Frequencies of an IFNL4 Variant in an Admixed Population from Amazonia and Its Influence on Hepatitis C Infection
Abstract
1. Introduction
2. Results
2.1. Populational Description
2.2. Genetic Characterization
2.3. Genetic Correlation with Fibrosis
2.4. Populational Genetics
3. Discussion
4. Materials and Methods
4.1. Study Population
4.2. Laboratory Tests
4.3. Histopathologic Exam
4.4. Molecular Analysis
4.5. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Prokunina-Olsson, L.; Muchmore, B.; Tang, W.; Pfeiffer, R.M.; Park, H.; Dickensheets, H.; Hergott, D.; Porter-Gill, P.; Mumy, A.; Kohaar, I.; et al. A Variant Upstream of IFNL3 (IL28B) Creating a New Interferon Gene IFNL4 Is Associated with Impaired Clearance of Hepatitis C Virus. Nat. Genet. 2013, 45, 164–171. [Google Scholar] [CrossRef] [PubMed]
- Bruening, J.; Weigel, B.; Gerold, G. The Role of Type III Interferons in Hepatitis C Virus Infection and Therapy. J. Immunol. Res. 2017, 2017, 7232361. [Google Scholar] [CrossRef] [PubMed]
- Eslam, M.; Ahlenstiel, G.; George, J. Interferon Lambda and Liver Fibrosis. J. Interferon Cytokine Res. 2019, 39, 627–635. [Google Scholar] [CrossRef]
- Chevaliez, S.; Hézode, C. IL28B Polymorphisms and Chronic Hepatitis C. Gastroenterol. Clin. Biol. 2010, 34, 587–589. [Google Scholar] [CrossRef] [PubMed]
- Zaki, S.M.; Ahmed, H.S.; Yousif, M.M.; Awad, E.M. Interleukin 28B Polymorphism as a Predictor of Sustained Virological Response to Sofosbuvir-Based Therapy for Hepatitis C Virus Patients. Trop. Med. Infect. Dis. 2022, 7, 230. [Google Scholar] [CrossRef]
- O’Brien, T.R.; Jackson, S.S. What Have We Learned from Studies of IFN-λ Variants and Hepatitis C Virus Infection? J. Interferon Cytokine Res. 2019, 39, 618–626. [Google Scholar] [CrossRef]
- Park, H.; O’Brien, T.R.; Rehermann, B. The Role of Genetics in Hepatic Fibrosis among Hepatitis C Virus Patients. Hepatology 2018, 67, 2043–2045. [Google Scholar] [CrossRef]
- Fang, M.Z.; Jackson, S.S.; O’Brien, T.R. IFNL4: Notable Variants and Associated Phenotypes. Gene 2020, 730, 144289. [Google Scholar] [CrossRef]
- Vergara, C.; Thio, C.L.; Johnson, E.; Kral, A.H.; O’Brien, T.R.; Goedert, J.J.; Mangia, A.; Piazzolla, V.; Mehta, S.H.; Kirk, G.D.; et al. Multi-Ancestry Genome-Wide Association Study of Spontaneous Clearance of Hepatitis C Virus. Gastroenterology 2019, 156, 1496–1507.e7. [Google Scholar] [CrossRef]
- Amaral, I.d.S.A. A Influência Dos Polimorfismos Nos Genes Interferons Lambda 3 Lambda 4 e Ancestralidade Genética Na Infecção Crônica Pelo Vírus Da Hepatite c e Na Resposta Ao Tratamento Em Uma População Miscigenada de Belém-Pará-Brasil. Ph.D. Thesis, Universidade Federal do Pará, Belém, Brazil, 2015. [Google Scholar]
