Transcriptome Sequencing-Based Screening of Key Melatonin-Related Genes in Ischemic Stroke
Abstract
1. Introduction
2. Results
2.1. Identification of Differential Genes
2.2. Screening of Signature Genes
2.3. Construction of the PPI Network and XGBoost Model
2.4. Enrichment Analysis
2.5. Expression Levels and Diagnostic Significance of Key Genes
2.6. miRNA–TF–mRNA Analysis
2.7. Hub Gene Enrichment
2.8. Correlation of Hub Genes with Immune Infiltrating Cells
2.9. scRNA Profiling in IS
2.10. Drug Prediction for IS Therapy
2.11. Molecular Docking of the Four Core Genes
2.12. Key Gene Validation
3. Discussion
4. Materials and Methods
4.1. Data Acquisition and Pre-Processing
4.2. Identification of Differentially Expressed Genes
4.3. Support Vector Machine, Random Forest, and Least Absolute Shrinkage with Selection Operator Model Construction
4.4. PPI Analysis and XGBoot Model Construction
4.5. Enrichment Analysis and Assessment of Hub Gene Diagnosticity
4.6. miRNA–TF–mRNA Regulatory Network Analysis
4.7. Hub Gene Enrichment Analysis and Immune Infiltration
4.8. Analysis of Single-Cell Data and Intercellular Communication
4.9. CMAP Analysis
4.10. Protein–Ligand Interaction Analysis
4.11. Animals and MACO Modelling
4.12. RNA Extraction and qPCR
4.13. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wang, W.; Jiang, B.; Sun, H.; Ru, X.; Sun, D.; Wang, L.; Wang, L.; Jiang, Y.; Li, Y.; Wang, Y.; et al. Prevalence, Incidence, and Mortality of Stroke in China. Circulation 2017, 135, 759–771. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Liu, J.; Liu, M.; Lu, C.; Brainin, M.; Zhang, J. Patterns of Stroke Between University Hospitals and Nonuniversity Hospitals in Mainland China: Prospective Multicenter Hospital-Based Registry Study. World Neurosurg. 2017, 98, 258–265. [Google Scholar] [CrossRef] [PubMed]
- Barthels, D.; Das, H. Current advances in ischemic stroke research and therapies. Biochim. Biophys. Acta (BBA) Mol. Basis Dis. 2020, 1866, 165260. [Google Scholar] [CrossRef]
- Kahles, T.; Brandes, R.P. NADPH oxidases as therapeutic targets in ischemic stroke. Cell. Mol. Life Sci. 2012, 69, 2345–2363. [Google Scholar] [CrossRef] [PubMed]
- Allen, C.L.; Bayraktutan, U. Oxidative Stress and Its Role in the Pathogenesis of Ischaemic Stroke. Int. J. Stroke 2009, 4, 461–470. [Google Scholar] [CrossRef]
- Nathan, C.; Ding, A. SnapShot: Reactive Oxygen Intermediates (ROI). Cell 2010, 140, 951–951.e2. [Google Scholar] [CrossRef]
- Alsbrook, D.L.; Di Napoli, M.; Bhatia, K.; Biller, J.; Andalib, S.; Hinduja, A.; Rodrigues, R.; Rodriguez, M.; Sabbagh, S.Y.; Selim, M.; et al. Neuroinflammation in Acute Ischemic and Hemorrhagic Stroke. Curr. Neurol. Neurosci. Rep. 2023, 23, 407–431. [Google Scholar] [CrossRef]
- Zhao, Y.; Zhang, X.; Chen, X.; Wei, Y. Neuronal injuries in cerebral infarction and ischemic stroke: From mechanisms to treatment (Review). Int. J. Mol. Med. 2021, 49, 15. [Google Scholar] [CrossRef]
- Wardlaw, J.M.; Murray, V.; Berge, E.; Del Zoppo, G.J. Thrombolysis for acute ischaemic stroke. Cochrane Database Syst. Rev. 2014, 2014, CD000213. [Google Scholar] [CrossRef]
