Ontogeny of Thyroid Hormone Signaling in the Retina of Zebrafish: Effects of Thyroidal Status on Retinal Morphology, Cell Survival, and Color Preference
Abstract
:1. Introduction
2. Results
2.1. Expression Patterns of TH Signaling Genes During Retinal Development
2.2. Retinal Phenotype of dio3b and thrb Crispants
2.3. Thyroid Status Alters the General Morphology of the Zebrafish Larvae Retina
2.4. IOP Decreases the Number of Axons in the Optic Nerve but Does Not Modify the Structure of the Optic Tectum
2.5. Thyroid Status and the Expression of Zebrafish Opsins
2.6. IOP and T3 Treatments Differentially Modified Retinal Cell Death and Proliferation
2.7. Color Preference Is Modified After IOP and T3 Treatments
3. Discussion
4. Material and Methods
4.1. Nomenclature
4.2. Zebrafish
4.3. Zebrafish Eye Dissection
4.4. Iopanoic Acid (IOP) and T3 Treatments
4.5. RNA Isolation and cDNA Synthesis
4.6. Quantitative PCR (qPCR)
4.7. Hematoxylin and Eosin (H&E) Staining and Retinal Cell Layer Quantification
4.8. Transmission Electron Microscopy
4.9. Crispant Generation
4.10. PCNA Staining
4.11. Whole Mount Myelin Staining
4.12. TUNEL Assay
4.13. Color Preference Paradigm
4.14. Statistics
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Stenkamp, D.L. Development of the Vertebrate Eye and Retina. In Progress in Molecular Biology and Translational Science; Elsevier: Amsterdam, The Netherlands, 2015; Volume 134, pp. 397–414. [Google Scholar] [CrossRef]
- Ávila-Mendoza, J.; Mora, J.; Carranza, M.; Luna, M.; Arámburo, C. Growth hormone reverses excitotoxic damage induced by kainic acid in the green iguana neuroretina. Gen. Comp. Endocrinol. 2016, 234, 57–67. [Google Scholar] [CrossRef] [PubMed]
- Donner, K.; Yovanovich, C.A.M. A frog’s eye view: Foundational revelations and future promises. Semin. Cell Dev. Biol. 2020, 106, 72–85. [Google Scholar] [CrossRef]
- Seifert, M.; Baden, T.; Osorio, D. The retinal basis of vision in chicken. Semin. Cell Dev. Biol. 2020, 106, 106–115. [Google Scholar] [CrossRef]
- Hahn, J.; Monavarfeshani, A.; Qiao, M.; Kao, A.H.; Kölsch, Y.; Kumar, A.; Kunze, V.P.; Rasys, A.M.; Richardson, R.; Wekselblatt, J.B.; et al. Evolution of neuronal cell classes and types in the vertebrate retina. Nature 2023, 624, 415–424. [Google Scholar] [CrossRef]
- Diacou, R.; Nandigrami, P.; Fiser, A.; Liu, W.; Ashery-Padan, R.; Cvekl, A. Cell fate decisions, transcription factors and signaling during early retinal development. Prog. Retin. Eye Res. 2022, 91, 101093. [Google Scholar] [CrossRef]
- Yang, F.; Ma, H.; Ding, X.-Q. Thyroid Hormone Signaling in Retinal Development, Survival, and Disease. In Vitamins and Hormones; Elsevier: Amsterdam, The Netherlands, 2018; Volume 106, pp. 333–349. [Google Scholar] [CrossRef]
- McNerney, C.; Johnston, R.J. Thyroid hormone signaling specifies cone photoreceptor subtypes during eye development: Insights from model organisms and human stem cell-derived retinal organoids. In Vitamins and Hormones; Elsevier: Amsterdam, The Netherlands, 2021; Volume 116, pp. 51–90. [Google Scholar] [CrossRef]
- Cohen, A.; Popowitz, J.; Delbridge-Perry, M.; Rowe, C.J.; Connaughton, V.P. The Role of Estrogen and Thyroid Hormones in Zebrafish Visual System Function. Front. Pharmacol. 2022, 13, 837687. [Google Scholar] [CrossRef]
- Sjöberg, M.; Vennström, B.; Forrest, D. Thyroid hormone receptors in chick retinal development: Differential expression of mRNAs for α and N-terminal variant β receptors. Development 1992, 114, 39–47. [Google Scholar] [CrossRef] [PubMed]
- Ng, L.; Hurley, J.B.; Dierks, B.; Srinivas, M.; Saltó, C.; Vennström, B.; Reh, T.A.; Forrest, D. A thyroid hormone receptor that is required for the development of green cone photoreceptors. Nat. Genet. 2001, 27, 94–98. [Google Scholar] [CrossRef]
- Suzuki, S.C.; Bleckert, A.; Williams, P.R.; Takechi, M.; Kawamura, S.; Wong, R.O.L. Cone photoreceptor types in zebrafish are generated by symmetric terminal divisions of dedicated precursors. Proc. Natl. Acad. Sci. USA 2013, 110, 15109–15114. [Google Scholar] [CrossRef]
- Deveau, C.; Jiao, X.; Suzuki, S.C.; Krishnakumar, A.; Yoshimatsu, T.; Hejtmancik, J.F.; Nelson, R.F. Thyroid hormone receptor beta mutations alter photoreceptor development and function in Danio rerio (zebrafish). PLoS Genet. 2020, 16, e1008869. [Google Scholar] [CrossRef]
- Weiss, A.H.; Kelly, J.P.; Bisset, D.; Deeb, S.S. Reduced L- and M- and increased S-cone functions in an infant with thyroid hormone resistance due to mutations in the THRβ2 gene. Ophthalmic Genet. 2012, 33, 187–195. [Google Scholar] [CrossRef] [PubMed]
- Eldred, K.C.; Hadyniak, S.E.; Hussey, K.A.; Brenerman, B.; Zhang, P.-W.; Chamling, X.; Sluch, V.M.; Welsbie, D.S.; Hattar, S.; Taylor, J.; et al. Thyroid hormone signaling specifies cone subtypes in human retinal organoids. Science 2018, 362, eaau6348. [Google Scholar] [CrossRef]
- Ma, H.; Yang, F.; York, L.R.; Li, S.; Ding, X.-Q. Excessive Thyroid Hormone Signaling Induces Photoreceptor Degeneration in Mice. eNeuro 2023, 10, ENEURO.0058-23.2023. [Google Scholar] [CrossRef]
- Ng, L.; Lyubarsky, A.; Nikonov, S.S.; Ma, M.; Srinivas, M.; Kefas, B.; St. Germain, D.L.; Hernandez, A.; Pugh, E.N.; Forrest, D. Type 3 Deiodinase, a Thyroid-Hormone-Inactivating Enzyme, Controls Survival and Maturation of Cone Photoreceptors. J. Neurosci. 2010, 30, 3347–3357. [Google Scholar] [CrossRef] [PubMed]
- Vancamp, P.; Bourgeois, N.M.A.; Houbrechts, A.M.; Darras, V.M. Knockdown of the thyroid hormone transporter MCT8 in chicken retinal precursor cells hampers early retinal development and results in a shift towards more UV/blue cones at the expense of green/red cones. Exp. Eye Res. 2019, 178, 135–147. [Google Scholar] [CrossRef]
- Rozenblat, R.; Tovin, A.; Zada, D.; Lebenthal-Loinger, I.; Lerer-Goldshtein, T.; Appelbaum, L. Genetic and Neurological Deficiencies in the Visual System of mct8 Mutant Zebrafish. Int. J. Mol. Sci. 2022, 23, 2464. [Google Scholar] [CrossRef]
- Liu, Y.; Ng, L.; Liu, H.; Heuer, H.; Forrest, D. Cone photoreceptor differentiation regulated by thyroid hormone transporter MCT8 in the retinal pigment epithelium. Proc. Natl. Acad. Sci. USA 2024, 121, e2402560121. [Google Scholar] [CrossRef]
- Darras, V.M. Deiodinases: How Nonmammalian Research Helped Shape Our Present View. Endocrinology 2021, 162, bqab039. [Google Scholar] [CrossRef]
- Houbrechts, A.M.; Vergauwen, L.; Bagci, E.; Van Houcke, J.; Heijlen, M.; Kulemeka, B.; Hyde, D.R.; Knapen, D.; Darras, V.M. Deiodinase knockdown affects zebrafish eye development at the level of gene expression, morphology and function. Mol. Cell. Endocrinol. 2016, 424, 81–93. [Google Scholar] [CrossRef]
- Sadow, P.M.; Chassande, O.; Koo, E.K.; Gauthier, K.; Samarut, J.; Xu, J.; O’Malley, B.W.; Weiss, R.E. Regulation of expression of thyroid hormone receptor isoforms and coactivators in liver and heart by thyroid hormone. Mol. Cell. Endocrinol. 2003, 203, 65–75. [Google Scholar] [CrossRef]
- Köhrle, J.; Frädrich, C. Deiodinases control local cellular and systemic thyroid hormone availability. Free Radic. Biol. Med. 2022, 193, 59–79. [Google Scholar] [CrossRef] [PubMed]
- Lazcano, I.; Pech-Pool, S.M.; Olvera, A.; García-Martínez, I.; Palacios-Pérez, S.; Orozco, A. The importance of thyroid hormone signaling during early development: Lessons from the zebrafish model. Gen. Comp. Endocrinol. 2023, 334, 114225. [Google Scholar] [CrossRef] [PubMed]
- Avanesov, A.; Malicki, J. Analysis of the Retina in the Zebrafish Model. In Methods in Cell Biology; Elsevier: Amsterdam, The Netherlands, 2010; Volume 100, pp. 153–204. [Google Scholar] [CrossRef]
- Meier, A.; Nelson, R.; Connaughton, V.P. Color Processing in Zebrafish Retina. Front. Cell. Neurosci. 2018, 12, 327. [Google Scholar] [CrossRef]
- Park, J.-S.; Ryu, J.-H.; Choi, T.-I.; Bae, Y.-K.; Lee, S.; Kang, H.J.; Kim, C.-H. Innate Color Preference of Zebrafish and Its Use in Behavioral Analyses. Mol. Cells 2016, 39, 750–755. [Google Scholar] [CrossRef]
- Angueyra, J.M.; Kunze, V.P.; Patak, L.K.; Kim, H.; Kindt, K.; Li, W. Transcription factors underlying photoreceptor diversity. eLife 2023, 12, e81579. [Google Scholar] [CrossRef]
- Moreno-Campos, R.; Singleton, E.W.; Uribe, R.A. A targeted CRISPR-Cas9 mediated F0 screen identifies genes involved in establishment of the enteric nervous system. PLoS ONE 2024, 19, e0303914. [Google Scholar] [CrossRef]
- Koriyama, Y.; Benowitz, L.I. Optic Nerve Regeneration in Lower Vertebrates and Mammals. In Neural Regeneration; Elsevier: Amsterdam, The Netherlands, 2015; pp. 209–227. [Google Scholar] [CrossRef]
- Zaichikova, A.A.; Damjanović, I.; Maximov, P.V.; Aliper, A.T.; Maximova, E.M. Neurons in the Optic Tectum of Fish: Electrical Activity and Selection of Appropriate Stimulation. Neurosci. Behav. Physiol. 2021, 51, 993–1001. [Google Scholar] [CrossRef]
- Harvey, B.M.; Baxter, M.; Granato, M. Optic nerve regeneration in larval zebrafish exhibits spontaneous capacity for retinotopic but not tectum specific axon targeting. PLoS ONE 2019, 14, e0218667. [Google Scholar] [CrossRef]
- Mackin, R.D.; Frey, R.A.; Gutierrez, C.; Farre, A.A.; Kawamura, S.; Mitchell, D.M.; Stenkamp, D.L. Endocrine regulation of multichromatic color vision. Proc. Natl. Acad. Sci. USA 2019, 116, 16882–16891. [Google Scholar] [CrossRef]
- Morris, A.; Fadool, J. Studying rod photoreceptor development in zebrafish. Physiol. Behav. 2005, 86, 306–313. [Google Scholar] [CrossRef]
- Volkov, L.I.; Kim-Han, J.S.; Saunders, L.M.; Poria, D.; Hughes, A.E.O.; Kefalov, V.J.; Parichy, D.M.; Corbo, J.C. Thyroid hormone receptors mediate two distinct mechanisms of long-wavelength vision. Proc. Natl. Acad. Sci. USA 2020, 117, 15262–15269. [Google Scholar] [CrossRef] [PubMed]
- Geysens, S.; Ferran, J.L.; Van Herck, S.L.J.; Tylzanowski, P.; Puelles, L.; Darras, V.M. Dynamic mRNA distribution pattern of thyroid hormone transporters and deiodinases during early embryonic chicken brain development. Neuroscience 2012, 221, 69–85. [Google Scholar] [CrossRef] [PubMed]
- Campinho, M.A.; Saraiva, J.; Florindo, C.; Power, D.M. Maternal Thyroid Hormones Are Essential for Neural Development in Zebrafish. Mol. Endocrinol. 2014, 28, 1136–1149. [Google Scholar] [CrossRef]
- Huang, S.A.; Dorfman, D.M.; Genest, D.R.; Salvatore, D.; Larsen, P.R. Type 3 Iodothyronine Deiodinase Is Highly Expressed in the Human Uteroplacental Unit and in Fetal Epithelium. J. Clin. Endocrinol. Metab. 2003, 88, 1384–1388. [Google Scholar] [CrossRef]
- Brown, D.D. The Role of Deiodinases in Amphibian Metamorphosis. Thyroid 2005, 15, 815–821. [Google Scholar] [CrossRef]
- Ng, L.; Hernandez, A.; He, W.; Ren, T.; Srinivas, M.; Ma, M.; Galton, V.A.; St. Germain, D.L.; Forrest, D. A Protective Role for Type 3 Deiodinase, a Thyroid Hormone-Inactivating Enzyme, in Cochlear Development and Auditory Function. Endocrinology 2009, 150, 1952–1960. [Google Scholar] [CrossRef]
- Ma, H.; Yang, F.; Ding, X.-Q. Inhibition of thyroid hormone signaling protects retinal pigment epithelium and photoreceptors from cell death in a mouse model of age-related macular degeneration. Cell Death Dis. 2020, 11, 24. [Google Scholar] [CrossRef] [PubMed]
- Wei, S.; Qiu, L.; Ru, S.; Yang, Y.; Wang, J.; Zhang, X. Bisphenol S disrupts opsins gene expression and impairs the light-sensing function via antagonizing TH-TRβ signaling pathway in zebrafish larvae. Food Chem. Toxicol. 2023, 172, 113588. [Google Scholar] [CrossRef] [PubMed]
- Bouzaffour, M.; Rampon, C.; Ramaugé, M.; Courtin, F.; Vriz, S. Implication of type 3 deiodinase induction in zebrafish fin regeneration. Gen. Comp. Endocrinol. 2010, 168, 88–94. [Google Scholar] [CrossRef]
- Little, A.G.; Seebacher, F. Thyroid hormone regulates cardiac performance during cold acclimation in Zebrafish (Danio rerio). J. Exp. Biol. 2013, 217 Pt 5, 718–725. [Google Scholar] [CrossRef]
- Stinckens, E.; Vergauwen, L.; Blackwell, B.R.; Ankley, G.T.; Villeneuve, D.L.; Knapen, D. Effect of Thyroperoxidase and Deiodinase Inhibition on Anterior Swim Bladder Inflation in the Zebrafish. Environ. Sci. Technol. 2020, 54, 6213–6223. [Google Scholar] [CrossRef] [PubMed]
- Farías-Serratos, B.M.; Lazcano, I.; Villalobos, P.; Darras, V.M.; Orozco, A. Thyroid hormone deficiency during zebrafish development impairs central nervous system myelination. PLoS ONE 2021, 16, e0256207. [Google Scholar] [CrossRef] [PubMed]
- Van Dingenen, I.; Vergauwen, L.; Haigis, A.-C.; Blackwell, B.R.; Stacy, E.; Villeneuve, D.L.; Knapen, D. Deiodinase inhibition impairs the formation of the three posterior swim bladder tissue layers during early embryonic development in zebrafish. Aquat. Toxicol. 2023, 261, 106632. [Google Scholar] [CrossRef] [PubMed]
- Powell, C.; Cornblath, E.; Elsaeidi, F.; Wan, J.; Goldman, D. Zebrafish Müller glia-derived progenitors are multipotent, exhibit proliferative biases and regenerate excess neurons. Sci. Rep. 2016, 6, 24851. [Google Scholar] [CrossRef]
- Krylov, A.; Yu, S.; Veen, K.; Newton, A.; Ye, A.; Qin, H.; He, J.; Jusuf, P.R. Heterogeneity in quiescent Müller glia in the uninjured zebrafish retina drive differential responses following photoreceptor ablation. Front. Mol. Neurosci. 2023, 16, 1087136. [Google Scholar] [CrossRef]
