Spectrum and Prevalence of Rare APOE Variants and Their Association with Familial Dysbetalipoproteinemia
Abstract
:1. Introduction
2. Results
2.1. Identification and Clinical Interpretation of Rare APOE Variants
2.2. APOE Genotypes in Carriers of Rare APOE Variants
2.3. Prevalence of Rare APOE Variants
2.4. Carriage of Multiple Rare Variants
2.5. Clinical Features Depending on APOE Variants’ Pathogenicity
3. Discussion
3.1. Causality Between Rare APOE Variants and Autosomal Dominant FD
3.2. Carries of Multiple Rare Variants
3.3. Prevalence of Pathogenic or Likely Pathogenic APOE Variants Associated with Autosomal Dominant FD
3.4. Clinical Features in Carriers of Causal Variants for Autosomal Dominant FD
4. Materials and Methods
4.1. Sampling
4.2. Clinical and Biochemical Data
4.3. Genetic Analysis
4.3.1. DNA Extraction
4.3.2. Sequencing
4.3.3. Bioinformatic Analysis and Clinical Interpretation
4.4. Polygenic Risk Score
4.5. Prevalence of Rare APOE Variants Associated with Autosomal Dominant FD
4.6. Ethical Statement
4.7. Statistical Analysis
4.8. Limitations
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A
Variant No. | Variant | Genomic Coordinates (GRCh37) | Reference Allele | Alternative Allele | Variant Type | HGVSc | HGVSp | Total AF, gnomAD v2.1.1, % | CADD v1.7 | ACMG Criteria | ACMG Class | No. of Probands, Total (ESSE-Ivanovo/FH/RPS) | Previously Reported Phenotype | Ref. |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | rs1212454788 | chr19:45411071 | G | A | M | c.98G>A | p.Arg33His | 0.0008005 | 0.004 | PM2, BP4 | VUS | 1 (0/1/0) | FH | [70] |
2 | rs769452 | chr19:45411110 | T | C | M | c.137T>C | p.Leu46Pro | 0.2521 | 8.993 | BS1, BP4 | LB | 34 (15/6/13) | FH, HCH, FCHL | [6,40] |
3 | rs762461580 | chr19:45411122 | G | A | M | c.149G>A | p.Arg50His | 0.001595 | 22.9 | PM2, PP3 | VUS | 1 (1/0/0) | NR | NR |
4 | rs1969839083 | chr19:45411157-45411160 | TCTG | — | F | c.184_187del | p.Glu63Argfs Ter15 | NR | 32.0 | PVS1, PM2, PP3 | P | 1 (0/0/1) | FD | [10] |
5 | rs11083750 | chr19:45411858 | C | G | M | c.305C>G | p.Pro102Arg | 0.002841 | 24.0 | PM2, PP3 | VUS | 1 (0/1/0) | HCH | [29] |
6 | rs543363163 | chr19:45411965 | G | A | M | c.412G>A | p.Gly138Ser | 0 | 5.886 | PM2, BP4 | VUS | 1 (1/0/0) | NR | NR |
7 | rs267606664 | chr19:45411987 | G | A | M | c.434G>A | p.Gly145Asp | 0.01532 | 24.9 | PM1, PP3, BS1, | VUS | 11 (1/1/9) | FD | [29,35] |
8 | Not registered | chr19:45411987-45412014 | GCCAGAGCACCGAGGAGCTGCGGGTGCG | — | F | c.434_461del | p.Gly145Alafs Ter97 | NR | 35.0 | PVS1, PM2, PP3 | P | 1 (1/0/0) | FD | [10] |
9 | rs121918393 | chr19:45412013 | C | T | M | c.460C>T | p.Arg154Cys | 0.008979 | 28.4 | PM1, PM2, PM5, PP3, BP6 | LP | 10 (3/1/6) | FD, HCH, HTG | [5,45,46] |
10 | Not registered | chr19:45412042 | T | — | F | c.489del | p.Lys164Serfs Ter87 | NR | 32.0 | PVS1, PM2, PP3 | P | 1 (1/0/0) | NR | NR |
11 | rs2122137937 | chr19:45412101 | G | C | M | c.548G>C | p.Gly183Ala | NR | 23.0 | PM2, PP3 | VUS | 4 (0/0/4) | FD | ClinVar report |
12 | rs981058595 | chr19:45412104 | C | T | M | c.551C>T | p.Ala184Val | NR | 15.57 | PM2 | VUS | 1 (0/0/1) | NR | NR |
13 | Not registered | chr19:45412152 | G | C | M | c.599G>C | p.Gly200Ala | NR | 8.8 | PM2, BP4 | VUS | 1 (0/0/1) | NR | NR |
14 | Not registered | chr19:45412152 | G | A | M | c.599G>A | p.Gly200Glu | NR | 7.788 | PM2, BP4 | VUS | 1 (1/0/0) | NR | NR |
15 | Not registered | chr19:45412154 | C | T | M | c.601C>T | p.Pro201Ser | NR | 16.64 | PM2 | VUS | 2 * (0/0/2) | NR | NR |
16 | Not registered | chr19:45412175 | G | T | M | c.622G>T | p.Val208Leu | NR | 0.007 | PM2, BP4 | VUS | 1 (1/0/0) | NR | NR |
17 | rs567353589 | chr19:45412241 | G | A | M | c.688G>A | p.Glu230Lys | 0.001551 | 16.13 | PM2, PS3 | LP | 1 (0/0/1) | FCHL | [29,71] |
18 | rs199768005 | chr19:45412314 | T | A | M | c.761T>A | p.Val254Glu | 0.04515 | 23.9 | PP3, BS1, BS4 | B | 6 (3/1/2) | FD, HTG | [10,31,72] |
19 | rs140808909 | chr19:45412337 | G | A | M | c.784G>A | p.Glu262Lys | 0.01985 | 23.0 | PP3, BS1 | VUS | 1 (0/0/1) | FD, HCH, HTG | [29,73,74,75,76] |
20 | rs190853081 | chr19:45412340 | G | A | M | c.787G>A | p.Glu263Lys | 0.01967 | 24.0 | PP3, BS1 | VUS | 1 * (0/0/1) | FD, HCH, HTG | [29,73,74,75,76] |
21 | rs267606661 | chr19:45412358 | C | G | M | c.805C>G | p.Arg269Gly | 0.03605 | 22.8 | PP3, BS1, BS4 | B | 4 (0/1/3) | FD, HCH | [31,72] |
22 | Not registered | chr19:45412365 | A | C | M | c.812A>C | p.Gln271Pro | NR | 24.1 | PM2, PP3 | VUS | 1 (1/0/0) | NR | NR |
