A CsWRKY48 Gene from Tea Plants Intercropped with Chinese Chestnut Plays an Important Role in Resistance to Biotic and Abiotic Stresses
Abstract
1. Introduction
2. Results
2.1. qPCR Analysis of WRKY48 Transcription Factors
2.2. Gene Cloning and Sequence Analysis
2.3. Genetic Transformation in Tobacco and Screening of Transgenic Tobacco Lines
2.4. Phenotype Observation of the CsWRKY48 Transgenic Lines
2.5. Phenotypic Analysis of Transgenic Tobacco After Low-Temperature Treatment and Aphid Feeding
2.6. Cold Resistance Analysis of CsWRKY48 Overexpressing Tobacco Plants
2.7. Insect Resistance Analysis of CsWRKY48-Overexpressing Tobacco Plants
2.8. CsWRKY48 TF Promoter Analysis
3. Materials and Methods
3.1. Plant Materials
3.2. Plant Growth Conditions
3.3. Expression of WRKY48 Under Low Temperatures, Different Plant Growth Regulators, PEG, and NaCl
3.4. The CsWRKY48 Gene Cloning
3.5. The CsWRKY48 Gene Promoter Cloning and Sequence Analysis
3.6. Over Expression Vector Construction, Plant Transformation of CsWRKY48, and Identification of Transgenic Lines
3.7. Observations on the Phenotype of Transgenic Tobacco
3.8. Low-Temperature Stress in Transgenic Tobacco
3.9. Aphid Feeding Stress in Transgenic Tobacco
3.10. Determination of Physiological and Biochemical Indices of Transgenic Tobacco
3.11. Expression Analysis of Stress-Related Genes in Transgenic Tobacco
3.12. Statistical Analysis and Graphing of Data
4. Discussion
4.1. Effects of Trichomes on Plant Stress Resistance
4.2. Regulation of CsWRKY48 Gene by Hormone Crosstalks
4.3. CsWRKY48 Enhancement of Cold and Insect Resistance in Plants via NtCBF1, NtDREB2B, NtChiA, NtTD, etc.
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chen, C.; Yu, W.; Xu, X.; Wang, Y.; Wang, B.; Xu, S.; Lan, Q.; Wang, Y. Research advancements in salt tolerance of cucurbitaceae: From salt response to molecular mechanisms. Int. J. Mol. Sci. 2024, 25, 9051. [Google Scholar] [CrossRef] [PubMed]
- Waadt, R.; Seller, C.A.; Hsu, P.K.; Takahashi, Y.; Munemasa, S.; Schroeder, J.I. Plant hormone regulation of abiotic stress responses. Nat. Rev. Mol. Cell Biol. 2022, 23, 680–694. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Ye, T.; Guo, Z.; Yao, Y.; Tu, H.; Wang, P.; Zhang, Y.; Wang, Y.; Li, X.; Li, B.; et al. A double-stranded RNA binding protein enhances drought resistance via protein phase separation in rice. Nat. Commun. 2024, 15, 2514. [Google Scholar] [CrossRef] [PubMed]
- Han, D.; Du, M.; Zhou, Z.; Wang, S.; Li, T.; Han, J.; Xu, T. An NAC transcription factor gene from Malus baccata, MbNAC29, increases cold and high salinity tolerance in Arabidopsis. Vitr. Cell. Dev. Biol.—Plant 2020, 56, 588–599. [Google Scholar] [CrossRef]
- Wang, Y.; He, W.; Wang, L.; Lan, Y.X.; Wu, M. TCP transcription factor identification in pecan (Carya illinoensis) and salt tolerance function analysis of CiTCP8. Sci. Hortic. 2024, 13, 2568. [Google Scholar] [CrossRef]
- Javed, T.; Gao, S.J. WRKY transcription factors in plant defense. Trends Genet. 2023, 39, 787–801. [Google Scholar] [CrossRef] [PubMed]
- Qing, L.D.; Yi, T.; Xue, M.Z. Overexpression of the transcription factor MdWRKY115 improves drought and osmotic stress tolerance by directly binding to the MdRD22 promoter in apple. Hortic. Plant J. 2024, 10, 629–640. [Google Scholar]
- Jiang, J.; Ma, S.; Ye, N. WRKY transcription factors in plant responses to stresses. J. Integr. Plant Biol. 2017, 59, 86–101. [Google Scholar] [CrossRef]
- Li, H.L.; Zhang, L.B.; Guo, D.; Li, C.Z.; Peng, S.Q. Identification and expression profiles of the WRKY transcription factor family in Ricinus communis. Gene 2012, 503, 48–53. [Google Scholar] [CrossRef]
- Zhang, M.; Zhao, R.; Huang, K.; Huang, S.; Wang, H.; Wei, Z.; Li, Z.; Bian, M.; Jiang, W.; Wu, T.; et al. The OsWRKY63-OsWRKY76-OsDREB1B module regulates chilling tolerance in rice. Plant J. 2022, 112, 383–398. [Google Scholar] [CrossRef]
- Li, Y.; Li, X.; Wei, J.; Cai, K.; Zhang, H.; Ge, L.; Ren, Z.; Zhao, C.; Zhao, X. Genome-wide identification and analysis of the WRKY gene family and cold stress response in Acer truncatum. Genes 2021, 12, 1867. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Liang, X.; Cai, W.; Wang, H.; Liu, X.; Cheng, L.; Song, P.; Luo, G.; Han, D. Isolation and functional analysis of VvWRKY28, a Vitis vinifera WRKY transcription factor gene, with functions in tolerance to cold and salt stress in transgenic Arabidopsis thaliana. Int. J. Mol. Sci. 2022, 23, 13418. [Google Scholar] [CrossRef] [PubMed]
- Poosapati, S.; Poretsky, E.; Dressano, K.; Ruiz, M.; Vazquez, A.; Sandoval, E.; Estrada-Cardenas, A.; Duggal, S.; Lim, J.H.; Morris, G.; et al. A sorghum genome-wide association study (GWAS) identifies a WRKY transcription factor as a candidate gene underlying sugarcane aphid (Melanaphis sacchari) resistance. Planta 2022, 255, 37. [Google Scholar] [CrossRef]
- Li, P.; Song, A.; Gao, C.; Jiang, J.; Chen, S.; Fang, W.; Zhang, F.; Chen, F. The over-expression of a chrysanthemum WRKY transcription factor enhances aphid resistance. Plant Physiol. Biochem. 2015, 95, 26–34. [Google Scholar] [CrossRef]
- Pokharel, S.S.; Yu, H.; Fang, W.; Parajulee, M.N.; Chen, F. Intercropping cover crops for a vital ecosystem service: A review of the biocontrol of insect pests in tea agroecosystems. Plants 2023, 12, 2361. [Google Scholar] [CrossRef]
- Wen, B.; Zhang, X.; Ren, S. Characteristics of soil nutrients, heavy metals and tea quality in different intercropping patterns. Agrofor. Syst. 2020, 94, 963–974. [Google Scholar] [CrossRef]
- Hong, Y.; Heerink, N.; Jin, S.; Berentsen, P.; Zhang, L.; Werf, W.V. Intercropping and agroforestry in China—Current state and trends. Agric. Ecosyst. Environ. 2017, 244, 52–61. [Google Scholar] [CrossRef]
- Wang, L.; Dossa, K.; You, J.; Zhang, Y.; Li, D.; Zhou, R.; Yu, J.; Wei, X.; Zhu, X.; Jiang, S.; et al. High-resolution temporal transcriptome sequencing unravels ERF and WRKY as the master players in the regulatory networks underlying sesame responses to waterlogging and recovery. Genomics 2021, 113, 276–290. [Google Scholar] [CrossRef] [PubMed]
- Wu, T.; Jiang, Y.; Li, M.; Pu, D.; Shi, M.; Lan, Z.Q. RNA-seq analysis reveals the potential mechanism of improved viability and product quality of tea plants through intercropping with Chinese chestnut. Plant Growth Regul. 2022, 96, 177–193. [Google Scholar] [CrossRef]
- Zhang, J.; He, X.; Zhou, J.; Dong, Z.; Yu, H.; Tang, Q.; Yuan, L.; Peng, S.; Zhong, X.; He, Y. Selection and verification of standardized reference genes of Angelica dahurica under various abiotic stresses by real-time quantitative PCR. Genes 2024, 15, 79. [Google Scholar] [CrossRef]
- Song, J.; Wu, H.; He, F.; Qu, J.; Wang, Y.; Li, C.; Liu, J.H. Citrus sinensis CBF1 functions in cold tolerance by modulating Putrescine Biosynthesis through regulation of Arginine Decarboxylase. Plant Cell Physiol. 2022, 63, 19–29. [Google Scholar] [CrossRef] [PubMed]