- Chen, S.; Zhang, Z.-Y.; Fang, Y.-J.; Luo, Y.-J.; Lenahan, C.; Zhang, J.-M. The role of medical gas in stroke: An updated review. Med. Gas Res. 2019, 9, 221. [Google Scholar] [CrossRef]
- Cui, Q. Modifiable and non-modifiable risk factors in ischemic stroke: A meta-analysis. Afr. Health Sci. 2019, 19, 2121. [Google Scholar] [CrossRef] [PubMed]
- Dichgans, M.; Pulit, S.L.; Rosand, J. Stroke genetics: Discovery, biology, and clinical applications. Lancet Neurol. 2019, 18, 587–599. [Google Scholar] [CrossRef] [PubMed]
- Caprio, F.Z.; Sorond, F.A. Cerebrovascular Disease. Med. Clin. N. Am. 2019, 103, 295–308. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Gao, S.; Lenahan, C.; Gu, Y.; Wang, X.; Fang, Y.; Xu, W.; Wu, H.; Pan, Y.; Shao, A.; et al. Melatonin as an Antioxidant Agent in Stroke: An Updated Review. Aging Dis. 2022, 13, 1823. [Google Scholar] [CrossRef]
- Pei, Z.; Pang, S.F.; Cheung, R.T.F. Pretreatment with melatonin reduces volume of cerebral infarction in a rat middle cerebral artery occlusion stroke model. J. Pineal Res. 2002, 32, 168–172. [Google Scholar] [CrossRef]
- Feng, D.; Wang, B.; Wang, L.; Abraham, N.; Tao, K.; Huang, L.; Shi, W.; Dong, Y.; Qu, Y. Pre-ischemia melatonin treatment alleviated acute neuronal injury after ischemic stroke by inhibiting endoplasmic reticulum stress-dependent autophagy via PERK and IRE1 signalings. J. Pineal Res. 2017, 62, e12395. [Google Scholar] [CrossRef]
- Chen, B.H.; Park, J.H.; Lee, Y.L.; Kang, I.J.; Kim, D.W.; Hwang, I.K.; Lee, C.-H.; Yan, B.C.; Kim, Y.-M.; Lee, T.-K.; et al. Melatonin improves vascular cognitive impairment induced by ischemic stroke by remyelination via activation of ERK1/2 signaling and restoration of glutamatergic synapses in the gerbil hippocampus. Biomed. Pharmacother. 2018, 108, 687–697. [Google Scholar] [CrossRef]
- Liu, Z.J.; Ran, Y.Y.; Qie, S.Y.; Gong, W.J.; Gao, F.H.; Ding, Z.T.; Xi, J.N. Melatonin protects against ischemic stroke by modulating microglia/macrophage polarization toward anti-inflammatory phenotype through STAT3 pathway. CNS Neurosci. Ther. 2019, 25, 1353–1362. [Google Scholar] [CrossRef]
- Tengattini, S.; Reiter, R.J.; Tan, D.X.; Terron, M.P.; Rodella, L.F.; Rezzani, R. Cardiovascular diseases: Protective effects of melatonin. J. Pineal Res. 2008, 44, 16–25. [Google Scholar] [CrossRef]
- Moras, M.; Lefevre, S.D.; Ostuni, M.A. From Erythroblasts to Mature Red Blood Cells: Organelle Clearance in Mammals. Front. Physiol. 2017, 8, 1076. [Google Scholar] [CrossRef]
- Rudra, D.S.; Pal, U.; Maiti, N.C.; Reiter, R.J.; Swarnakar, S. Melatonin inhibits matrix metalloproteinase-9 activity by binding to its active site. J. Pineal Res. 2013, 54, 398–405. [Google Scholar] [CrossRef] [PubMed]
- Mayo, J.C.; Sainz, R.M.; Tan, D.-X.; Hardeland, R.; Leon, J.; Rodriguez, C.; Reiter, R.J. Anti-inflammatory actions of melatonin and its metabolites, N1-acetyl-N2-formyl-5-methoxykynuramine (AFMK) and N1-acetyl-5-methoxykynuramine (AMK), in macrophages. J. Neuroimmunol. 2005, 165, 139–149. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; He, C. Nrf2-mediated anti-inflammatory polarization of macrophages as therapeutic targets for osteoarthritis. Front. Immunol. 2022, 13, 967193. [Google Scholar] [CrossRef] [PubMed]