23 | rs770562611 | chr19:45412473 | C | T | M | c.920C>T | p.Thr307Ile | 0.0004557 | 11.92 | PM2 | VUS | 1 (0/0/1) | NR | NR |
24 | rs28931579 | chr19:45412493 | A | C | M | c.940A>C | p.Ser314Arg | 0.009104 | 8.179 | PM2, BP4 | VUS | 2 (0/1/1) | HTG | [72] |
Common Name | Variants Forming a Genotype | Genomic Coordinates (GRCh37) | Reference Allele | Alternative Allele | Variant Type | HGVSc | HGVSp | Total AF, gnomAD v2.1.1, % | No. of Probands | Previously Reported Phenotype | Ref. |
---|---|---|---|---|---|---|---|---|---|---|---|
Apoε4-Freiberg | rs769452 | chr19:45411110 | T | C | missense | c.137T>C | p.Leu46Pro | 0.2521% | 3 | HLP, Alzheimer disease | [37,50] |
rs429358 | chr19:45411941 | T | C | missense | c.388T>C | p.Cys130Arg | 14.25% | ||||
ε2ε1 | rs267606664 | chr19:45411987 | G | A | missense | c.434G>A | p.Gly145Asp | 0.01532 | 3 | FD | [32,33,34,35,36] |
rs7412 | chr19:45412079 | C | T | missense | c.526C>T | p.Arg176Cys | 6.542 |
Carrier No. | Variant 1, Gene Variant Zygosity | Variant 2, Gene Variant Zygosity | Variant 3, Gene Variant Zygosity | APOE Genotype | TG PRS, Percentile | Sex | Age, Years | BMI, kg/m2 | Diabetes | Hypothyroidism | CHD | TC, mmol/L | LDL-C, mmol/L | HDL-C, mmol/L | TG, mmol/L |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | APOE: p.Leu46Pro het | APOE: p.Pro201Ser het | - | ε4ε4 | 90 | M | 50 | 26.5 | no | no | no | 6.50 | 3.51 | 1.05 | 4.22 |
2 | APOE: p.Glu262Lys het | APOE: p.Glu263Lys het | - | ε3ε3 | 6 | M | 32 | 41.0 | no | no | no | 4.54 | no data | no data | 2.06 |
3 | APOE: p.Gly200Ala het | APOE: p.Pro201Ser het | LMF1: p.Tyr439Cys homo | ε3ε3 | 22 | M | 31 | 25.8 | no | no | no | 16.16 | no data | 0.88 | 21.33 |
4 | APOE: p.Pro102Arg het | LDLR: p.Trp666Ter het | - | ε3ε3 | 28 | M | 25 | 27.8 | no | no | no | 9.31 | 8.25 | 0.87 | 1.64 |
5 | APOE: p.Arg33His het | LDLR: p.Gly592Glu het | - | ε3ε3 | <1 | M | 59 | 33.0 | no | no | yes | 10.29 | 8.47 | 0.97 | 1.67 |
6 | APOE: p.Gly145Asp het | LDLR: p.Gly592Glu het | - | ε2ε3 | 25 | F | 48 | 24.4 | no | yes | no | 9.83 | 6.82 | 2.07 | 1.11 |
7 | APOE: p.Ser314Arg het | LDLR: p.Glu140Asp het | - | ε3ε3 | 9 | F | 28 | 28.4 | no | no | no | 7.90 | 6.51 | 1.10 | 0.64 |
8 | APOE: p.Leu46Pro het | LDLR: p.Cys160Gly het | - | ε3ε4 | 90 | F | 58 | no data | no data | no data | no data | 14.86 | 12.91 | 1.30 | 1.47 |
9 | APOE: p.Leu46Pro het | LDLR: p.Cys329Tyr het | - | ε3ε3 | 21 | F | 54 | 35.5 | no | no | no | 9.22 | 7.44 | 1.29 | 1.08 |
10 | APOE: p.Arg154Cys het | LPL: p.Asp202Asn het | LPL: p.Tyr233Cys het | ε3ε3 | 67 | F | 42 | 18.0 | no | no | no | no data | no data | 0.20 | 26.28 |
11 | APOE: p.Leu46Pro het | GPIHPB1: p.Arg158Glyfs Ter148 het | - | ε3ε3 | <1 | F | 46 | 31.1 | no | no | no | 9.30 | 6.16 | 2.31 | 1.77 |
APOE Variant, HGVSp | APOE Genotype | No. of Probands * | TG PRS, Percentile | Sex/ Men, n (%) | Age, Years | BMI, kg/m2 | Diabetes, n (%) | Hypothyroidism, n (%) | CHD, n (%) | TC, mmol/L | LDL-C, mmol/L | HDL-C, mmol/L | TG, mmol/L | Carotid/Femoral Atherosclerosis, Xanthomas ** |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
p.Leu46Pro | ε3ε3 | 8 | 54 (41; 74) | 4 (50.0) | 53 (44; 63) | 24.5 (22.1; 26.3) | 2 (25.0) | 0 | 1 (12.5) | 6.95 (6.51; 7.37) | 4.09 (3.27; 4.54) | 1.35 (0.97; 1.60) | 2.92 (1.61; 4.24) | |
ε4ε4 Apoε4-Freiberg | 1 | 14 | M | 41 | 27.5 | no | no | no | 6.48 | 4.12 | 1.51 | 1.82 | ||
1 | 51 | M | 37 | 26.6 | no | no | no | 8.00 | - | 0.95 | 11.00 | Femoral atherosclerosis | ||
ε3ε4 | 16 | 66 (31; 93) n =15 | 4 (25.0) | 45 (40; 47) | 25.5 (23.4; 30.0) | 1 (6.3) | 3 (18.8) | 0 | 5.65 (5.26; 6.22) n =15 | 3.59 (2.88; 4.35) n =15 | 1.33 (1.25; 1.61) n =15 | 1.15 (0.97; 2.48) n =15 | ||
ε2ε4 | 4 | 66 (50; 69) | 1 (25.0) | 50 (42; 58) | 30.9 (29.1; 33.2) | 1 (25.0) | 0 | 0 | 5.58 (5.06; 6.08) | 3.15 (2.79; 3.41) | 1.50 (1.25; 1.68) | 2.24 (1.02; 3.61) | ||
Total | 30 | 60 (27; 80) n =29 | 9 (30.0) | 45 (41; 56) | 26.1 (23.5; 29.7) | 4 (13.3) | 3 (10.0) | 1 (3.3) | 6.14 (5.36; 6.83) n =29 | 3.80 (2.92; 4.33) n =28 | 1.33 (1.12; 1.66) n =29 | 1.89 (1.02; 3.23) n =29 | ||
p.Arg50His | ε3ε3 | 1 | 96 | M | 44 | 34.6 | no | no | no | 3.10 | 1.94 | 0.74 | 1.78 | |
p.Glu63Argfs Ter15 | ε2ε3 | 1 | 13 | F | 56 | 27.0 | no | no | no | 13.16 | - | 1.36 | 4.75 | Carotid and femoral atherosclerosis, tendon xanthomas |
p.Gly138Ser | ε3ε3 | 1 | 85 | F | 47 | 23.9 | no | no | no | 3.72 | 2.07 | 1.51 | 0.94 | |
p.Gly145Asp | ε2ε1 | 3 | 61 (31; 73) | 3 (100) | 40 (39; 47) | 28.4 (26.1; 30.2) | 1 (33.3) | 0 | 1 (33.3) | 16.03 n = 1 | 2.94 (2.30; 3.51) | 0.71 0.91 n = 2 | 9.87 (9.74; 11.16) | Carotid and femoral atherosclerosis, cutaneous eruptive and tendon xanthomas (n = 3) |