- Ruiz, I.; Fourati, S.; Ahmed-Belkacem, A.; Rodriguez, C.; Scoazec, G.; Donati, F.; Soulier, A.; Demontant, V.; Poiteau, L.; N’Debi, M.; et al. Real-World Efficacy and Safety of Direct-Acting Antiviral Drugs in Patients with Chronic Hepatitis C and Inherited Blood Disorders. Eur. J. Gastroenterol. Hepatol. 2021, 33, e191–e196. [Google Scholar] [CrossRef]
- Thorball, C.W.; Fellay, J.; Borghesi, A. Immunological Lessons from Genome-Wide Association Studies of Infections. Curr. Opin. Immunol. 2021, 72, 87–93. [Google Scholar] [CrossRef] [PubMed]
- Thomas, D.L.; Thio, C.L.; Martin, M.P.; Qi, Y.; Ge, D.; O’hUigin, C.; Kidd, J.; Kidd, K.; Khakoo, S.I.; Alexander, G.; et al. Genetic Variation in IL28B and Spontaneous Clearance of Hepatitis C Virus. Nature 2009, 461, 798–801. [Google Scholar] [CrossRef]
- Wack, A.; Terczyńska-Dyla, E.; Hartmann, R. Guarding the Frontiers: The Biology of Type III Interferons. Nat. Immunol. 2015, 16, 802–809. [Google Scholar] [CrossRef] [PubMed]
- Onabajo, O.O.; Wang, F.; Lee, M.-H.; Florez-Vargas, O.; Obajemu, A.; Tanikawa, C.; Vargas, J.M.; Liao, S.-F.; Song, C.; Huang, Y.-H.; et al. Intracellular Accumulation of IFN-Λ4 Induces ER Stress and Results in Anti-Cirrhotic but Pro-HCV Effects. Front. Immunol. 2021, 12, 692263. [Google Scholar] [CrossRef] [PubMed]
- Møhlenberg, M.; O’Brien, T.R.; Hartmann, R. The Role of IFNL4 in Liver Inflammation and Progression of Fibrosis. Genes Immun. 2022, 23, 111–117. [Google Scholar] [CrossRef]
- Leung, J.; Peacock, A.; Colledge, S.; Grebely, J.; Cunningham, E.B.; Hickman, M.; Vickerman, P.; Stone, J.; Trickey, A.; Dumchev, K.; et al. A Global Meta-Analysis of the Prevalence of HIV, Hepatitis C Virus, and Hepatitis B Virus Among People Who Inject Drugs—Do Gender-Based Differences Vary by Country-Level Indicators? J. Infect. Dis. 2019, 220, 78–90. [Google Scholar] [CrossRef] [PubMed]
- Abdel-Gawad, M.; Nour, M.; El-Raey, F.; Nagdy, H.; Almansoury, Y.; El-Kassas, M. Gender Differences in Prevalence of Hepatitis C Virus Infection in Egypt: A Systematic Review and Meta-Analysis. Sci. Rep. 2023, 13, 2499. [Google Scholar] [CrossRef]
- Nastri, A.C.d.S.S.; de Mello Malta, F.; Diniz, M.A.; Yoshino, A.; Abe-Sandes, K.; dos Santos, S.E.B.; de Castro Lyra, A.; Carrilho, F.J.; Pinho, J.R.R. Association of IFNL3 and IFNL4 Polymorphisms with Hepatitis C Virus Infection in a Population from Southeastern Brazil. Arch. Virol. 2016, 161, 1477–1484. [Google Scholar] [CrossRef]
- Oh, R.C.; Hustead, T.R.; Ali, S.M.; Pantsari, M.W. Mildly Elevated Liver Transaminase Levels: Causes and Evaluation. Am. Fam. Physician 2017, 96, 709–715. [Google Scholar] [PubMed]
- Mohamed, M.F.; Wadhavkar, N.; Elfanagely, Y.; Marino, D.; Beran, A.; Abdallah, M.; Promrat, K. Etiologies and Outcomes of Transaminase Elevation > 1000 IU/L: A Systematic Review and Meta-Analysis. Dig. Dis. Sci. 2023, 68, 2843–2852. [Google Scholar] [CrossRef]