- Tao, T.; Liu, M.; Chen, M.; Luo, Y.; Wang, C.; Xu, T.; Jiang, Y.; Guo, Y.; Zhang, J.H. Natural medicine in neuroprotection for ischemic stroke: Challenges and prospective. Pharmacol. Ther. 2020, 216, 107695. [Google Scholar] [CrossRef]
- Jahan, R.; Saver, J.L.; Schwamm, L.H.; Fonarow, G.C.; Liang, L.; Matsouaka, R.A.; Xian, Y.; Holmes, D.N.; Peterson, E.D.; Yavagal, D.; et al. Association Between Time to Treatment With Endovascular Reperfusion Therapy and Outcomes in Patients With Acute Ischemic Stroke Treated in Clinical Practice. JAMA 2019, 322, 252. [Google Scholar] [CrossRef]
- Reiter, R.J.; Tan, D.-X.; Rosales-Corral, S.; Manchester, L.C. The Universal Nature, Unequal Distribution and Antioxidant Functions of Melatonin and Its Derivatives. Mini-Rev. Med. Chem. 2013, 13, 373–384. [Google Scholar]
- Onaolapo, A.Y.; Onaolapo, O.J.; Nathaniel, T.I. Cerebrovascular Disease in the Young Adult: Examining Melatonin’s Possible Multiple Roles. J. Exp. Neurosci. 2019, 13, 117906951982730. [Google Scholar] [CrossRef]
- Talbot, N.C.; Luther, P.M.; Spillers, N.J.; Ragland, A.R.; Kidder, E.J.; Kelkar, R.A.; Varrassi, G.; Ahmadzadeh, S.; Shekoohi, S.; Kaye, A.D. Neuroprotective Potential of Melatonin: Evaluating Therapeutic Efficacy in Alzheimer’s and Parkinson’s Diseases. Cureus 2023, 15, e50948. [Google Scholar] [CrossRef]
- Li, Z.; Bi, R.; Sun, S.; Chen, S.; Chen, J.; Hu, B.; Jin, H. The Role of Oxidative Stress in Acute Ischemic Stroke-Related Thrombosis. Oxidative Med. Cell. Longev. 2022, 2022, 8418820. [Google Scholar] [CrossRef]
- Fesharaki-Zadeh, A. Oxidative Stress in Traumatic Brain Injury. Int. J. Mol. Sci. 2022, 23, 13000. [Google Scholar] [CrossRef]
- Farhood, B.; Goradel, N.H.; Mortezaee, K.; Khanlarkhani, N.; Najafi, M.; Sahebkar, A. Melatonin and cancer: From the promotion of genomic stability to use in cancer treatment. J. Cell. Physiol. 2019, 234, 5613–5627. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, C.; Mayo, J.C.; Sainz, R.M.; Antolín, I.; Herrera, F.; Martín, V.; Reiter, R.J. Regulation of antioxidant enzymes: A significant role for melatonin. J. Pineal Res. 2004, 36, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Moldovan, M.; Constantinescu, A.O.; Balseanu, A.; Oprescu, N.; Zagrean, L.; Popa-Wagner, A. Sleep deprivation attenuates experimental stroke severity in rats. Exp. Neurol. 2010, 222, 135–143. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.; Wan, J.; Chen, Y.; Wang, Z.; Hui, L.; Li, Y.; Xu, D.; Zhou, W. Inhibitory effects of p38 inhibitor against mitochondrial dysfunction in the early brain injury after subarachnoid hemorrhage in mice. Brain Res. 2013, 1517, 133–140. [Google Scholar] [CrossRef]
- Gladbach, A.; Van Eersel, J.; Bi, M.; Ke, Y.D.; Ittner, L.M. ERK inhibition with PD184161 mitigates brain damage in a mouse model of stroke. J. Neural Transm. 2013, 121, 543–547. [Google Scholar] [CrossRef]
- Hou, K.; Xiao, Z.-C.; Dai, H.-L. p38 MAPK Endogenous Inhibition Improves Neurological Deficits in Global Cerebral Ischemia/Reperfusion Mice. Neural Plast. 2022, 2022, 3300327. [Google Scholar] [CrossRef]
- Kang, J.Q.; Chong, Z.Z.; Maiese, K. Akt1 protects against inflammatory microglial activation through maintenance of membrane asymmetry and modulation of cysteine protease activity. J. Neurosci. Res. 2003, 74, 37–51. [Google Scholar] [CrossRef]