ε3ε3 | 3 | 79 (73; 89) | 0 | 51 (42; 61) | 32.5 (27.3; 37.8) | 1 (50.0) n = 2 | 1 (50.0) n = 2 | 1 (50.0) n = 2 | 4.20 3.95 n = 2 | 1.18 1.40 n = 2 | 5.78 2.06 n = 2 | 3.79 0.70 n = 2 | ||
ε2ε3 | 4 | 55 (38; 59) n = 3 | 1 (25.0) | 56 (47; 57) | 28.6 (26.0; 31.0) | 0 | 1 (25.0) | 1 (25.0) | 5.37 (4.46; 56.58) | 2.35 (1.63; 3.07) | 1.04 (0.87; 1.47) | 1.49 (1.31; 2.32) | ||
Total | 10 | 62 (55; 79) n = 9 | 4 (40.0) | 52 (39; 56) | 28.4 (25.0; 31.4) n = 9 | 2 (22.2) n = 9 | 2 (22.2) n = 9 | 3 (33.3) n = 9 | 4.94 (4.08; 6.23) n = 7 | 2.94 (1.66; 3.15) n = 9 | 1.05 (0.87; 1.25) n = 8 | 3.79 (1.36; 9.60) n = 9 | ||
p.Glu145Alafs Ter97 | ε3ε3 | 1 | 74 | F | 30 | 19.3 | no | no | no | 4.48 | 2.32 | 1.66 | 0.69 | |
p.Arg154Cys | ε3ε3 | 9 | 74 (19; 88) n = 8 | 4 (44.4) | 52 (45; 58) | 28.6 (26.1; 31.3) | 2 (22.2) | 0 | 0 | 8.72 (5.53; 15.91) n = 8 | 3.54 (2.96; 4.10) n = 5 | 1.14 (0.94; 1.44) | 4.50 (1.95; 12.39) | Carotid (n = 6) and femoral (n = 3) atherosclerosis, cutaneous eruptive xanthomas (n = 1) |
p.Lys164Serfs Ter87 | ε3ε3 | 1 | 32 | F | 56 | 43.5 | no | no | no | 4.19 | 2.59 | 1.19 | 0.65 | Carotid atherosclerosis |
p.Gly183Ala | ε3ε3 | 3 | 7 (6; 39) | 3 (100) | 55 (51; 57) | 28.7 (27.0; 28.8) | 0 | 0 | 0 | 4.83 (4.69; 5.96) | 3.02 (2.85; 3.37) | 1.06 (0.94; 1.34) | 1.38 (1.05; 2.34) | |
ε3ε4 | 1 | 69 | F | 48 | 25.6 | no | no | no | 5.80 | 3.89 | 1.53 | 1.12 | ||
Total | 4 | 38 (7; 69) | 3 (75.0) | 52 (48; 56) | 27.2 (25.5; 28.8) | 0 | 0 | 0 | 5.32 (4.76; 6.12) | 3.37 (2.94; 3.76) | 1.30 (1.00; 1.55) | 1.25 (1.02; 1.86) | ||
p.Ala184Val | ε3ε3 | 1 | 35 | F | 64 | 19.0 | no | no | no | 6.20 | no data | no data | no data | |
p.Gly200Glu | ε3ε4 | 1 | 77 | F | 63 | no data | no | no | no | 5.84 | 2.60 | 1.16 | 1.54 | |
p.Val208Leu | ε3ε3 | 1 | 50 | F | 60 | 29.8 | no | no | no | 6.28 | 2.70 | 1.17 | 1.60 | |
p.Glu230Lys | ε3ε3 | 1 | 49 | M | 50 | 28.7 | yes | no | yes | 4.90 | 2.68 | 0.84 | 5.26 | Carotid atherosclerosis |
p.Val254Glu | ε3ε3 | 6 | 56 (40; 65) n = 5 | 2 (33.3) | 50 (35; 52) | 28.8 (23.7; 28.9) n = 5 | 0 n = 5 | 0 n = 5 | 0 n = 5 | 5.62 (4.78; 6.08) n = 5 | 3.75 (3.19; 3.94) n = 5 | 1.13 (1.02; 1.18) n = 5 | 1.48 (1.43; 1.70) n = 5 | |
p.Arg269Gly | ε3ε3 | 1 | no data | M | 55 | 31.9 | no | no | no | 4.30 | 2.07 | 1.67 | 1.25 | |
1 | 6 | F | 33 | 21.1 | no | no | no | 4.27 | 2.88 | 1.10 | 0.66 | |||
ε4ε4 | 1 | 32 | F | 63 | no data | 5.60 | no data | |||||||
ε3ε4 | 1 | 3 | F | 34 | no data | |||||||||
Total | 4 | 6 (5; 19) n = 3 | 1 (25.0) | 45 (34; 57) | NA | 0 n = 2 | 0 n = 2 | 0 n = 2 | 4.30 (4.29; 4.95) n = 3 | NA | NA | NA | ||
p.Gln271Pro | ε3ε3 | 1 | 62 | M | 53 | 33.5 | yes | no | no | 7.41 | 2.64 | 0.73 | 12.75 | |
p.Thr307Ile | ε3ε3 | 1 | 75 | M | 30 | 30.0 | no | no | no | 4.90 | 3.41 | 1.12 | 1.03 | |
p.Ser314Arg | ε3ε3 | 1 | no data | F | 33 | 27.7 | no | no | no | 4.00 | 2.04 | 1.65 | 0.67 |
References
- Mach, F.; Baigent, C.; Catapano, A.L.; Koskinas, K.C.; Casula, M.; Badimon, L.; Chapman, M.J.; De Backer, G.G.; Delgado, V.; Ference, B.A.; et al. 2019 ESC/EAS Guidelines for the management of dyslipidaemias: Lipid modification to reduce cardiovascular risk: The Task Force for the management of dyslipidaemias of the European Society of Cardiology (ESC) and European Atherosclerosis Society (EAS). Eur. Heart. J. 2020, 41, 111–188. [Google Scholar] [CrossRef] [PubMed]
- Hu, P.; Dharmayat, K.I.; Stevens, C.A.; Sharabiani, M.T.; Jones, R.S.; Watts, G.F.; Genest, J.; Ray, K.K.; Vallejo-Vaz, A.J. Prevalence of familial hypercholesterolemia among the general population and patients with atherosclerotic cardiovascular disease: A systematic review and meta-analysis. Circulation 2020, 141, 1742–1759. [Google Scholar] [CrossRef] [PubMed]
- Beheshti, S.O.; Madsen, C.M.; Varbo, A.; Nordestgaard, B.G. Worldwide Prevalence of Familial Hypercholesterolemia: Meta-Analyses of 11 Million Subjects. J. Am. Coll. Cardiol. 2020, 75, 2553–2566. [Google Scholar] [CrossRef]
- Paquette, M.; Trinder, M.; Guay, S.P.; Brunham, L.R.; Baass, A. Prevalence of Dysbetalipoproteinemia in the UK Biobank According to Different Diagnostic Criteria. J. Clin. Endocrinol. Metab. 2024, dgae259. [Google Scholar] [CrossRef]
- Bea, A.M.; Larrea-Sebal, A.; Marco-Benedi, V.; Uribe, K.B.; Galicia-Garcia, U.; Lamiquiz-Moneo, I.; Laclaustra, M.; Moreno-Franco, B.; Fernandez-Corredoira, P.; Olmos, S.; et al. Contribution of APOE genetic variants to dyslipidemia. Arterioscler. Thromb. Vasc. Biol. 2023, 43, 1066–1077. [Google Scholar] [CrossRef]
- Abou Khalil, Y.; Marmontel, O.; Ferrières, J.; Paillard, F.; Yelnik, C.; Carreau, V.; Charrière, S.; Bruckert, E.; Gallo, A.; Giral, P.; et al. APOE Molecular Spectrum in a French Cohort with Primary Dyslipidemia. Int. J. Mol. Sci. 2022, 23, 5792. [Google Scholar] [CrossRef]
- Meshkov, A.; Ershova, A.; Kiseleva, A.; Zotova, E.; Sotnikova, E.; Petukhova, A.; Zharikova, A.; Malyshev, P.; Rozhkova, T.; Blokhina, A.; et al. The LDLR, APOB, and PCSK9 Variants of Index Patients with Familial Hypercholesterolemia in Russia. Genes 2021, 12, 66. [Google Scholar] [CrossRef]
- Meshkov, A.N.; Ershova, A.I.; Kiseleva, A.V.; Shalnova, S.A.; Drapkina, O.M.; Boytsov, S.A. The prevalence of heterozygous familial hypercholesterolemia in selected regions of the Russian Federation: The FH-ESSE-RF study. J. Pers. Med. 2021, 11, 464. [Google Scholar] [CrossRef]
- Blokhina, A.V.; Ershova, A.I.; Meshkov, A.N.; Kiseleva, A.V.; Klimushina, M.V.; Zharikova, A.A.; Sotnikova, E.A.; Ramensky, V.E.; Drapkina, O.M. Phenotypic vs. genetic cascade screening for familial hypercholesterolemia: A case report. Front. Cardiovasc. Med. 2022, 9, 982607. [Google Scholar] [CrossRef]
- Blokhina, A.V.; Ershova, A.I.; Kiseleva, A.V.; Sotnikova, E.A.; Zharikova, A.A.; Zaicenoka, M.; Vyatkin, Y.V.; Ramensky, V.E.; Kutsenko, V.A.; Shalnova, S.A.; et al. Applicability of Diagnostic Criteria and High Prevalence of Familial Dysbetalipoproteinemia in Russia: A Pilot Study. Int. J. Mol. Sci. 2023, 24, 13159. [Google Scholar] [CrossRef]
- Vallejo-Vaz, A.J.; Stevens, C.A.; Lyons, A.R.; Dharmayat, K.I.; Freiberger, T.; Hovingh, G.K.; Mata, P.; Raal, F.J.; Santos, R.D.; Soran, H.; et al. Global perspective of familial hypercholesterolaemia: A cross-sectional study from the EAS Familial Hypercholesterolaemia Studies Collaboration (FHSC). Lancet 2021, 398, 1713–1725. [Google Scholar] [CrossRef] [PubMed]
- Dharmayat, K.I.; Vallejo-Vaz, A.J.; Stevens, C.A.; Brandts, J.M.; Lyons, A.R.; Groselj, U.; Abifadel, M.; Aguilar-Salinas, C.A.; Alhabib, K.; Alkhnifsawi, M.; et al. Familial hypercholesterolaemia in children and adolescents from 48 countries: A cross-sectional study. Lancet 2024, 403, 55–66. [Google Scholar] [CrossRef] [PubMed]
- Hopkins, P.N.; Nanjee, M.N.; Wu, L.L.; McGinty, M.G.; Brinton, E.A.; Hunt, S.C.; Anderson, J.L. Altered composition of triglyceride-rich lipoproteins and coronary artery disease in a large case–control study. Atherosclerosis 2009, 207, 559–566. [Google Scholar] [CrossRef]
- Pallazola, V.A.; Sathiyakumar, V.; Park, J.; Vakil, R.M.; Toth, P.P.; Lazo-Elizondo, M.; Brown, E.; Quispe, R.; Guallar, E.; Banach, M.; et al. Modern prevalence of dysbetalipoproteinemia (Fredrickson-Levy-Lees type III hyperlipoproteinemia). Arch. Med. Sci. 2019, 16, 993–1003. [Google Scholar] [CrossRef]
- Koopal, C.; Marais, A.D.; Visseren, F.L.J. Familial dysbetalipoproteinemia: An underdiagnosed lipid disorder. Curr. Opin. Endocrinol. Diabetes Obes. 2017, 24, 133–139. [Google Scholar] [CrossRef]
- Blokhina, A.V.; Ershova, A.I.; Meshkov, A.N.; Drapkina, O.M. Familial dysbetalipoproteinemia: Highly atherogenic and underdiagnosed disorder. Cardiovasc. Ther. Prev. 2021, 20, 2893. (In Russian) [Google Scholar] [CrossRef]
- Smelt, A.H.M.; De Beer, F. Apolipoprotein E and familial dysbetalipoproteinemia: Clinical, biochemical, and genetic aspects. Semin. Vasc. Med. 2004, 4, 249–257. [Google Scholar] [CrossRef]
- De Beer, F.; Stalenhoef, A.F.H.; Hoogerbrugge, N.; Kastelein, J.J.P.; Gevers Leuven, J.A.; van Duijn, C.M.; Havekes, L.M.; Smelt, A.H. Expression of type III hyperlipoproteinemia in apolipoprotein E2 (Arg158 → Cys) homozygotes is associated with hyperinsulinemia. Arterioscler. Thromb. Vasc. Biol. 2002, 22, 294–299. [Google Scholar] [CrossRef]
- Heidemann, B.E.; Wolters, F.J.; Kavousi, M.; Gruppen, E.G.; Dullaart, R.P.; Marais, A.D.; Visseren, F.L.; Koopal, C. Adiposity and the development of dyslipidemia in APOE ε2 homozygous subjects: A longitudinal analysis in two population-based cohorts. Atherosclerosis 2021, 325, 57–62. [Google Scholar] [CrossRef]
- Corsetti, J.P.; Love, T.M.; Sparks, C.E.; Bakker, S.J.L.; Dullaart, R.P.F. Insulin resistance involvement in prevalence of familial dysbetalipoproteinemia in ε2ε2 subjects by Bayesian network modeling. Clin. Biochem. 2018, 59, 31–36. [Google Scholar] [CrossRef]
- Koopal, C.; Retterstøl, K.; Sjouke, B.; Hovingh, G.K.; Ros, E.; de Graaf, J.; Dullaart, R.P.; Bertolini, S.; Visseren, F.L. Vascular risk factors, vascular disease, lipids and lipid targets in patients with familial dysbetalipoproteinemia: A European cross-sectional study. Atherosclerosis 2015, 240, 90–97. [Google Scholar] [CrossRef] [PubMed]
- Varbo, A.; Freiberg, J.J.; Nordestgaard, B.G. Extreme nonfasting remnant cholesterol vs extreme LDL cholesterol as contributors to cardiovascular disease and all-cause mortality in 90000 individuals from the general population. Clin. Chem. 2015, 61, 533–543. [Google Scholar] [CrossRef] [PubMed]
- Quispe, R.; Martin, S.S.; Michos, E.D.; Lamba, I.; Blumenthal, R.S.; Saeed, A.; Lima, J.; Puri, R.; Nomura, S.; Tsai, M.; et al. Remnant cholesterol predicts cardiovascular disease beyond LDL and ApoB: A primary prevention study. Eur. Heart. J. 2021, 42, 4324–4332. [Google Scholar] [CrossRef] [PubMed]
- Kexin, W.; Yaodong, D.; Wen, G.; Rui, W.; Jiaxin, Y.; Xiaoli, L.; Hua, S.; Hailong, G. Association of increased remnant cholesterol and the risk of coronary artery disease: A retrospective study. Front. Cardiovasc. Med. 2021, 8, 740596. [Google Scholar] [CrossRef] [PubMed]
- Karpe, F.; Boquist, S.; Tang, R.; Bond, G.M.; de Faire, U.; Hamsten, A. Remnant lipoproteins are related to intima-media thickness of the carotid artery independently of LDL cholesterol and plasma triglycerides. J. Lipid Res. 2001, 42, 17–21. [Google Scholar] [CrossRef]
- Wang, A.; Tian, X.; Zuo, Y.; Wu, J.; Tang, H.; Wang, Y.; Zhao, X. Association of remnant cholesterol with intra-and extra-cranial atherosclerosis in Chinese community population. Atheroscler. Plus 2021, 46, 20–26. [Google Scholar] [CrossRef]
- Paquette, M.; Bernard, S.; Paré, G.; Baass, A. Dysbetalipoproteinemia: Differentiating Multifactorial Remnant Cholesterol Disease From Genetic ApoE Deficiency. J. Clin. Endocrinol. Metab. 2022, 107, 538–548. [Google Scholar] [CrossRef] [PubMed]
- Koopal, C.; Marais, A.D.; Westerink, J.; Visseren, F.L.J. Autosomal dominant familial dysbetalipoproteinemia: A pathophysiological framework and practical approach to diagnosis and therapy. J. Clin. Lipidol. 2017, 11, 12–23. [Google Scholar] [CrossRef]
- Abou, K.Y.; Rabes, J.P.; Boileau, C.; Varret, M. APOE gene variants in primary dyslipidemia. Atherosclerosis 2021, 328, 11–22. [Google Scholar] [CrossRef]
- Heidemann, B.E.; Koopal, C.; Baass, A.; Defesche, J.C.; Zuurbier, L.; Mulder, M.T.; Roeters van Lennep, J.E.; Riksen, N.P.; Boot, C.; Marais, A.D.; et al. Establishing the relationship between familial dysbetalipoproteinemia and genetic variants in the APOE gene. Clin. Genet. 2022, 102, 253–261. [Google Scholar] [CrossRef]
- Zhao, S.P.; van den Maagdenberg, A.M.; Vroom, T.F.; van’t Hooft, F.M.; Gevers Leuvens, J.A.; Havekes, L.M.; Frants, R.R.; van der Laarse, A.; Smelt, A.H. Lipoprotein profiles in a family with two mutants of apolipoprotein E: Possible association with hypertriglyceridaemia but not with dysbetalipoproteinaemia. Clin. Sci. 1994, 86, 323–329. [Google Scholar] [CrossRef] [PubMed]
- Weisgraber, K.H.; Rall, S.C., Jr.; Innerarity, T.L.; Mahley, R.W.; Kuusi, T.; Ehnholm, C. A novel electrophoretic variant of human apolipoprotein E. Identification and characterization of apolipoprotein E1. J. Clin. Investig. 1984, 73, 1024–1033. [Google Scholar] [CrossRef] [PubMed]
- Miller, D.B.; Hegele, R.A.; Wolfe, B.M.; Huff, M.W. Identification, molecular characterization, and cellular studies of an apolipoprotein E mutant (E1) in three unrelated families with hyperlipidemia. J. Clin. Endocrinol. Metab. 1995, 80, 807–813. [Google Scholar] [CrossRef] [PubMed]
- Richard, P.; Beucler, I.; Pascual De Zulueta, M.; Biteau, N.; De Gennes, J.L.; Iron, A. Compound heterozygote for both rare apolipoprotein E1 (Gly127-->Asp, Arg158-->Cys) and E3(Cys112-->Arg, Arg251-->Gly) alleles in a multigeneration pedigree with hyperlipoproteinaemia. Clin. Sci. 1997, 93, 89–95. [Google Scholar] [CrossRef]
- Wintjens, R.; Bozon, D.; Belabbas, K.; MBou, F.; Girardet, J.P.; Tounian, P.; Jolly, M.; Boccara, F.; Cohen, A.; Karsenty, A.; et al. Global molecular analysis and APOE mutations in a cohort of autosomal dominant hypercholesterolemia patients in France. J. Lipid Res. 2016, 57, 482–491. [Google Scholar] [CrossRef]
- Limonova, A.S.; Ershova, A.I.; Meshkov, A.N.; Kiseleva, A.V.; Divashuk, M.G.; Kutsenko, V.A.; Drapkina, O.M. Case Report: Hypertriglyceridemia and Premature Atherosclerosis in a Patient With Apolipoprotein E Gene ε2ε1 Genotype. Front. Cardiovasc. Med. 2021, 7, 585779. [Google Scholar] [CrossRef]
- Orth, M.; Weng, W.; Funke, H.; Steinmetz, A.; Assmann, G.; Nauck, M.; Dierkes, J.; Ambrosch, A.; Weisgraber, K.H.; Mahley, R.W.; et al. Effects of a frequent apolipoprotein E isoform, ApoE4Freiburg (Leu28→ Pro), on lipoproteins and the prevalence of coronary artery disease in whites. Arterioscler. Thromb. Vasc. Biol. 1999, 19, 1306–1315. [Google Scholar] [CrossRef]
- Rasmussen, K.L.; Tybjaerg-Hansen, A.; Nordestgaard, B.G.; Frikke-Schmidt, R. APOE and dementia—Resequencing and genotyping in 105,597 individuals. Alzheimer’s Dement. 2020, 16, 1624–1637. [Google Scholar] [CrossRef]
- Liampas, I.; Kyriakoulopoulou, P.; Siokas, V.; Tsiamaki, E.; Stamati, P.; Kefalopoulou, Z.; Chroni, E.; Dardiotis, E. Apolipoprotein E Gene in α-Synucleinopathies: A Narrative Review. Int. J. Mol. Sci. 2024, 25, 1795. [Google Scholar] [CrossRef]
- Marmontel, O.; Abou-Khalil, Y.; Bluteau, O.; Cariou, B.; Carreau, V.; Charrière, S.; Divry, E.; Gallo, A.; Moulin, P.; Paillard, F.; et al. Additive effect of APOE Rare Variants on the phenotype of familial hypercholesterolemia. Arterioscler. Thromb. Vasc. Biol. 2023, 43, e270–e278. [Google Scholar] [CrossRef]
- Chen, J.; Li, Q.; Wang, J. Topology of human apolipoprotein E3 uniquely regulates its diverse biological functions. Proc. Natl. Acad. Sci. USA 2011, 108, 14813–14818. [Google Scholar] [CrossRef] [PubMed]
- Mahley, R.W.; Huang, Y.; Rall, S.C., Jr. Pathogenesis of type III hyperlipoproteinemia (dysbetalipoproteinemia): Questions, quandaries, and paradoxes. J. Lipid Res. 1999, 40, 1933–1949. [Google Scholar] [CrossRef] [PubMed]
- Richards, S.; Aziz, N.; Bale, S.; Bick, D.; Das, S.; Gastier-Foster, J.; Grody, W.W.; Hegde, M.; Lyon, E.; Spector, E.; et al. Standards and guidelines for 321 the interpretation of sequence variants: A joint consensus recommendation of the American 322 College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. 2015, 17, 405–423. [Google Scholar] [CrossRef]
- Schubach, M.; Maass, T.; Nazaretyan, L.; Röner, S.; Kircher, M. CADD v1.7: Using protein language models, regulatory CNNs and other nucleotide-level scores to improve genome-wide variant predictions. Nucleic Acids Res. 2024, 52, D1143–D1154. [Google Scholar] [CrossRef] [PubMed]
- Feussner, G.; Albanese, M.; Mann, W.A.; Valencia, A.; Schuster, H. Apolipoprotein E2 (Arg-136-->Cys), a variant of apolipoprotein E associated with late-onset dominance of type III hyperlipoproteinaemia. Eur. J. Clin. Investig. 1996, 26, 13–23. [Google Scholar] [CrossRef] [PubMed]
- Walden, C.C.; Huff, M.W.; Leiter, L.A.; Connelly, P.W.; Hegele, R.A. Detection of a new apolipoprotein-E mutation in type III hyperlipidemia using deoxyribonucleic acid restriction isotyping. J. Clin. Endocrinol. Metab. 1994, 78, 699–704. [Google Scholar] [CrossRef]
- Wardell, M.R.; Brennan, S.O.; Janus, E.D.; Fraser, R.; Carrell, R.W. Apolipoprotein E2-Christchurch (136 Arg----Ser). New variant of human apolipoprotein E in a patient with type III hyperlipoproteinemia. J. Clin. Investig. 1987, 80, 483–490. [Google Scholar] [CrossRef]
- Hegele, R.A. Illuminating the full spectrum of APOE variation. Atherosclerosis 2023, 385, 117311. [Google Scholar] [CrossRef]
- Radwan, Z.H.; Wang, X.; Waqar, F.; Pirim, D.; Niemsiri, V.; Hokanson, J.E.; Hamman, R.F.; Bunker, C.H.; Barmada, M.M.; Demirci, F.Y.; et al. Comprehensive evaluation of the association of APOE genetic variation with plasma lipoprotein traits in U.S. whites and African blacks. PLoS ONE 2014, 9, e114618. [Google Scholar] [CrossRef]
- Argyri, L.; Dafnis, I.; Theodossiou, T.A.; Gantz, D.; Stratikos, E.; Chroni, A. Molecular basis for increased risk for late-onset Alzheimer disease due to the naturally occurring L28P mutation in apolipoprotein E4. J. Biol. Chem. 2014, 289, 12931–12945. [Google Scholar] [CrossRef]
- Varghese, B.; Park, J.; Chew, E.; Sajja, A.; Brownstein, A.; Pallazola, V.A.; Sathiyakumar, V.; Jones, S.R.; Sniderman, A.D.; Martin, S.S. Importance of the triglyceride level in identifying patients with a Type III Hyperlipoproteinemia phenotype using the ApoB algorithm. J. Clin. Lipidol. 2021, 15, 104–115. [Google Scholar] [CrossRef] [PubMed]
- Boytsov, S.A.; Drapkina, O.M.; Shlyakhto, E.V.; Konradi, A.O.; Balanova, Y.A.; Zhernakova, Y.V.; Metelskaya, V.A.; Oshchepkova, E.V.; Rotar, O.P.; Shalnova, S.A. Epidemiology of cardiovascular diseases and their risk factors in regions of Russian Federation (ESSE-RF) study. Ten years later. Cardiovasc. Ther. Prev. 2021, 20, 3007. (In Russian) [Google Scholar] [CrossRef]
- Federal State Statistics Service for Ivanono Region. Statistical Yearbook “Ivanovo Region”. 2013; p. 44. Available online: https://37.rosstat.gov.ru/folder/31706 (accessed on 30 September 2024).
- Civeira, F. Guidelines for the diagnosis and management of heterozygous familial hypercholesterolemia. Atherosclerosis 2004, 173, 55–68. [Google Scholar] [CrossRef] [PubMed]
- Kopylova, O.V.; Ershova, A.I.; Pokrovskaya, M.S.; Meshkov, A.N.; Efimova, I.A.; Serebryanskaya, Z.Z.; Blokhina, A.V.; Borisova, A.L.; Kondratskaya, V.A.; Limonova, A.S.; et al. Population-nosological research biobank of the National Medical Research Center for Therapy and Preventive Medicine: Analysis of biosamples, principles of collecting and storing information. Cardiovasc. Ther. Prev. 2021, 20, 3119. (In Russian) [Google Scholar] [CrossRef]
- Collins, R.; Reith, C.; Emberson, J.; Armitage, J.; Baigent, C.; Blackwell, L.; Blumenthal, R.; Danesh, J.; Smith, G.D.; DeMets, D.; et al. Interpretation of the evidence for the efficacy and safety of statin therapy. Lancet 2016, 388, 2532–2561. [Google Scholar] [CrossRef]
- Blokhina, A.V.; Ershova, A.I.; Meshkov, A.N.; Limonova, A.S.; Mikhailina, V.I.; Drapkina, O.M. Lipid Clinic is an Efficacious Model of Preventive Medicine. Ration. Pharmacother. Cardiol. 2021, 17, 4–10. (In Russian) [Google Scholar] [CrossRef]
- Ramensky, V.E.; Ershova, A.I.; Zaicenoka, M.; Kiseleva, A.V.; Zharikova, A.A.; Vyatkin, Y.V.; Sotnikova, E.A.; Efimova, I.A.; Divashuk, M.G.; Kurilova, O.V.; et al. Targeted Sequencing of 242 Clinically Important Genes in the Russian Population from the Ivanovo Region. Front. Genet. 2021, 12, 709419. [Google Scholar] [CrossRef]
- Van der Auwera, G.A.; O’Connor, B.D. Genomics in the Cloud: Using Docker, GATK, and WDL in Terra; O’Reilly Media: Sebastopol, CA, USA, 2020. [Google Scholar]
- Amberger, J.S.; Bocchini, C.A.; Schiettecatte, F.; Scott, A.F.; Hamosh, A. OMIM.org: Online Mendelian Inheritance in Man (OMIM®), an online catalog of human genes and genetic disorders. Nucleic Acids Res. 2015, 43, 89–98. [Google Scholar] [CrossRef]
- Karczewski, K.J.; Francioli, L.C.; Tiao, G.; Cummings, B.B.; Alfoldi, J.; Wang, Q.; Collins, R.L.; Laricchia, K.M.; Ganna, A.; Birnbaum, D.P.; et al. The mutational constraint spectrum quantified from variation in 141,456 humans. Nature 2020, 581, 434–443. [Google Scholar] [CrossRef]
- Landrum, M.J.; Lee, J.M.; Benson, M.; Brown, G.; Chao, C.; Chitipiralla, S.; Gu, B.; Hart, J.; Hoffman, D.; Hoover, J.; et al. ClinVar: Public archive of interpretations of clinically relevant variants. Nucleic Acids Res. 2016, 44, 862–868. [Google Scholar] [CrossRef]
- Stenson, P.D.; Mort, M.; Ball, E.V.; Chapman, M.; Evans, K.; Azevedo, L.; Hayden, M.; Heywood, S.; Millar, D.S.; Phillips, A.D.; et al. The Human Gene Mutation Database (HGMD®): Optimizing its use in a clinical diagnostic or research setting. Hum. Genet. 2020, 139, 1197–1207. [Google Scholar] [CrossRef] [PubMed]
- Fokkema, I.F.; Kroon, M.; López Hernández, J.A.; Asscheman, D.; Lugtenburg, I.; Hoogenboom, J.; den Dunnen, J.T. The LOVD3 platform: Efficient genome-wide sharing of genetic variants. Eur. J. Hum. Genet. 2021, 29, 1796–1803. [Google Scholar] [CrossRef] [PubMed]
- Sherry, S.T.; Ward, M.H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E.M.; Sirotkin, K. dbSNP: The NCBI database of genetic variation. Nucleic Acids Res. 2001, 29, 308–311. [Google Scholar] [CrossRef] [PubMed]
- CADD—Combined Annotation Dependent Depletion. Available online: https://cadd.gs.washington.edu/ (accessed on 1 August 2024).
- Khera, A.V.; Emdin, C.A.; Drake, I.; Natarajan, P.; Bick, A.G.; Cook, N.R.; Chasman, D.I.; Baber, U.; Mehran, R.; Rader, D.J.; et al. Genetic Risk, Adherence to a Healthy Lifestyle, and Coronary Disease. N. Engl. J. Med. 2016, 375, 2349–2358. [Google Scholar] [CrossRef]
- R Development Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2013; Available online: https://www.R-project.org/ (accessed on 6 February 2024).
- Wickham, H. GGPLOT2: Elegant Graphics for Data Analysis; R Package Version; Springer: New York, NY, USA, 2016; p. 3. [Google Scholar]
- Medeiros, A.M.; Alves, A.C.; Miranda, B.; Chora, J.R.; Bourbon, M.; Investigators of the Portuguese FH Study. Unraveling the genetic background of individuals with a clinical familial hypercholesterolemia phenotype. J. Lipid Res. 2024, 65, 100490. [Google Scholar] [CrossRef]
- Feussner, G.; Scharnagl, H.; Scherbaum, C.; Acar, J.; Dobmeyer, J.; Lohrmann, J.; Wieland, H.; März, W. Apolipoprotein E5 (Glu212→Lys): Increased binding to cell surface proteoglycans but decreased uptake and lysosomal degradation in cultured fibroblasts. J. Lipid Res. 1996, 37, 1632–1645. [Google Scholar] [CrossRef]
- van den Maagdenberg, A.M.; Weng, W.; de Bruijn, I.H.; de Knijff, P.; Funke, H.; Smelt, A.H.; Gevers Leuven, J.A.; van’t Hooft, F.M.; Assmann, G.; Hofker, M.H.; et al. Characterization of five new mutants in the carboxyl-terminal domain of human apolipoprotein E: No cosegregation with severe hyperlipidemia. Am. J. Hum. Genet. 1993, 52, 937–946. [Google Scholar]