- Mohammad, Y.A.; Mohammed, A.; Muath, S. Cytokine Polymorphisms and Genotypic Susceptibility of HCV Infection in Ribavirin Response to Peg Interferon. Trop. Biomed. 2023, 40, 331–336. [Google Scholar] [CrossRef]
- Abd Alla, M.D.A.; Dawood, R.M.; Rashed, H.A.E.-H.; El-Dessouky, Y.M.; AbuFarrag, G.A.; Ammar, I.A.E.; Mahmoud, M.M.A.-H.; Salum, G.M.; Abu-Amer, M.Z.; Sekeen, M.A.; et al. HCV Treatment Outcome Depends on SNPs of IFNL3-Gene Polymorphisms (Rs12979860) and Cirrhotic Changes in Liver Parenchyma. Heliyon 2023, 9, e21194. [Google Scholar] [CrossRef]
- Da Silva, A.M.V. Influência Dos Polimorfismos Nos Genes IFNL3 e IFNL4 Na Resposta Virologica Sustentada e Na Produção de Citocinas Em Pacientes Brasileiros Com Hepatite c Crônica Tratados Com Alfapeginterferona. Ph.D. Thesis, Instituto Oswaldo Cruz, Rio de Janeiro, Brazil, 2018. [Google Scholar]
- Magri, M.C.; Manchiero, C.; Prata, T.V.G.; Nunes, A.K.d.S.; de Oliveira Junior, J.S.; Dantas, B.P.; Tengan, F.M. The Influence of Gene-Chronic Hepatitis C Virus Infection on Hepatic Fibrosis and Steatosis. Diagn. Microbiol. Infect. Dis. 2020, 97, 115025. [Google Scholar] [CrossRef]
- Conde, S.R.S.d.S.; Monteiro, J.C.M.S.; dos Santos, B.T.S.; Filgueiras, N.K.F.; Lins, P.A.d.A.; Freitas, F.B.; Graça, E.d.S.; Demachki, S.; de Araújo, M.T.F.; Ishak, R.; et al. SNP Rs8099917 in Gene IL28B Might Be Associated with Risk of Chronic Infection by HCV but Not with Response to Treatment. Biomed. Res. Int. 2014, 2014, 748606. [Google Scholar] [CrossRef][Green Version]
- Cavalcante, L.N.; Abe-Sandes, K.; Angelo, A.L.D.; Machado, T.M.B.; Lemaire, D.C.; Mendes, C.M.C.; Pinho, J.R.; Malta, F.; Lyra, L.G.C.; Lyra, A.C. IL28B Polymorphisms Are Markers of Therapy Response and Are Influenced by Genetic Ancestry in Chronic Hepatitis C Patients from an Admixed Population. Liver Int. 2012, 32, 476–486. [Google Scholar] [CrossRef] [PubMed]
- da Costa e Silva, Á.M.; Aires, R.S.; da Silva, S.M.; de Matos, M.A.D.; Carneiro, M.A.d.S.; Lopes, C.L.R.; Teles, S.A.; Martins, R.M.B. Association between the IL28B rs12979860 polymorphism and therapy response in patients infected with genotype 1 of hepatitis c virus in central Brazil. Rev. Patol. Trop. 2016, 45, 152–160. [Google Scholar] [CrossRef][Green Version]
- Pena, S.D.J.; Santos, F.R.; Tarazona-Santos, E. Genetic Admixture in Brazil. Am. J. Med. Genet. C Semin. Med. Genet. 2020, 184, 928–938. [Google Scholar] [CrossRef] [PubMed]
- Escher, L.M.; Naslavsky, M.S.; Scliar, M.O.; Duarte, Y.A.O.; Zatz, M.; Nunes, K.; Oliveira, S.F. Challenges in Selecting Admixture Models and Marker Sets to Infer Genetic Ancestry in a Brazilian Admixed Population. Sci. Rep. 2022, 12, 21240. [Google Scholar] [CrossRef]
- Santos, N.P.C.; Ribeiro-Rodrigues, E.M.; Ribeiro-dos-Santos, Â.K.C.; Pereira, R.; Gusmão, L.; Amorim, A.; Guerreiro, J.F.; Zago, M.A.; Matte, C.; Hutz, M.H.; et al. Assessing Individual Interethnic Admixture and Population Substructure Using a 48-Insertion-Deletion (INSEL) Ancestry-Informative Marker (AIM) Panel. Hum. Mutat. 2010, 31, 184–190. [Google Scholar] [CrossRef]