- Lee, S.H.; Chun, W.; Kong, P.J.; Han, J.A.; Cho, B.P.; Kwon, O.Y.; Lee, H.J.; Kim, S.S. Sustained activation of Akt by melatonin contributes to the protection against kainic acid-induced neuronal death in hippocampus. J. Pineal Res. 2006, 40, 79–85. [Google Scholar] [CrossRef]
- Hinson, J.P.; Kapas, S.; Smith, D.M. Adrenomedullin, a Multifunctional Regulatory Peptide*. Endocr. Rev. 2000, 21, 138–167. [Google Scholar]
- Bassat, E.; Mutlak, Y.E.; Genzelinakh, A.; Shadrin, I.Y.; Baruch Umansky, K.; Yifa, O.; Kain, D.; Rajchman, D.; Leach, J.; Riabov Bassat, D.; et al. The extracellular matrix protein agrin promotes heart regeneration in mice. Nature 2017, 547, 179–184. [Google Scholar] [CrossRef]
- Feng, J.; Li, Y.; Li, Y.; Yin, Q.; Li, H.; Li, J.; Zhou, B.; Meng, J.; Lian, H.; Wu, M.; et al. Versican Promotes Cardiomyocyte Proliferation and Cardiac Repair. Circulation 2024, 149, 1004–1015. [Google Scholar] [CrossRef] [PubMed]
- Ma, S.L.; Tang, N.L.S.; Zhang, Y.P.; Ji, L.-D.; Tam, C.W.C.; Lui, V.W.C.; Chiu, H.F.K.; Lam, L.C.W. Association of prostaglandin-endoperoxide synthase 2 (PTGS2) polymorphisms and Alzheimer’s disease in Chinese. Neurobiol. Aging 2008, 29, 856–860. [Google Scholar] [CrossRef] [PubMed]
- Oliveira-Filho, J.; Ornellas, A.C.P.; Zhang, C.R.; Oliveira, L.M.B.; Araújo-Santos, T.; Borges, V.M.; Ventura, L.M.G.B.; Reis, F.J.F.B.; Aras, R.; Fernandes, A.M.; et al. COX-2 rs20417 Polymorphism Is Associated with Stroke and White Matter Disease. J. Stroke Cerebrovasc. Dis. 2015, 24, 1817–1822. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Z.; Lu, C.; Meng, S.; Dun, L.; Yin, N.; An, H.; Xu, H.; Liu, G.; Cai, Y. Silencing of PTGS2 exerts promoting effects on angiogenesis endothelial progenitor cells in mice with ischemic stroke via repression of the NF-κB signaling pathway. J. Cell. Physiol. 2019, 234, 23448–23460. [Google Scholar] [CrossRef]
- Bi, J.; Shan, W.; Luo, A.; Zuo, Z. Critical role of matrix metallopeptidase 9 in postoperative cognitive dysfunction and age-dependent cognitive decline. Oncotarget 2017, 8, 51817–51829. [Google Scholar] [CrossRef]
- Noble, W.S. What is a support vector machine? Nat. Biotechnol. 2006, 24, 1565–1567. [Google Scholar] [CrossRef]
- Paul, A.; Mukherjee, D.P.; Das, P.; Gangopadhyay, A.; Chintha, A.R.; Kundu, S. Improved Random Forest for Classification. IEEE Trans. Image Process. 2018, 27, 4012–4024. [Google Scholar] [CrossRef]
- Vasquez, M.M.; Hu, C.; Roe, D.J.; Chen, Z.; Halonen, M.; Guerra, S. Least absolute shrinkage and selection operator type methods for the identification of serum biomarkers of overweight and obesity: Simulation and application. BMC Med. Res. Methodol. 2016, 16, 154. [Google Scholar] [CrossRef]
- Wolbers, M.; Koller, M.T.; Witteman, J.C.M.; Steyerberg, E.W. Prognostic Models With Competing Risks. Epidemiology 2009, 20, 555–561. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.-G.; Han, Y.; He, Q.-Y. clusterProfiler: An R Package for Comparing Biological Themes Among Gene Clusters. OMICS J. Integr. Biol. 2012, 16, 284–287. [Google Scholar] [CrossRef]