- Li, X.Y.; Wang, Y.; Dai, Y.; He, Y.; Li, C.X.; Mao, P.; Ma, X.R. The transcription factors of tall fescue in response to temperature stress. Plant Biol. 2021, 23 (Suppl. S1), 89–99. [Google Scholar] [CrossRef] [PubMed]
- Vaghela, B.; Vashi, R.; Rajput, K.; Joshi, R. Plant chitinases and their role in plant defense: A comprehensive review. Enzym. Microb. Technol. 2022, 159, 110055. [Google Scholar] [CrossRef]
- Schäfer, M.; Meza-Canales, I.D.; Navarro-Quezada, A.; Brütting, C.; Vanková, R.; Baldwin, I.T.; Meldau, S. Cytokinin levels and signaling respond to wounding and the perception of herbivore elicitors in Nicotiana attenuata. J. Integr. Plant Biol. 2015, 57, 198–212. [Google Scholar] [CrossRef]
- Xie, L.; Yan, T.; Li, L.; Chen, M.; Ma, Y.; Hao, X.; Fu, X.; Shen, Q.; Huang, Y.; Qin, W.; et al. The WRKY transcription factor AaGSW2 promotes glandular trichome initiation in Artemisia annua. J. Exp. Bot. 2021, 72, 1691–1701. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; van Herwijnen, Z.O.; Dräger, D.B.; Sui, C.; Haring, M.A.; Schuurink, R.C. SlMYC1 regulates type VI glandular trichome formation and terpene biosynthesis in tomato glandular cells. Plant Cell 2018, 30, 2988–3005. [Google Scholar] [CrossRef]
- Hua, B.; Chang, J.; Wu, M.; Xu, Z.; Zhang, F.; Yang, M.; Xu, H.; Wang, L.J.; Chen, X.Y.; Wu, S. Mediation of JA signalling in glandular trichomes by the woolly/SlMYC1 regulatory module improves pest resistance in tomato. Plant Biotechnol. J. 2021, 19, 375–393. [Google Scholar] [CrossRef]
- Zhao, Q.; Xiang, X.; Liu, D.; Yang, A.; Wang, Y. Tobacco transcription factor NtbHLH123 confers tolerance to cold stress by regulating the NtCBF Pathway and reactive oxygen species homeostasis. Front. Plant Sci. 2018, 9, 381. [Google Scholar] [CrossRef]
- Yang, D.; Liu, Y.; Cheng, H.; Wang, Q.; Lv, L.; Zhang, Y.; Song, G.; Zuo, D. Identification of the group III WRKY subfamily and the functional analysis of GhWRKY53 in Gossypium hirsutum L. Plants 2021, 10, 1235. [Google Scholar] [CrossRef] [PubMed]
- Spyropoulou, E.A.; Haring, M.A.; Schuurink, R.C. RNA sequencing on Solanum lycopersicum trichomes identifies transcription factors that activate terpene synthase promoters. BMC Genet. 2014, 15, 402. [Google Scholar] [CrossRef]
- Fan, C.; Yao, H.; Qiu, Z.; Ma, H.; Zeng, B. Genome-wide analysis of Eucalyptus grandis WRKY genes family and their expression profiling in response to hormone and abiotic stress treatment. Gene 2018, 678, 38–48. [Google Scholar] [CrossRef]
- Liu, S.; Zhang, C.; Guo, F.; Sun, Q.; Yu, J.; Dong, T.; Wang, X.; Song, W.; Li, Z.; Meng, X.; et al. A systematical genome-wide analysis and screening of WRKY transcription factor family engaged in abiotic stress response in sweetpotato. BMC Plant Biol. 2022, 22, 616. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Li, G.; Wang, R.; Wang, G.; Wan, Y. Genome-wide analysis of WRKY transcription factors involved in abiotic stress and ABA response in Caragana korshinskii. Int. J. Mol. Sci. 2023, 24, 9519. [Google Scholar] [CrossRef]
- Goyal, P.; Manzoor, M.M.; Vishwakarma, R.A.; Sharma, D.; Dhar, M.K.; Gupta, S. A comprehensive transcriptome-wide identification and screening of WRKY gene family engaged in abiotic stress in Glycyrrhiza glabra. Sci. Rep. 2020, 10, 373. [Google Scholar] [CrossRef]
