Next Article in Journal
Modulation of miR-29a and miR-29b Expression and Their Target Genes Related to Inflammation and Renal Fibrosis by an Oral Nutritional Supplement with Probiotics in Malnourished Hemodialysis Patients
Previous Article in Journal
Dopamine Signaling in Substantia Nigra and Its Impact on Locomotor Function—Not a New Concept, but Neglected Reality
Previous Article in Special Issue
Integrated Bulk Segregant Analysis, Fine Mapping, and Transcriptome Revealed QTLs and Candidate Genes Associated with Drought Adaptation in Wild Watermelon
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification of Gene Responsible for Conferring Resistance against Race KN2 of Podosphaera xanthii in Melon

Department of Horticulture, Sunchon National University, Suncheon 57922, Republic of Korea
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2024, 25(2), 1134; https://doi.org/10.3390/ijms25021134
Submission received: 27 November 2023 / Revised: 26 December 2023 / Accepted: 12 January 2024 / Published: 17 January 2024
(This article belongs to the Special Issue Melon Breeding and Molecular Research)

Abstract

Powdery mildew caused by Podosphaera xanthii is a serious fungal disease which causes severe damage to melon production. Unlike with chemical fungicides, managing this disease with resistance varieties is cost effective and ecofriendly. But, the occurrence of new races and a breakdown of the existing resistance genes poses a great threat. Therefore, this study aimed to identify the resistance locus responsible for conferring resistance against P. xanthii race KN2 in melon line IML107. A bi-parental F2 population was used in this study to uncover the resistance against race KN2. Genetic analysis revealed the resistance to be monogenic and controlled by a single dominant gene in IML107. Initial marker analysis revealed the position of the gene to be located on chromosome 2 where many of the resistance gene against P. xanthii have been previously reported. Availability of the whole genome of melon and its R gene analysis facilitated the identification of a F-box type Leucine Rich Repeats (LRR) to be accountable for the resistance against race KN2 in IML107. The molecular marker developed in this study can be used for marker assisted breeding programs.

1. Introduction

Melon (Cucumis melo L.) is a globally cultivated fruit crop, belonging to the Cucurbitaceae family, known for its sweet flavor, distinct aroma, and nutritional value in the market [1]. During the year 2019–2020, melon was cultivated with a production of 27.5 million tons throughout the world [2]. Over 25% of melon production is lost annually due to biotic stresses such as diseases and pests [3]. Most important among these are the bacterial fruit blotch, Anthracnose, Powdery mildew and Fusarium wilt [4].
Powdery mildew (PM), caused by the fungus Golovinomyces cichoracearum and Podosphaera xanthii (previously known as Erysiphe cichoracearum and Sphaerotheca fuliginea, respectively), is one of the most common and damaging foliar diseases in melons. Throughout the year, through natural infestation in fields and artificial infestation in greenhouse conditions [5,6] a numerous variety of vegetable crops and cereals are affected by this disease in various countries, with slight variations in their virulence [7,8,9,10,11,12]. According to Robinson and Decker-Walters [13], among the two fungi, P. xanthii is most widely reported on the melon.
P. xanthii and G. cichoracearum outbreaks occur in higher temperatures and humidity regions [7,14]. Typically, the symptoms start with the appearance of white powder-like patches on both the upper and lower side of the leaf’s surface and further spread to completely cover the entire plant [15]. Some symptoms, like chlorotic leaves and a reduced canopy, were commonly seen in many crops which leads to poor fruit quality and yield loss [16]. The intensity of the disease differs based on the melon cultivar, cultivation season, and geographical area which makes difficult to manage this disease [12].
The first occurrence of P. xanthii was reported in California in 1925. Since then, based on the reaction of P. xanthii isolates to melon differential lines, more than 28 physiological races were reported worldwide. Out of 28, three races—1, 2, and 3—were reported from the USA. Similarly, other races—0, 4, and 5—were reported in France and four races—1, N1 (race 6), N2 (race 7) and 5—were reported in Japan [12,17]. By comparing the interaction of 22 melon accessions against 28 races of P. xanthii, McCreight [18] identified eight variants of race 1 and six variants of race 2. In addition, Kim et al. [19] reported the existence of race N5, based on its distinctive reaction on 10 differential melon lines. Later, another two new races, named KN1 and KN2, were reported in South Korea, which were reported to be different in virulence from the previous reported races and also to each other, on the basis of differential lines [20]. In America and Brazil, the presence of races 1, 2 and 3 were reported [21,22]. In China, the predominance occurrence of races 1 and 2F were reported [23,24].
For many years, fungicides have been extensively used to control powdery mildew in melon, which is less effective and has led to the development of fungicide-resistant PM pathogens [25,26]. Therefore, the most effective way to manage this fungus is to develop resistant melon varieties [27,28,29]. Constant efforts of breeders has led to the development of more than 30 resistant germplasm worldwide against PM [18,22,30,31]. Extensive and wide cultivation of resistant varieties with a single gene has often resulted in the emergence of new virulent isolate or strain. Recently, breakdown of resistance in the melon varieties carrying single powdery mildew resistance gene was reported. Hence, it is necessary to develop melon varieties with durable resistance by pyramiding race-specific genes to overcome powdery mildew [12,22]. With the emergence of new races and break down of the resistance, it is necessary to identify the new sources of R genes, which will be a continuous process.
Until now, several quantitative trait loci (QTL) conferring resistance against P. xanthii have been reported in melon. Most of them are located on chromosomes 2, 5, and 12 namely, Pm1–6 [32,33,34], Pm-R, W, X, Y [28,29,35,36], Pm-x1, x3, x5 [37], Pm-Edisto47-1, 2 [27], Pm-2F [38], Pm-PxA, B [39], Pm-An [24], PmV.1, PmXII.1 [40], BPm12.1 [41], and pm-S [42]. Identification of the putative candidate genes present in these QTL regions is important for breeding programs. The use of molecular markers that are closely linked to specific resistance genes can be a powerful tool for marker-assisted breeding [28].
Plants fight themselves against numerous diseases through diverse defense mechanisms. R-genes play a very vital role in these defense mechanisms by encoding putative receptors in response to the Avr genes released by the pathogen during the infestation [43]. Leucine-rich repeats (LRR) are one of the largest and important class of R genes in plants. The LRR domain can determine the R-gene’s specificity for various races of the same pathogen in different crops [44]. It was reported that LRR act as an effector-binding domain for the recognition of pathogens [45] and as a regulatory domain for signaling during the pathogen attack [46,47]. LRR were reported to confer disease resistance in many plant species against different diseases [48,49,50,51,52,53]. In the present study, we have identified and characterized the LRR genes present in the clusters of QTLs regions on the chromosomes 2, 5, and 12. We identified LRR as a candidate gene based on the physical position, structural diversity, and co-segregation against P. xanthii race KN2 in melon. We also developed a functional marker (LRR) for this gene, which may be further used in the marker assisted breeding.