- Pena, S.D.J.; Di Pietro, G.; Fuchshuber-Moraes, M.; Genro, J.P.; Hutz, M.H.; Kehdy, F.d.S.G.; Kohlrausch, F.; Magno, L.A.V.; Montenegro, R.C.; Moraes, M.O.; et al. The Genomic Ancestry of Individuals from Different Geographical Regions of Brazil Is More Uniform Than Expected. PLoS ONE 2011, 6, e17063. [Google Scholar] [CrossRef]
- Conde, S.R.S.d.S.; Rocha, L.L.; Ferreira, V.M.; Monteiro, J.C.M.S.; Filgueiras, N.K.F.; Lins, P.A.D.A.; Dos Santos, B.T.S.; Freitas, F.B.; Graça, E.D.S.; Demachki, S.; et al. Absence of Correlation between IL-28B Gene Polymorphisms and the Clinical Presentation of Chronic Hepatitis B in an Amazon Brazilian Population. Dis. Markers 2014, 2014, 534534. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Eslam, M.; McLeod, D.; Kelaeng, K.S.; Mangia, A.; Berg, T.; Thabet, K.; Irving, W.L.; Dore, G.J.; Sheridan, D.; Grønbæk, H.; et al. IFN-Λ3, Not IFN-Λ4, Likely Mediates IFNL3–IFNL4 Haplotype–Dependent Hepatic Inflammation and Fibrosis. Nat. Genet. 2017, 49, 795–800. [Google Scholar] [CrossRef] [PubMed]
- Bibert, S.; Roger, T.; Calandra, T.; Bochud, M.; Cerny, A.; Semmo, N.; Duong, F.H.T.; Gerlach, T.; Malinverni, R.; Moradpour, D.; et al. IL28B Expression Depends on a Novel TT/-G Polymorphism Which Improves HCV Clearance Prediction. J. Exp. Med. 2013, 210, 1109–1116. [Google Scholar] [CrossRef]
- Bedossa, P.; Poynard, T. An Algorithm for the Grading of Activity in Chronic Hepatitis C. Hepatology 1996, 24, 289–293. [Google Scholar] [CrossRef]


| Variables | Total n = 106 | No Fibrosis n = 57 | Fibrosis n = 49 | p | 
|---|---|---|---|---|
| Sex (male/female) | 57/49 | 32/25 | 25/24 | 0.598 a | 
| Age (years) | 56 (25–85) | 56 (25–80) | 56 (31–85) | 0.279 a | 
| HCV genotype (1/3) | 37/14 | 12/9 | 25/5 | 0.039 a | 
| Viral Load (IU/mL) | 4.1 × 105 (1.7 × 105–4.2 × 107) | 4.8 × 105 (1.7 × 101–4.2 × 107) | 3.7 × 105 (5.6 × 103–4.2 × 106) | 0.881 b | 
| AST (U/L) | 55.5 (17–351) | 45 (17–182) | 65 (19–351) | 0.012 b | 
| ALT (U/L) | 58.5 (13–322) | 51 (20–212) | 70 (13–322) | 0.051 b | 
| GGT (U/L) | 62 (12–984) | 69 (17–984) | 59.5 (12–244) | 0.794 b | 
| FA (U/L) | 146 (2.72–661) | 183.9 (2.72–661) | 113.5 (35–336) | 1 b | 
| ALB (g/dL) | 4.3 (2.9–6.5) | 4.4 (3.1–5.1) | 4.2 (2.9–6.5) | 0.949 b | 
| SNP | Genotypes | HCV Group n = 106 (%) | Control Group n = 85 (%) | OR (95% CI) | p | 
|---|---|---|---|---|---|
| rs12979860 | CC | 3 (3) | 32 (38) | 2.291 (1.09–4.83) | 0.033 | 
| CT | 74 (70) | 41 (48) | |||
| TT | 29 (27) | 12 (14) | |||
| Alleles | C * | 80 (38) | 105 (62) | 0.001 | |
| T | 132 (62) | 65 (38) | |||
| Total | 212 (100) | 170 (100) | |||
| HWE | <0.0001 | 0.981 | 