- Zhou, G.; Soufan, O.; Ewald, J.; Hancock, R.E.W.; Basu, N.; Xia, J. NetworkAnalyst 3.0: A visual analytics platform for comprehensive gene expression profiling and meta-analysis. Nucleic Acids Res. 2019, 47, W234–W241. [Google Scholar] [CrossRef] [PubMed]
- Hänzelmann, S.; Castelo, R.; Guinney, J. GSVA: Gene set variation analysis for microarray and RNA-Seq data. BMC Bioinform. 2013, 14, 7. [Google Scholar] [CrossRef] [PubMed]
- Chen, B.; Khodadoust, M.S.; Liu, C.L.; Newman, A.M.; Alizadeh, A.A. Profiling Tumor Infiltrating Immune Cells with CIBERSORT; Springer: New York, NY, USA, 2018; pp. 243–259. [Google Scholar]
- Gribov, A.; Sill, M.; Lück, S.; Rücker, F.; Döhner, K.; Bullinger, L.; Benner, A.; Unwin, A. SEURAT: Visual analytics for the integrated analysis of microarray data. BMC Med. Genom. 2010, 3, 21. [Google Scholar] [CrossRef]
- Becht, E.; McInnes, L.; Healy, J.; Dutertre, C.-A.; Kwok, I.W.H.; Ng, L.G.; Ginhoux, F.; Newell, E.W. Dimensionality reduction for visualizing single-cell data using UMAP. Nat. Biotechnol. 2019, 37, 38–44. [Google Scholar] [CrossRef]
- Hu, C.; Li, T.; Xu, Y.; Zhang, X.; Li, F.; Bai, J.; Chen, J.; Jiang, W.; Yang, K.; Ou, Q.; et al. CellMarker 2.0: An updated database of manually curated cell markers in human/mouse and web tools based on scRNA-seq data. Nucleic Acids Res. 2023, 51, D870–D876. [Google Scholar] [CrossRef]
- Jin, X.-F.; Wang, S.; Shen, M.; Wen, X.; Han, X.-R.; Wu, J.-C.; Tang, G.-Z.; Wu, D.-M.; Lu, J.; Zheng, Y.-L. RETRACTED: Effects of rehabilitation training on apoptosis of nerve cells and the recovery of neural and motor functions in rats with ischemic stroke through the PI3K/Akt and Nrf2/ARE signaling pathways. Brain Res. Bull. 2017, 134, 236–245. [Google Scholar] [CrossRef]
- Chiang, T.; Messing, R.O.; Chou, W.-H. Mouse Model of Middle Cerebral Artery Occlusion. J. Vis. Exp. 2011, 48, 2761. [Google Scholar] [CrossRef]
Genes | Primers (5′–3′) | |
---|---|---|
Adm | F | TTGGACTTTGCGGGTTTTGC |
R | GATGCTCCGATACCCTGCTG | |
Mmp9 | F | AGGGCCCCTTTCTTATTGCC |
R | CACATTTTGCGCCCAGAGAA | |
Ptgs2 | F | ACGTGTTGACGTCCAGATCA |
R | GGCCCTGGTGTAGTAGGAGA | |
Vcan | F | GATGCCTACTGCTTTAAACCTAAAC |
R | AGCTCTCTCGGGTACCATGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, T.; Li, H.; Zhang, S.; Wang, Y.; He, J.; Kang, J. Transcriptome Sequencing-Based Screening of Key Melatonin-Related Genes in Ischemic Stroke. Int. J. Mol. Sci. 2024, 25, 11620. https://doi.org/10.3390/ijms252111620
Li T, Li H, Zhang S, Wang Y, He J, Kang J. Transcriptome Sequencing-Based Screening of Key Melatonin-Related Genes in Ischemic Stroke. International Journal of Molecular Sciences. 2024; 25(21):11620. https://doi.org/10.3390/ijms252111620
Chicago/Turabian StyleLi, Tianzhi, Hongyan Li, Sijie Zhang, Yihan Wang, Jinshan He, and Jingsong Kang. 2024. "Transcriptome Sequencing-Based Screening of Key Melatonin-Related Genes in Ischemic Stroke" International Journal of Molecular Sciences 25, no. 21: 11620. https://doi.org/10.3390/ijms252111620
APA StyleLi, T., Li, H., Zhang, S., Wang, Y., He, J., & Kang, J. (2024). Transcriptome Sequencing-Based Screening of Key Melatonin-Related Genes in Ischemic Stroke. International Journal of Molecular Sciences, 25(21), 11620. https://doi.org/10.3390/ijms252111620