132 (0.541)63.438
(p < 0.01)
A30 (0.127)112 (0.459)
Table 3. The primers of this study.
Table 3. The primers of this study.
PrimerSequence (5′-3′)
SNP38943374-F1GAAGGTGACCAAGTTCATGCTGATGATGAGGTGCCAGGGTGGAGGC
SNP38943374-F2GAAGGTCGGAGTCAACGGATTGATGATGAGGTGCCAGGGTGGAGGA
SNP38943374-RGAAGGCTGTAACTGCTGAGCGGAAGTGTT
SNP38943495-F1GAAGGTGACCAAGTTCATGCTACATTAAAATATCACATGACATAAG
SNP38943495-F2GAAGGTCGGAGTCAACGGATTACATTAAAATATCACATGACATAAA
SNP38943495-RTTTCAGCTCTGGTTTGGTTGTAAGAGTAT
GADD45b-RT-FCTTTCTGCTGCGACAACGAC
GADD45b-RT-RGAGGGTTCGTGACCAGGATG
IFN-γ-RT-FTGCAGGCTCTCAAACACATC
IFN-γ-RT-RTGTTTTCGGTCAGTGTGCTC
TNF-α-RT-F ATCTGCTGTGAATGCCGTGA
TNF-α-RT-RCGTCAGCCTGGATAGACGAC
IL-10-RT-FCTAGACCAGAGCGTCGAGGA
IL-10-RT-RCCAAGGCTGTTGGCAGAATC
18s-RT-FTGACGGAAGGGCACCACCAG
18s-RT-RGCACCACCACCCACAGAATCG
Table 4. The information of two SNP loci in the GADD45b gene.
Table 4. The information of two SNP loci in the GADD45b gene.
SNPChromosomeLocusRefAltRegion
SNP38943374 C>ANW_024044237.138943374CAIntergenic
SNP38943495 G>A38943495GAIntergenic
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, P.; Luo, X.; Li, W.; Fu, X.; Lin, Q.; Niu, Y.; Liang, H.; Ma, B.; Xiao, W.; Li, N. Intergenic Variants Upstream of GADD45b Affect Survival of Micropterus salmoides Following LMBV Exposure. Int. J. Mol. Sci. 2025, 26, 9281. https://doi.org/10.3390/ijms26199281

AMA Style

Li P, Luo X, Li W, Fu X, Lin Q, Niu Y, Liang H, Ma B, Xiao W, Li N. Intergenic Variants Upstream of GADD45b Affect Survival of Micropterus salmoides Following LMBV Exposure. International Journal of Molecular Sciences. 2025; 26(19):9281. https://doi.org/10.3390/ijms26199281

Chicago/Turabian Style

Li, Pinhong, Xia Luo, Wenxian Li, Xiaozhe Fu, Qiang Lin, Yinjie Niu, Hongru Liang, Baofu Ma, Wenwen Xiao, and Ningqiu Li. 2025. "Intergenic Variants Upstream of GADD45b Affect Survival of Micropterus salmoides Following LMBV Exposure" International Journal of Molecular Sciences 26, no. 19: 9281. https://doi.org/10.3390/ijms26199281

APA Style

Li, P., Luo, X., Li, W., Fu, X., Lin, Q., Niu, Y., Liang, H., Ma, B., Xiao, W., & Li, N. (2025). Intergenic Variants Upstream of GADD45b Affect Survival of Micropterus salmoides Following LMBV Exposure. International Journal of Molecular Sciences, 26(19), 9281. https://doi.org/10.3390/ijms26199281

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop