Evaluation of a Novel Mechanical Device for the Production of Microfragmented Adipose Tissue for Veterinary Regenerative Medicine: A Proof-of-Concept
Abstract
1. Introduction
2. Results
2.1. Microfat Culture
2.2. Cell Count
2.3. Histological Analysis
2.4. Ad-MSCs Trilineage Differentiation
2.5. Gene Expression Analysis
2.6. Flow Cytometry
2.7. Effects of Microfat-Conditioned Medium on Cell Vitality
3. Discussion
4. Materials and Methods
4.1. Ethics Statement
4.2. Adipose Tissue Harvesting and Processing
4.3. Histological Analysis
4.4. Cell Expansion and Count
4.5. Determination of Cell-Doubling Time and Cell-Doubling Number
4.6. Ad-MSC Differentiation
- −
- Adipogenic differentiation: Cells were treated with adipogenic differentiation media according to the manufacturer’s instructions (StemPro Adipogenesis Differentiation Kit; Fisher Scientific, Hampton, NH, USA). The medium was changed every 2–3 days. After 21 days, the cells were fixed with 70% ethanol, and lipid vacuoles were visualized with Oil Red O staining [61].
- −
- Osteogenic differentiation: Cells were treated with osteogenic induction medium composed of complete medium supplemented with 100 nM dexamethasone, 10 mM glycerophosphate and 0.250 mM ascorbic acid. The medium was changed every 2–3 days. After 21 days, the cells were fixed with 1% paraformaldehyde, and extracellular calcified matrix deposition was visualized by Alizarin Red staining [61].
- −
- Chondrogenic differentiation: Cells were treated with chondrogenic differentiation media according to the manufacturer’s instructions (StemPro Chondrogenesis Differentiation Kit; Fisher Scientific, Hampton, NH, USA). The medium was changed every 2–3 days. After 21 days, the cells were fixed with 4% formaldehyde, and chondrogenic proteins were visualized by Alcian Blue staining [61].
4.7. Evaluation of the Viability of Fat Microfragments
4.8. Gene Expression Analysis
4.9. Flow Cytometry
4.10. Effects of Microfat-Conditioned Medium on Cell Vitality
4.11. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Watts, A.E. Use of Stem Cells for the Treatment of Musculoskeletal Injuries in Horses. Vet. Clin. N. Am. Equine Pract. 2023, 39, 475–487. [Google Scholar] [CrossRef]
- Ivanovska, A.; Wang, M.; Arshaghi, T.E.; Shaw, G.; Alves, J.; Byrne, A.; Butterworth, S.; Chandler, R.; Cuddy, L.; Dunne, J.; et al. Manufacturing Mesenchymal Stromal Cells for the Treatment of Osteoarthritis in Canine Patients: Challenges and Recommendations. Front. Vet. Sci. 2022, 9, 897150. [Google Scholar] [CrossRef] [PubMed]
- Williams, Z.J.; Pezzanite, L.M.; Chow, L.; Rockow, M.; Dow, S.W. Evaluation of Stem-Cell Therapies in Companion Animal Disease Models: A Concise Review (2015–2023). Stem Cells 2024, 42, 677–705. [Google Scholar] [CrossRef] [PubMed]
- Ribitsch, I.; Oreff, G.L.; Jenner, F. Regenerative Medicine for Equine Musculoskeletal Diseases. Animals 2021, 11, 234. [Google Scholar] [CrossRef]
- Barrett, J.G.; MacDonald, E.S. Use of Biologics and Stem Cells in the Treatment of Other Inflammatory Diseases in the Horse. Vet. Clin. N. Am. Equine Pract. 2023, 39, 553–563. [Google Scholar] [CrossRef] [PubMed]
- Voga, M.; Adamic, N.; Vengust, M.; Majdic, G. Stem Cells in Veterinary Medicine—Current State and Treatment Options. Front. Vet. Sci. 2020, 7, 278. [Google Scholar] [CrossRef] [PubMed]
- Johnson, V.; Chow, L.; Harrison, J.; Soontararak, S.; Dow, S. Activated Mesenchymal Stromal Cell Therapy for Treatment of Multi-Drug Resistant Bacterial Infections in Dogs. Front. Vet. Sci. 2022, 9, 925701. [Google Scholar] [CrossRef] [PubMed]
- Mocchi, M.; Dotti, S.; Bue, M.D.; Villa, R.; Bari, E.; Perteghella, S.; Torre, M.L.; Grolli, S. Veterinary Regenerative Medicine for Musculoskeletal Disorders: Can Mesenchymal Stem/Stromal Cells and Their Secretome Be the New Frontier? Cells 2020, 9, 1453. [Google Scholar] [CrossRef]
- Harman, R.M.; Marx, C.; Van de Walle, G.R. Translational Animal Models Provide Insight Into Mesenchymal Stromal Cell (MSC) Secretome Therapy. Front. Cell Dev. Biol. 2021, 9, 654885. [Google Scholar] [CrossRef]
- Colbath, A.C.; Dow, S.W.; McIlwraith, C.W.; Goodrich, L.R. Mesenchymal Stem Cells for Treatment of Musculoskeletal Disease in Horses: Relative Merits of Allogeneic versus Autologous Stem Cells. Equine Vet. J. 2020, 52, 654–663. [Google Scholar] [CrossRef]
- Rogers, C.J.; Harman, R.J.; Sheinkop, M.B.; Hanson, P.; Ambach, M.A.; David, T.; Desai, R.; Sampson, S.; Aufierro, D.; Bowen, J.; et al. Clinical Evaluation of Safety and Efficacy of a Central Current Good Manufacturing Practices Laboratory Produced Autologous Adipose-Derived Stromal Vascular Fraction Cell Therapy Product for the Treatment of Knee Osteoarthritis. Stem Cells Dev. 2024, 33, 168–176. [Google Scholar] [CrossRef] [PubMed]
- Hohmann, E.; Keough, N.; Frank, R.M.; Rodeo, S. Micro-Fragmented Adipose Tissue Demonstrates Comparable Clinical Efficacy to Other Orthobiologics Injections in Treating Symptomatic Knee Osteoarthritis. A Systematic Review of Level I-IV Clinical Studies. Arthrosc. J. Arthrosc. Relat. Surg. Off. Publ. Arthrosc. Assoc. N. Am. Int. Arthrosc. Assoc. 2024; in press. [Google Scholar] [CrossRef]
- Zeira, O.; Scaccia, S.; Pettinari, L.; Ghezzi, E.; Asiag, N.; Martinelli, L.; Zahirpour, D.; Dumas, M.P.; Konar, M.; Lupi, D.M.; et al. Intra-Articular Administration of Autologous Micro-Fragmented Adipose Tissue in Dogs with Spontaneous Osteoarthritis: Safety, Feasibility, and Clinical Outcomes. Stem Cells Transl. Med. 2018, 7, 819–828. [Google Scholar] [CrossRef] [PubMed]
- Kamm, J.L.; Riley, C.B.; Parlane, N.A.; Gee, E.K.; McIlwraith, C.W. Immune Response to Allogeneic Equine Mesenchymal Stromal Cells. Stem Cell Res. Ther. 2021, 12, 570. [Google Scholar] [CrossRef] [PubMed]
- Guest, D.J.; Dudhia, J.; Smith, R.K.W.; Roberts, S.J.; Conzemius, M.; Innes, J.F.; Fortier, L.A.; Meeson, R.L. Position Statement: Minimal Criteria for Reporting Veterinary and Animal Medicine Research for Mesenchymal Stromal/Stem Cells in Orthopedic Applications. Front. Vet. Sci. 2022, 9, 817041. [Google Scholar] [CrossRef] [PubMed]
- Dias, I.E.; Pinto, P.O.; Barros, L.C.; Viegas, C.A.; Dias, I.R.; Carvalho, P.P. Mesenchymal Stem Cells Therapy in Companion Animals: Useful for Immune-Mediated Diseases? BMC Vet. Res. 2019, 15, 358. [Google Scholar] [CrossRef] [PubMed]
- Jeon, B.-S.; Yi, H.; Ku, H.-O. International Regulatory Considerations Pertaining to the Development of Stem Cell-Based Veterinary Medicinal Products. J. Vet. Sci. 2021, 22, e6. [Google Scholar] [CrossRef] [PubMed]
- Stem Cell-Based Products for Veterinary Use: Specific Question on Target Animal Safety Addressed by CVMP/ADVENT—Scientific Guideline. European Medicines Agency. Available online: https://www.ema.europa.eu/en/stem-cell-based-products-veterinary-use-specific-question-target-animal-safety-addressed-cvmp-advent-scientific-guideline (accessed on 12 April 2024).
- European Medicines Agency. DogStem. Available online: https://www.ema.europa.eu/en/medicines/veterinary/EPAR/dogstem (accessed on 12 April 2024).
- European Medicines Agency. Arti-Cell Forte. Available online: https://www.ema.europa.eu/en/medicines/veterinary/EPAR/arti-cell-forte (accessed on 12 April 2024).
- Punzón, E.; Salgüero, R.; Totusaus, X.; Mesa-Sánchez, C.; Badiella, L.; García-Castillo, M.; Pradera, A. Equine Umbilical Cord Mesenchymal Stem Cells Demonstrate Safety and Efficacy in the Treatment of Canine Osteoarthritis: A Randomized Placebo-Controlled Trial. J. Am. Vet. Med. Assoc. 2022, 260, 1947–1955. [Google Scholar] [CrossRef]
- Broeckx, S.Y.; Seys, B.; Suls, M.; Vandenberghe, A.; Mariën, T.; Adriaensen, E.; Declercq, J.; Van Hecke, L.; Braun, G.; Hellmann, K.; et al. Equine Allogeneic Chondrogenic Induced Mesenchymal Stem Cells Are an Effective Treatment for Degenerative Joint Disease in Horses. Stem Cells Dev. 2019, 28, 410–422. [Google Scholar] [CrossRef]
- Barrachina, L.; Romero, A.; Zaragoza, P.; Rodellar, C.; Vázquez, F.J. Practical Considerations for Clinical Use of Mesenchymal Stem Cells: From the Laboratory to the Horse. Vet. J. Lond. Engl. 2018, 238, 49–57. [Google Scholar] [CrossRef]
- Pennasilico, L.; Di Bella, C.; Sassaroli, S.; Salvaggio, A.; Roggiolani, F.; Piccionello, A.P. Effects of Autologous Microfragmented Adipose Tissue on Healing of Tibial Plateau Levelling Osteotomies in Dogs: A Prospective Clinical Trial. Animals 2023, 13, 2084. [Google Scholar] [CrossRef]
- Ragni, E.; Viganò, M.; De Luca, P.; Pedrini, E.; de Girolamo, L. Adipose-Derived Stem/Stromal Cells, Stromal Vascular Fraction, and Microfragmented Adipose Tissue. In Orthobiologics: Injectable Therapies for the Musculoskeletal System; Filardo, G., Mandelbaum, B.R., Muschler, G.F., Rodeo, S.A., Nakamura, N., Eds.; Springer International Publishing: Cham, Switzerland, 2022; pp. 47–61. ISBN 978-3-030-84744-9. [Google Scholar]
- Greenwood, V.; Clausen, P.; Matuska, A.M. Micro-Fragmented Adipose Tissue Cellular Composition Varies by Processing Device and Analytical Method. Sci. Rep. 2022, 12, 16107. [Google Scholar] [CrossRef] [PubMed]
- Ceserani, V.; Ferri, A.; Berenzi, A.; Benetti, A.; Ciusani, E.; Pascucci, L.; Bazzucchi, C.; Coccè, V.; Bonomi, A.; Pessina, A.; et al. Angiogenic and Anti-Inflammatory Properties of Micro-Fragmented Fat Tissue and Its Derived Mesenchymal Stromal Cells. Vasc. Cell 2016, 8, 3. [Google Scholar] [CrossRef] [PubMed]
- Nava, S.; Sordi, V.; Pascucci, L.; Tremolada, C.; Ciusani, E.; Zeira, O.; Cadei, M.; Soldati, G.; Pessina, A.; Parati, E.; et al. Long-Lasting Anti-Inflammatory Activity of Human Microfragmented Adipose Tissue. Stem Cells Int. 2019, 2019, e5901479. [Google Scholar] [CrossRef] [PubMed]
- Frazier, T.; March, K.; Garza, J.R.; Bunnell, B.A.; Darr, K.F.; Rogers, E.; Hamel, K.; Gimble, J.M. Non-Homologous Use of Adipose-Derived Cell and Tissue Therapies: Osteoarthritis as a Case Study. Bone Rep. 2022, 17, 101601. [Google Scholar] [CrossRef]
- Zeira, O.; Ghezzi, E.; Pettinari, L.; Re, V.; Lupi, D.M.; Benali, S.L.; Borgonovo, S.; Alessandri, G.; Petrella, F.; Paroni, R.; et al. Case Report: Microfragmented Adipose Tissue Drug Delivery in Canine Mesothelioma: A Case Report on Safety, Feasibility, and Clinical Findings. Front. Vet. Sci. 2020, 7, 585427. [Google Scholar] [CrossRef]
- Alessandri, G.; Coccè, V.; Pastorino, F.; Paroni, R.; Dei Cas, M.; Restelli, F.; Pollo, B.; Gatti, L.; Tremolada, C.; Berenzi, A.; et al. Microfragmented Human Fat Tissue Is a Natural Scaffold for Drug Delivery: Potential Application in Cancer Chemotherapy. J. Control. Release 2019, 302, 2–18. [Google Scholar] [CrossRef]
- Egger, D.; Oliveira, A.C.; Mallinger, B.; Hemeda, H.; Charwat, V.; Kasper, C. From 3D to 3D: Isolation of Mesenchymal Stem/Stromal Cells into a Three-Dimensional Human Platelet Lysate Matrix. Stem Cell Res. Ther. 2019, 10, 248. [Google Scholar] [CrossRef]
- Esteves, C.L.; Donadeu, F.X. Pericytes in Veterinary Species: Prospective Isolation, Characterization and Tissue Regeneration Potential. In Pericyte Biology—Novel Concepts; Birbrair, A., Ed.; Springer International Publishing: Cham, Switzerland, 2018; pp. 67–77. ISBN 978-3-030-02601-1. [Google Scholar]
- Covas, D.T.; Panepucci, R.A.; Fontes, A.M.; Silva, W.A.; Orellana, M.D.; Freitas, M.C.C.; Neder, L.; Santos, A.R.D.; Peres, L.C.; Jamur, M.C.; et al. Multipotent Mesenchymal Stromal Cells Obtained from Diverse Human Tissues Share Functional Properties and Gene-Expression Profile with CD146+ Perivascular Cells and Fibroblasts. Exp. Hematol. 2008, 36, 642–654. [Google Scholar] [CrossRef]
- Esteves, C.L.; Sheldrake, T.A.; Dawson, L.; Menghini, T.; Rink, B.E.; Amilon, K.; Khan, N.; Péault, B.; Donadeu, F.X. Equine Mesenchymal Stromal Cells Retain a Pericyte-Like Phenotype. Stem Cells Dev. 2017, 26, 964–972. [Google Scholar] [CrossRef]
- Semenzato, M.; Zambello, L.; Fumarola, S.; Motta, E.; Piroli, L.; Scorrano, L.; Bean, C. A Novel Benchtop Device for Efficient and Simple Purification of Cytokines, Growth Factors and Stem Cells from Adipose Tissue. Biomedicines 2023, 11, 1006. [Google Scholar] [CrossRef]
- Fortier, L.A. Equine Bone Marrow Aspirate Concentrate. Vet. Clin. N. Am. Equine Pract. 2023, 39, 453–459. [Google Scholar] [CrossRef] [PubMed]
- Bahamondes, F.; Flores, E.; Cattaneo, G.; Bruna, F.; Conget, P. Omental Adipose Tissue Is a More Suitable Source of Canine Mesenchymal Stem Cells. BMC Vet. Res. 2017, 13, 166. [Google Scholar] [CrossRef] [PubMed]
- Hendawy, H.; Uemura, A.; Ma, D.; Namiki, R.; Samir, H.; Ahmed, M.F.; Elfadadny, A.; El-Husseiny, H.M.; Chieh-Jen, C.; Tanaka, R. Tissue Harvesting Site Effect on the Canine Adipose Stromal Vascular Fraction Quantity and Quality. Animals 2021, 11, 460. [Google Scholar] [CrossRef]
- Eigenberger, A.; Felthaus, O.; Schratzenstaller, T.; Haerteis, S.; Utpatel, K.; Prantl, L. The Effects of Shear Force-Based Processing of Lipoaspirates on White Adipose Tissue and the Differentiation Potential of Adipose Derived Stem Cells. Cells 2022, 11, 2543. [Google Scholar] [CrossRef] [PubMed]
- Andreoli, V.; Berni, P.; Conti, V.; Ramoni, R.; Basini, G.; Grolli, S. Mesenchymal Stromal Cells Derived from Canine Adipose Tissue: Evaluation of the Effect of Different Shipping Vehicles Used for Clinical Administration. Int. J. Mol. Sci. 2024, 25, 3426. [Google Scholar] [CrossRef] [PubMed]
- Scattini, G.; Pellegrini, M.; Severi, G.; Cagiola, M.; Pascucci, L. The Stromal Vascular Fraction from Canine Adipose Tissue Contains Mesenchymal Stromal Cell Subpopulations That Show Time-Dependent Adhesion to Cell Culture Plastic Vessels. Animals 2023, 13, 1175. [Google Scholar] [CrossRef] [PubMed]
- Bikorimana, J.-P.; Saad, W.; Abusarah, J.; Lahrichi, M.; Talbot, S.; Shammaa, R.; Rafei, M. CD146 Defines a Mesenchymal Stromal Cell Subpopulation with Enhanced Suppressive Properties. Cells 2022, 11, 2263. [Google Scholar] [CrossRef] [PubMed]
- Murphy, M.B.; Moncivais, K.; Caplan, A.I. Mesenchymal Stem Cells: Environmentally Responsive Therapeutics for Regenerative Medicine. Exp. Mol. Med. 2013, 45, e54. [Google Scholar] [CrossRef]
- Eleuteri, S.; Fierabracci, A. Insights into the Secretome of Mesenchymal Stem Cells and Its Potential Applications. Int. J. Mol. Sci. 2019, 20, 4597. [Google Scholar] [CrossRef]
- Shahsavari, A.; Weeratunga, P.; Ovchinnikov, D.A.; Whitworth, D.J. Pluripotency and Immunomodulatory Signatures of Canine Induced Pluripotent Stem Cell-Derived Mesenchymal Stromal Cells Are Similar to Harvested Mesenchymal Stromal Cells. Sci. Rep. 2021, 11, 3486. [Google Scholar] [CrossRef]
- Ling, L.; Hou, J.; Liu, D.; Tang, D.; Zhang, Y.; Zeng, Q.; Pan, H.; Fan, L. Important Role of the SDF-1/CXCR4 Axis in the Homing of Systemically Transplanted Human Amnion-Derived Mesenchymal Stem Cells (hAD-MSCs) to Ovaries in Rats with Chemotherapy-Induced Premature Ovarian Insufficiency (POI). Stem Cell Res. Ther. 2022, 13, 79. [Google Scholar] [CrossRef]
- Bartosh, T.J.; Ylöstalo, J.H.; Bazhanov, N.; Kuhlman, J.; Prockop, D.J. Dynamic Compaction of Human Mesenchymal Stem/Precursor Cells (MSC) into Spheres Self-Activates Caspase-Dependent IL1 Signaling to Enhance Secretion of Modulators of Inflammation and Immunity (PGE2, TSG6 and STC1). Stem Cells Dayt. Ohio 2013, 31, 2443–2456. [Google Scholar] [CrossRef] [PubMed]
- Fan, X.-L.; Zhang, Y.; Li, X.; Fu, Q.-L. Mechanisms Underlying the Protective Effects of Mesenchymal Stem Cell-Based Therapy. Cell. Mol. Life Sci. 2020, 77, 2771–2794. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Liu, Y.; Ding, H.; Shi, X.; Ren, H. Mesenchymal Stem Cell-Secreted Prostaglandin E2 Ameliorates Acute Liver Failure via Attenuation of Cell Death and Regulation of Macrophage Polarization. Stem Cell Res. Ther. 2021, 12, 15. [Google Scholar] [CrossRef] [PubMed]
- Hayashi, Y.; Murakami, M.; Kawamura, R.; Ishizaka, R.; Fukuta, O.; Nakashima, M. CXCL14 and MCP1 Are Potent Trophic Factors Associated with Cell Migration and Angiogenesis Leading to Higher Regenerative Potential of Dental Pulp Side Population Cells. Stem Cell Res. Ther. 2015, 6, 111. [Google Scholar] [CrossRef] [PubMed]
- Whelan, D.S.; Caplice, N.M.; Clover, A.J.P. Mesenchymal Stromal Cell Derived CCL2 Is Required for Accelerated Wound Healing. Sci. Rep. 2020, 10, 2642. [Google Scholar] [CrossRef]
- Zhang, X.; Zhang, S.; Wang, T. How the Mechanical Microenvironment of Stem Cell Growth Affects Their Differentiation: A Review. Stem Cell Res. Ther. 2022, 13, 415. [Google Scholar] [CrossRef]
- Espina, J.A.; Cordeiro, M.H.; Milivojevic, M.; Pajić-Lijaković, I.; Barriga, E.H. Response of Cells and Tissues to Shear Stress. J. Cell Sci. 2023, 136, jcs260985. [Google Scholar] [CrossRef]
- Huang, Y.; Qian, J.-Y.; Cheng, H.; Li, X.-M. Effects of Shear Stress on Differentiation of Stem Cells into Endothelial Cells. World J. Stem Cells 2021, 13, 894–913. [Google Scholar] [CrossRef]
- You, X.; Gao, J.; Yao, Y. Advanced Methods to Mechanically Isolate Stromal Vascular Fraction: A Concise Review. Regen. Ther. 2024, 27, 120–125. [Google Scholar] [CrossRef]
- Favaretto, F.; Compagnin, C.; Cogliati, E.; Montagner, G.; Dell’Antonia, F.; Berna, G.; Vettor, R.; Milan, G.; Trojan, D. Characterization of Human Subcutaneous Adipose Tissue and Validation of the Banking Procedure for Autologous Transplantation. Int. J. Mol. Sci. 2023, 24, 8190. [Google Scholar] [CrossRef] [PubMed]
- Bancroft, J.D. Theory and Practice of Histological Techniques; Elsevier Health Sciences: Amsterdam, The Netherlands, 2008; ISBN 978-0-443-10279-0. [Google Scholar]
- Vidal, M.A.; Kilroy, G.E.; Johnson, J.R.; Lopez, M.J.; Moore, R.M.; Gimble, J.M. Cell Growth Characteristics and Differentiation Frequency of Adherent Equine Bone Marrow-Derived Mesenchymal Stromal Cells: Adipogenic and Osteogenic Capacity. Vet. Surg. 2006, 35, 601–610. [Google Scholar] [CrossRef] [PubMed]
- Roth, V. Doubling Time—Online Computing with 2 Points. Available online: https://www.doubling-time.com/compute.php (accessed on 5 August 2024).
- Ivanovska, A.; Grolli, S.; Borghetti, P.; Ravanetti, F.; Conti, V.; De Angelis, E.; Macchi, F.; Ramoni, R.; Martelli, P.; Gazza, F.; et al. Immunophenotypical Characterization of Canine Mesenchymal Stem Cells from Perivisceral and Subcutaneous Adipose Tissue by a Species-Specific Panel of Antibodies. Res. Vet. Sci. 2017, 114, 51–58. [Google Scholar] [CrossRef] [PubMed]











| Marker | Enzymatic Method | Mechanical Method |
|---|---|---|
| CD29 | 87.78 ± 10.50 | 88.37 ± 9.96 |
| CD90 | 99.73 ± 0.33 | 99.52 ± 0.71 |
| CD44 | 82.91 ± 5.87 | 79.41 ± 10.13 |
| CD45 | 0.02 ± 0.04 | 0.02 ± 0.04 |
| CD14 | 0.05 ± 0.05 | 0.15 ± 0.25 |
| MHC II | 0.06 ± 0.11 | 0.17 ± 0.30 |
| CD31 | 0.12 ± 0.01 | 0.30 ± 0.34 |
| CD146 | 0.76 ± 1.26 | 5.91 ± 10.18 |
| Dog | Breed | Sex | Age (years) | Weight (kg) |
|---|---|---|---|---|
| 1 | Setter | M | 2 | 15 |
| 2 | Labrador retriever | M | 8 | 39 |
| 3 | Australian shepherd | F | 3 | 20 |
| 4 | Labrador retriever | F | 5 | 30 |
| Gene | Primer Sequence | Accession Number Amplicon Size |
|---|---|---|
| TSG-6 | Fw: AATCGGATTTCACGTCTGCG | XM_533354.7 |
| Rv: CACCACACTCCTTTGCATGT | 182 bp | |
| SDF-1 | Fw: GCCGATTCTTCGAGAGCCAC | NM_001308461.1 |
| Rv: TCTGCCATACGCTGTTAGCTT | 240 bp | |
| IL-1-RA | Fw: GAAGAGACCTTGCAGGATGC | AF216526 |
| Rv: GACGGGCACCACATCTAACT | 141 bp | |
| STC-1 | Fw: CACTTCTCCAACAGATACT | XM_543238 |
| Rv: CATGTTGGGCCCAATTTTC | 110 bp | |
| COX-2 | Fw: GATCATAAGCGAGGACCAGCTTTC | NM_001003354.1 |
| Rv: GGCGCAGTTTATGTTGTCTATCCA | 100 bp | |
| PGES | Fw: GTATTGCCGGAGTGACCAGGA | NM_001122854.1 |
| Rv: AGTGCATCTGGGCGATGAAAG | 136 bp | |
| CCL-2 | Fw: TCCTCTGCCTGCTGCTCATAG | NM_001003297.1 |
| Rv: GCAGCAGGTGACTGGAGAAATAA | 86 bp | |
| CXCR-4 | Fw: GAGCGGTTACCATGGAAGAG | NM_001048026.1 |
| Rv: CGGTTGAAGTGAGCATTTTCC | 108 bp | |
| GAPDH | Fw: GATGGGCGTGAACCATGAGA | NM_001003142.2 |
| Rv: AGTGGTCATGGATGACTTTGGCTA | 107 bp |
| Antibody | Producer | Code |
|---|---|---|
| CD14 monoclonal antibody (Tuk4) FITC | ThermoFisher Scientific (Carlsbad, CA 92008, USA) | MA1-82074 |
| CD29 anti-human antibody (TS2/16) PE | BioLegend (San Diego, CA, USA) | 303004 |
| CD90 monoclonal antibody (YKIX337.217) PE | ThermoFisher Scientific (Carlsbad, CA 92008, USA) | 12-5900-42 |
| CD44 monoclonal antibody (YKIX337.8) FITC | ThermoFisher Scientific (Carlsbad, CA 92008, USA) | 11-5440-42 |
| CD45 monoclonal antibody (YKIX716.13) PE | Biorad (Hercules, CA, USA) | MCA1042PE |
| CD146 monoclonal antibody (P1H12) FITC | ThermoFisher Scientific (Carlsbad, CA 92008, USA) | 11-1469-42 |
| CD31 polyclonal antibody PE | Bioss Antibodies (Woburn, MA, USA) | bs-0468R-PE |
| Rat anti-dog MHC Class II monomorphic (YKIX334.2) FITC | Biorad (Hercules, CA, USA) | MCA1044F |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Berni, P.; Andreoli, V.; Conti, V.; Ramoni, R.; Basini, G.; Scattini, G.; Pascucci, L.; Pellegrini, M.; Del Bue, M.; Squassino, G.P.; et al. Evaluation of a Novel Mechanical Device for the Production of Microfragmented Adipose Tissue for Veterinary Regenerative Medicine: A Proof-of-Concept. Int. J. Mol. Sci. 2024, 25, 11854. https://doi.org/10.3390/ijms252111854
Berni P, Andreoli V, Conti V, Ramoni R, Basini G, Scattini G, Pascucci L, Pellegrini M, Del Bue M, Squassino GP, et al. Evaluation of a Novel Mechanical Device for the Production of Microfragmented Adipose Tissue for Veterinary Regenerative Medicine: A Proof-of-Concept. International Journal of Molecular Sciences. 2024; 25(21):11854. https://doi.org/10.3390/ijms252111854
Chicago/Turabian StyleBerni, Priscilla, Valentina Andreoli, Virna Conti, Roberto Ramoni, Giuseppina Basini, Gabriele Scattini, Luisa Pascucci, Martina Pellegrini, Maurizio Del Bue, Gian Paolo Squassino, and et al. 2024. "Evaluation of a Novel Mechanical Device for the Production of Microfragmented Adipose Tissue for Veterinary Regenerative Medicine: A Proof-of-Concept" International Journal of Molecular Sciences 25, no. 21: 11854. https://doi.org/10.3390/ijms252111854
APA StyleBerni, P., Andreoli, V., Conti, V., Ramoni, R., Basini, G., Scattini, G., Pascucci, L., Pellegrini, M., Del Bue, M., Squassino, G. P., Paino, F., Pessina, A., Alessandri, G., Pirazzoli, P., Bosetto, A., & Grolli, S. (2024). Evaluation of a Novel Mechanical Device for the Production of Microfragmented Adipose Tissue for Veterinary Regenerative Medicine: A Proof-of-Concept. International Journal of Molecular Sciences, 25(21), 11854. https://doi.org/10.3390/ijms252111854