- Lyu, P.; Iribarne, M.; Serjanov, D.; Zhai, Y.; Hoang, T.; Campbell, L.J.; Boyd, P.; Palazzo, I.; Nagashima, M.; Silva, N.J.; et al. Common and divergent gene regulatory networks control injury-induced and developmental neurogenesis in zebrafish retina. Nat. Commun. 2023, 14, 8477. [Google Scholar] [CrossRef]
- Mitchell, D.M.; Lovel, A.G.; Stenkamp, D.L. Dynamic changes in microglial and macrophage characteristics during degeneration and regeneration of the zebrafish retina. J. Neuroinflammation 2018, 15, 163. [Google Scholar] [CrossRef]
- Marcus, R.C.; Delaney, C.L.; Easter, S.S. Neurogenesis in the visual system of embryonic and adult zebrafish (Danio rerio). Vis. Neurosci. 1999, 16, 417–424. [Google Scholar] [CrossRef]
- Hernández-Núñez, I.; Quelle-Regaldie, A.; Sánchez, L.; Adrio, F.; Candal, E.; Barreiro-Iglesias, A. Decline in Constitutive Proliferative Activity in the Zebrafish Retina with Ageing. Int. J. Mol. Sci. 2021, 22, 11715. [Google Scholar] [CrossRef]
- Johnston, J.; Esposti, F.; Lagnado, L. Color Vision: Retinal Blues. Curr. Biol. 2012, 22, R637–R639. [Google Scholar] [CrossRef]
- Zhou, M.; Bear, J.; Roberts, P.A.; Janiak, F.K.; Semmelhack, J.; Yoshimatsu, T.; Baden, T. Zebrafish Retinal Ganglion Cells Asymmetrically Encode Spectral and Temporal Information across Visual Space. Curr. Biol. 2020, 30, 2927–2942.e7. [Google Scholar] [CrossRef] [PubMed]
- Baden, T. Circuit mechanisms for colour vision in zebrafish. Curr. Biol. 2021, 31, R807–R820. [Google Scholar] [CrossRef]
- Thoreson, W.B.; Dacey, D.M. Diverse Cell Types, Circuits, and Mechanisms for Color Vision in the Vertebrate Retina. Physiol. Rev. 2019, 99, 1527–1573. [Google Scholar] [CrossRef]
- Racheva, K.; Totev, T.; Natchev, E.; Bocheva, N.; Beirne, R.; Zlatkova, M. Color discrimination assessment in patients with hypothyroidism using the Farnsworth–Munsell 100 hue test. J. Opt. Soc. Am. A 2020, 37, A18. [Google Scholar] [CrossRef]
- De Abreu, M.S.; Giacomini, A.C.V.V.; Genario, R.; Dos Santos, B.E.; Marcon, L.; Demin, K.A.; Galstyan, D.S.; Strekalova, T.; Amstislavskaya, T.G.; Kalueff, A.V. Color as an important biological variable in zebrafish models: Implications for translational neurobehavioral research. Neurosci. Biobehav. Rev. 2021, 124, 1–15. [Google Scholar] [CrossRef]
- Zhang, L.; Leung, Y.F. Microdissection of Zebrafish Embryonic Eye Tissues. J. Vis. Exp. 2010, 2028. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, research0034.1. [Google Scholar] [CrossRef]
- Chapman, G.B.; Tarboush, R.; Connaughton, V.P. The Effects of Rearing Light Level and Duration Differences on the Optic Nerve, Brain, and Associated Structures in Developing Zebrafish Larvae: A Light and Transmission Electron Microscope Study. Anat. Rec. 2012, 295, 515–531. [Google Scholar] [CrossRef] [PubMed]
- Lazcano, I.; Rodríguez-Ortiz, R.; Villalobos, P.; Martínez-Torres, A.; Solís-Saínz, J.C.; Orozco, A. Knock-Down of Specific Thyroid Hormone Receptor Isoforms Impairs Body Plan Development in Zebrafish. Front. Endocrinol. 2019, 10, 156. [Google Scholar] [CrossRef]
- Hammond-Weinberger, D.R.; ZeRuth, G.T. Whole Mount Immunohistochemistry in Zebrafish Embryos and Larvae. J. Vis. Exp. 2020, 155, e60575. [Google Scholar] [CrossRef]
Real-Time PCR Primers | |||||
---|---|---|---|---|---|
Gene Target | Sequence Identifiers | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Position | (pb) |