- Maeda, H.; Nakamura, H.; Kobori, S.; Okada, M.; Mori, H.; Niki, H.; Ogura, T.; Hiraga, S. Identification of human apolipoprotein E variant gene: Apolipoprotein E7 (Glu244,245↑Lys244,245). J. Biochem. 1989, 105, 51–54. [Google Scholar] [CrossRef]
- Matsunaga, A.; Sasaki, J.; Moriyama, K.; Arakawa, F.; Takada, Y.; Nishi, K.; Hidaka, K.; Arakawa, K. Population frequency of apolipoprotein E5 (Glu3→Lys) and E7 (Glu244→Lys, Glu245→Lys) variants in western Japan. Clin. Genet. 1995, 48, 93–99. [Google Scholar] [CrossRef]
- Zhou, Y.; Mägi, R.; Milani, L.; Lauschke, V.M. Global genetic diversity of human apolipoproteins and effects on cardiovascular disease risk. J. Lipid Res. 2018, 59, 1987–2000. [Google Scholar] [CrossRef]
- Abondio, P.; Bruno, F.; Luiselli, D. Apolipoprotein E (APOE) Genotypes in Healthy Subjects from Worldwide Macroareas: A Population Genetics Perspective for Cardiovascular Disease, Neurodegeneration, and Dementia. Curr. Issues Mol. Biol. 2023, 45, 2817–2831. [Google Scholar] [CrossRef]
Sample, n | APOE Genotype, n (%) (95% Confidence Interval) | |||||
---|---|---|---|---|---|---|
ε3ε3 | ε2ε2 | ε4ε4 | ε2ε3 | ε3ε4 | ε2ε4 | |
86 | 49 (56.9) (45.85–67.61) | 3 (3.5) (0.73–9.86) | 4 (4.7) (1.28–11.48) | 6 (7.0) (2.60–14.57) | 20 (23.2) (14.82–33.61) | 4 (4.7) (1.28–11.48) |
Parameter | All Carriers (n = 44) | Carriers of Pathogenic or Likely Pathogenic Variants (n = 16) | Carriers of VUS (n = 13) | Carriers of Benign or Likely Benign Variants (n = 15) | p-Value * |
---|---|---|---|---|---|
Men, n (%) | 19 (43.2) | 8 (50.0) | 6 (46.2) | 5 (33.3) | 0.693 |
Age, years, Me (Q1; Q3) | 51 (42; 57) | 51 (40; 56) | 48 (44; 55) | 52 (43; 61) | 0.878 |
Current smoking, n (%) | 7 (16.3) n = 43 | 4 (25.0) | 0 | 3 (21.4) n = 14 | 0.161 |
Ex-smokers, n (%) | 9 (20.9) n = 43 | 2 (12.5) | 5 (38.5) | 2 (14.3) n = 14 | 0.207 |
Hypertension, n (%) | 24 (54.5) | 8 (50.0) | 7 (53.8) | 9 (60.0) | 0.928 |
BMI, kg/m2, Me (Q1; Q3) | 28.4 (24.5; 30.7) n = 43 | 28.5 (26.0; 31.5) | 28.8 (25.5; 30.9) n = 12 | 25.0 (22.3; 29.0) | 0.196 |
Diabetes, n (%) | 8 (18.2) | 4 (25.0) | 2 (15.4) | 2 (13.3) | 0.705 |
Hypothyroidism, n (%) | 1 (2.3) | 0 | 0 | 1 (6.7) | 0.636 |
CHD, n (%) | 4 (9.1) | 2 (12.5) | 1 (7.7) | 1 (6.7) | 1.0 |
LLT, n (%) | 14 (31.8) n = 43 | 9 (56.3) ** | 1 (7.7) ** | 4 (28.6) n = 14 | 0.017 |
TC, mmol/L, Me (Q1; Q3) | 5.82 (4.53; 7.35) n = 40 | 7.10 (4.90; 15.89) n = 13 | 4.87 (3.98; 5.95) n = 12 | 6.37 (4.74; 7.20) | 0.078 |
LDL-C, mmol/L, Me (Q1; Q3) | 3.02 (2.46; 3.97) | 2.94 (2.46; 3.81) n= 11 | 2.68 (2.07; 3.41) | 3.86 (2.96; 4.26) | 0.185 |
HDL-C, mmol/L, Me (Q1; Q3) | 1.17 (0.96; 1.50) n = 43 | 1.14 (0.88; 1.40) n=15 | 1.17 (1.06; 1.51) | 1.18 (1.03; 1.62) | 0.644 |
Non-HDL-C, mmol/L, Me (Q1; Q3) | 4.44 (3.19; 6.10) n = 39 | 5.29 (3.74; 12.47) n = 12 | 3.75 (2.50; 4.79) n = 12 | 5.10 (3.67; 5.83) | 0.142 |
TG, mmol/L, Me (Q1; Q3) | 1.84 (1.01; 4.86) | 5.01 *** (1.75; 10.50) | 1.38 *** (0.94; 1.78) | 1.70 *** (1.04; 3.25) | 0.061 |
ε3ε3, n (%) | 38 (86.4) | 12 (75.0) | 11 (84.6) | 15 (100) | 0.114 |
ε2ε2, n (%) | 3 (6.8) | 3 (18.7) | 0 | 0 | 0.098 |
ε2ε3, n (%) | 1 (2.3) | 1 (6.3) | 0 | 0 | 1.0 |
ε3ε4, n (%) | 2 (4.5) | 0 | 2 (15.4) | 0 | 0.082 |
High PRS TG, n (%) | 10 (25.0) n = 40 | 4 (26.7) n = 15 | 3 (25.0) n = 12 | 3 (23.1) n = 13 | 1.0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Blokhina, A.V.; Ershova, A.I.; Kiseleva, A.V.; Sotnikova, E.A.; Zharikova, A.A.; Zaicenoka, M.; Vyatkin, Y.V.; Ramensky, V.E.; Kutsenko, V.A.; Garbuzova, E.V.; et al. Spectrum and Prevalence of Rare APOE Variants and Their Association with Familial Dysbetalipoproteinemia. Int. J. Mol. Sci. 2024, 25, 12651. https://doi.org/10.3390/ijms252312651
Blokhina AV, Ershova AI, Kiseleva AV, Sotnikova EA, Zharikova AA, Zaicenoka M, Vyatkin YV, Ramensky VE, Kutsenko VA, Garbuzova EV, et al. Spectrum and Prevalence of Rare APOE Variants and Their Association with Familial Dysbetalipoproteinemia. International Journal of Molecular Sciences. 2024; 25(23):12651. https://doi.org/10.3390/ijms252312651
Chicago/Turabian StyleBlokhina, Anastasia V., Alexandra I. Ershova, Anna V. Kiseleva, Evgeniia A. Sotnikova, Anastasia A. Zharikova, Marija Zaicenoka, Yuri V. Vyatkin, Vasily E. Ramensky, Vladimir A. Kutsenko, Elizaveta V. Garbuzova, and et al. 2024. "Spectrum and Prevalence of Rare APOE Variants and Their Association with Familial Dysbetalipoproteinemia" International Journal of Molecular Sciences 25, no. 23: 12651. https://doi.org/10.3390/ijms252312651
APA StyleBlokhina, A. V., Ershova, A. I., Kiseleva, A. V., Sotnikova, E. A., Zharikova, A. A., Zaicenoka, M., Vyatkin, Y. V., Ramensky, V. E., Kutsenko, V. A., Garbuzova, E. V., Divashuk, M. G., Litinskaya, O. A., Pokrovskaya, M. S., Shalnova, S. A., Meshkov, A. N., & Drapkina, O. M. (2024). Spectrum and Prevalence of Rare APOE Variants and Their Association with Familial Dysbetalipoproteinemia. International Journal of Molecular Sciences, 25(23), 12651. https://doi.org/10.3390/ijms252312651