| rs12979860 | No Fibrosis n = 57 (%) | Fibrosis n = 49 (%) | p | Fibrosis F0–F2 n = 22 (%) | Fibrosis F3–F4 n = 27 (%) | p | 
|---|---|---|---|---|---|---|
| CC | 2 (3) | 1 (2) | 0 (0) | 1 (4) | ||
| CT | 41 (72) | 33 (67) | 0.802 | 17 (77) | 19 (70) | 1 | 
| TT | 14 (25) | 15 (31) | 5 (23) | 7 (26) | ||
| C * | 45 (39) | 35 (44) | 0.551 | 17 (39) | 21 (39) | 0.980 | 
| T | 69 (61) | 45 (56) | 27 (61) | 33 (61) | 
| p | Adjusted p | |
|---|---|---|
| AFR vs. HCB | 0.8848 | 0.8848 | 
| AMR vs. HCB | 0.0011 | 0.0018 | 
| EAS vs. HCB | <0.0001 | <0.0001 | 
| EUR vs. HCB | <0.0001 | <0.0001 | 
| SAS vs. HCB | <0.0001 | <0.0001 | 
| Score | Histological Activity | Stage | Fibrosis | 
|---|---|---|---|
| A0 | Absent | F0 | No fibrosis | 
| A1 | Mild | F1 | Portal fibrosis without septa | 
| A2 | Moderate | F2 | Portal fibrosis with few septa | 
| A3 | Severe | F3 | Numerous septa. No nodules | 
| F4 | Complete nodules: cirrhosis | 
| Probe ID | Fluorescence | Sequence 5′-3′ | 
|---|---|---|
| rs12979860 | VIC | TGAACCAGGGAGCTCCCCGAAGGCGCGAACCAGGGTTGAATTGCACTCCGC | 
| FAM | TGAACCAGGGAGCTCCCCGAAGGCGTGAACCAGGGTTGAATTGCACTCCGC | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Angelim, C.C.; Andrade, Á.A.F.; de Sousa, R.S.; Correa, R.L.; Sacramento, A.R.V.; Martins, L.D.; Conde, S.R.S.d.S.; Vallinoto, A.C.R.; Feitosa, R.N.M.; Costa, G.d.L.C. Frequencies of an IFNL4 Variant in an Admixed Population from Amazonia and Its Influence on Hepatitis C Infection. Int. J. Mol. Sci. 2024, 25, 12764. https://doi.org/10.3390/ijms252312764
Angelim CC, Andrade ÁAF, de Sousa RS, Correa RL, Sacramento ARV, Martins LD, Conde SRSdS, Vallinoto ACR, Feitosa RNM, Costa GdLC. Frequencies of an IFNL4 Variant in an Admixed Population from Amazonia and Its Influence on Hepatitis C Infection. International Journal of Molecular Sciences. 2024; 25(23):12764. https://doi.org/10.3390/ijms252312764
Chicago/Turabian StyleAngelim, Carolina Cabral, Álesson Adam Fonseca Andrade, Renata Santos de Sousa, Raissa Lima Correa, Amanda Roberta Vieira Sacramento, Letícia Dias Martins, Simone Regina Souza da Silva Conde, Antonio Carlos Rosário Vallinoto, Rosimar Neris Martins Feitosa, and Greice de Lemos Cardoso Costa. 2024. "Frequencies of an IFNL4 Variant in an Admixed Population from Amazonia and Its Influence on Hepatitis C Infection" International Journal of Molecular Sciences 25, no. 23: 12764. https://doi.org/10.3390/ijms252312764
APA StyleAngelim, C. C., Andrade, Á. A. F., de Sousa, R. S., Correa, R. L., Sacramento, A. R. V., Martins, L. D., Conde, S. R. S. d. S., Vallinoto, A. C. R., Feitosa, R. N. M., & Costa, G. d. L. C. (2024). Frequencies of an IFNL4 Variant in an Admixed Population from Amazonia and Its Influence on Hepatitis C Infection. International Journal of Molecular Sciences, 25(23), 12764. https://doi.org/10.3390/ijms252312764
 
        



 
       