mct8 | NM_001258230 | gttcgggaagatcggagacc | aacacggcacactgaggaat | exon 5–6 | 111 |
thraa | NM_131396.1 | atggaaaacacagagcaggag | aggaacagagatgctcttgtc | exon 2–4 | 132 |
thrab | ENSDARG00000052654 | ggatggaaataaggtgaatggaac | ggtagtgatatccggtagctttg | exon 3–5 | 210 |
thrb | ENSDART00000189391.1 | gaaccacagccgttacacca | cactgcatctgagagaaatcc | exon 1 | 194 |
Dio2 | NM_212789.4 | gcagcgcatgttaaccacag | gttgtgggtcttaccgctga | exon 1–2 | 160 |
Dio3b | ENSDART00000131982.3 | agggctccgcaggtgtg | aggaagtccagcaggcaggg | exon 1 | 106 |
Opn1sw2 | NSDART00000011178.9 | gggcaccaattacaagcaag | aggttacatgagaactgtgt | exon 1–5 | 1005 |
Opn1mw1 | ENSDART00000002046.8 | cagcccagcacaagaaactc | agagcaacctgacctccaagt | exon 1–2 | 190 |
Opn1mw2 | ENSDART00000025241.5 | tttttggctggtcccgataca | caggaacgcagaaatgacagc | exon 1–2 | 132 |
Opn1lw1 | ENSDART00000065941.6 | cccacactgcatctcgacaa | aaggtattccccatcactccaa | exon 6 | 63 |
Opn1lw2 | ENSDART00000065940.6 | agagggaagaactggactttcaga | ttcagaggagttttgcctacatatgt | exon 7 | 77 |
Rho | ENSDART00000027000.9 | acttccgtttcggggagaac | gaaggactcgttgttgacac | exon 1 | 132 |
18s | BI897395.1 | gaacgccacttgtccctct | gttggtggagcgatttgtct | no exon | 118 |
Actin | NM_131031.2 | tgaatcccaaagccaacagag | ccagagtccatcacaataccag | exon 3–4 | 139 |
gDNA Primers | |||||
Gene target | Forward primer (5′-3′) | Reverse primer (5′-3′) | (pb) | ||
dio3b | ENSDARG00000095767 | cagtctgcgctgaagaacgc | gccgaagttgaggatcagcg | 363 | |
thrb | ENSDARG00000021163 | gacatagcccatggtgtaag | ctttcttatgtggcccttgc | 310 | |
Templates for in vitro transcription of sgRNAs | |||||
dio3b | taatacgactcactataGGGCGCGCGGCTCGGCGGAGgttttagagctagaa | ||||
trhb | taatacgactcactataGGGTGAGTTATGCACCATGGgttttagagctagaa | ||||
Generic | aaaagcaccgactcggcactttttcaagttgatagactagccttattttaacttgctatttctagctctaaaaac |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lazcano, I.; Pech-Pool, S.M.; Maldonado-Lira, M.F.; Olvera, A.; Darras, V.M.; Orozco, A. Ontogeny of Thyroid Hormone Signaling in the Retina of Zebrafish: Effects of Thyroidal Status on Retinal Morphology, Cell Survival, and Color Preference. Int. J. Mol. Sci. 2024, 25, 12215. https://doi.org/10.3390/ijms252212215
Lazcano I, Pech-Pool SM, Maldonado-Lira MF, Olvera A, Darras VM, Orozco A. Ontogeny of Thyroid Hormone Signaling in the Retina of Zebrafish: Effects of Thyroidal Status on Retinal Morphology, Cell Survival, and Color Preference. International Journal of Molecular Sciences. 2024; 25(22):12215. https://doi.org/10.3390/ijms252212215
Chicago/Turabian StyleLazcano, Iván, Santiago M. Pech-Pool, María Fernanda Maldonado-Lira, Aurora Olvera, Veerle M. Darras, and Aurea Orozco. 2024. "Ontogeny of Thyroid Hormone Signaling in the Retina of Zebrafish: Effects of Thyroidal Status on Retinal Morphology, Cell Survival, and Color Preference" International Journal of Molecular Sciences 25, no. 22: 12215. https://doi.org/10.3390/ijms252212215
APA StyleLazcano, I., Pech-Pool, S. M., Maldonado-Lira, M. F., Olvera, A., Darras, V. M., & Orozco, A. (2024). Ontogeny of Thyroid Hormone Signaling in the Retina of Zebrafish: Effects of Thyroidal Status on Retinal Morphology, Cell Survival, and Color Preference. International Journal of Molecular Sciences, 25(22), 12215. https://doi.org/10.3390/ijms252212215