- Jan, R.; Asaf, S.; Lubna Asif, S.; Kim, E.G.; Jang, Y.H.; Kim, N.; Al-Harrasi, A.; Lee, G.S.; Kim, K.M. Enhancing the expression of the OsF3H gene in Oryza sativa leads to the regulation of multiple biosynthetic pathways and transcriptomic changes that influence insect resistance. Int. J. Mol. Sci. 2022, 23, 15308. [Google Scholar] [CrossRef]
- Tang, Y.; Guo, J.; Zhang, T.; Bai, S.; He, K.; Wang, Z. Genome-wide analysis of WRKY gene family and the synamic responses of key WRKY genes involved in Ostrinia furnacalis attack in Zea mays. Int. J. Mol. Sci. 2021, 22, 13045. [Google Scholar] [CrossRef] [PubMed]
- Yu, X.; Pan, Y.; Dong, Y.; Lu, B.; Zhang, C.; Yang, M.; Zuo, L. Cloning and overexpression of PeWRKY31 from Populus × euramericana enhances salt and biological tolerance in transgenic Nicotiana. BMC Plant Biol. 2021, 21, 80. [Google Scholar] [CrossRef]
- Wang, Y.; Dong, B.; Wang, N.; Zheng, Z.; Yang, L.; Zhong, S.; Fang, Q.; Xiao, Z.; Zhao, H. A WRKY transcription factor PmWRKY57 from Prunus mume improves cold tolerance in Arabidopsis thaliana. Mol. Biotechnol. 2023, 65, 1359–1368. [Google Scholar] [CrossRef] [PubMed]
- Luo, D.L.; Ba, L.J.; Shan, W.; Kuang, J.F.; Lu, W.J.; Chen, J.Y. Involvement of WRKY transcription factors in Abscisic-Acid-Induced cold tolerance of banana fruit. J. Agric. Food Chem. 2017, 65, 3627–3635. [Google Scholar] [CrossRef]
- Zhang, Y.; He, J.; Xiao, Y.; Zhang, Y.; Liu, Y.; Wan, S.; Liu, L.; Dong, Y.; Liu, H.; Yu, Y. CsGSTU8, a Glutathione S-transferase from Camellia sinensis, is regulated by CsWRKY48 and plays a positive role in drought tolerance. Front. Plant Sci. 2021, 12, 795919. [Google Scholar] [CrossRef]
Primer Name | GenBank No. | Sequence |
---|---|---|
NtEF1α-F | NM001326165 [20] | TGGTTGTGACTTTTGGTCCCA |
NtEF1α-R | ACAAACCCACGCTTGAGATCC | |
NtCBF1-F | NP001312156 [21] | GGATGAGGAGACGCTATTCTG |
NtCBF1-R | TGTGAACACTGAGGTGGAGG | |
NtDREB2B-F | EU727156 [22] | CGGCCGCCCATCTGAGTC |
NtDREB2B-R | AGGTGGAGGCAGCATTAGTC | |
NtChiA-F | P08252.2 [23] | GGCCTTGTGGAAGAGCCATA |
NtChiA-R | CCAAATCCAGGGAGGCGATT | |
NtTD-F | AAG59585.1 [24] | ACATGGGTCAAGTTAGGCGG |
NtTD-R | TATAGGGGTGGCAAATGGGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, J.; Gong, Y.; Li, M.; Bai, Y.; Wu, T. A CsWRKY48 Gene from Tea Plants Intercropped with Chinese Chestnut Plays an Important Role in Resistance to Biotic and Abiotic Stresses. Int. J. Mol. Sci. 2024, 25, 13526. https://doi.org/10.3390/ijms252413526
Wang J, Gong Y, Li M, Bai Y, Wu T. A CsWRKY48 Gene from Tea Plants Intercropped with Chinese Chestnut Plays an Important Role in Resistance to Biotic and Abiotic Stresses. International Journal of Molecular Sciences. 2024; 25(24):13526. https://doi.org/10.3390/ijms252413526
Chicago/Turabian StyleWang, Jianzhao, Yikai Gong, Meng Li, Yan Bai, and Tian Wu. 2024. "A CsWRKY48 Gene from Tea Plants Intercropped with Chinese Chestnut Plays an Important Role in Resistance to Biotic and Abiotic Stresses" International Journal of Molecular Sciences 25, no. 24: 13526. https://doi.org/10.3390/ijms252413526
APA StyleWang, J., Gong, Y., Li, M., Bai, Y., & Wu, T. (2024). A CsWRKY48 Gene from Tea Plants Intercropped with Chinese Chestnut Plays an Important Role in Resistance to Biotic and Abiotic Stresses. International Journal of Molecular Sciences, 25(24), 13526. https://doi.org/10.3390/ijms252413526