2. Results

2.1. Pathogen Isolate and Determination of Physiological Race

Based on the report of Hong et al. [20], the KN2 isolate was characterized by using a set of eight differential melon lines. After 14 days of inoculation, scoring was noted for these eight lines. Out of eight differential lines, four melon lines, MR-1, PI124112, PMR5, and Edisto 47 were resistant to KN2, whereas the remaining four lines, SCNU1154, PMR 45, WMR 29 and PI414723 were susceptible (Figure 1 and Table 1). The results suggested that different patterns of pathogenicity were observed in the eight differential lines.

2.2. Inheritance of Resistance

Two breeding lines were screened against the race KN2. One line, namely IML107, showed resistance, whereas the remaining three breeding lines, namely IML197, were susceptible against the KN2 race (Figure 2). To understand the inheritance, the F1 derived from the cross between resistant IML107 and susceptible IML197 was found to be resistant against the KN2 race, whereas the phenotyping of 138 F2 were segregated into 100 resistant and 38 susceptible against KN2 (Table S2). The inheritance of resistance was found to be complete dominant gene (100:38; 3:1). These results were further confirmed by the Chi square test (p = 0.68) (Table 2).

2.3. Molecular Analysis of Resistance against Powdery Mildew Race KN2

In the present study, we have selected the four SNP markers on chromosomes 2, 5 and 12, reported to be associated with PM resistance and tested in the resistant and susceptible breeding lines. Among the four SNP markers tested, three marker Pm-2-HRM-1, Pm-5-HRM-1 and Pm-12-HRM-1 on chromosomes 2, 5 and 12 found to be polymorphic between the parents (Figure 3). These three markers were further tested in 100 R lines and 38 S lines of F2 populations. However, Pm-2-HRM-1 showed 94.28% segregation with the R and the S lines. The other two markers, Pm-5-HRM-1 and Pm-12-HRM-1, showed low percent segregation of 79.71% and 89.13%, respectively.
Based on the results of segregation analysis, we further explored the genes located on chromosome 2. All the 23 genes of LRRs and pathogenicity-related genes on chromosome 2 were performed for parental polymorphism along with its F1. Out of the 23 markers tested, marker 1, named MELO C2-1, corresponds F-box/LRR-repeat protein 15, marker 6 and marker 13, named MELO C2-6 and MELO C2-13, belong to the plant intracellular Ras-group-related LRR protein 6 and receptor protein kinase, putative, respectively, showing polymorphism between the parents and heterozygosity in the F1 tested (Table 3; Figure 4). These three markers were further tested with another mapping population developed between IML107 X IML197 with 39 F2 plants (Resistant-26; Susceptible-13) along with the parents. Out of three markers tested, F-box/LRR-repeat protein 15 (MELO C2-1) located at 562322 bases showed maximum segregation of 89.74% (0.00 cM) with the F2 phenotypes compared to the other two markers. Based on the linkage map, two gene-based markers, namely plant intracellular Ras-group-related LRR protein 6 (MELO C2-6) and receptor protein kinase, putative (MELO C2-13), showed 71.79% (33.13 cM) and 76.92% (65.16 cM) segregation, respectively (Figure 5) (Table S3). Another marker (11) (Figure 4) showed polymorphism among the parents and was also able to differentiate the F1 but, when kept with the F2 plants, it did not show any segregation between them.

3. Discussion

Melon is a significant crop among the Cucurbitaceae family, cultivated globally. In South Korea, it holds economic importance and is widely grown to meet domestic demand as well as for its import purposes. It is a fruit of choice in many countries because of its various nutritional qualities [54,55,56]. However, the occurrence of powdery mildew, a fungal disease, is a serious threat to melon production by reducing yield and affecting the fruit quality. In melon, powdery mildew disease caused by P. xanthii is commonly reported when compared to the other fungus species. In South Korea, both race 1 and race 5 of powdery mildew have been documented [19,57]. This disease spreads widely in South Korea, and there are reports of the breakdown of existing R gene in various regions and existence of new races KN1 and KN2 [20]. The uses of molecular markers and identification of potential candidate genes linked to the powdery mildew resistance is a crucial requirement for the progression of molecular breeding [58]. It is important to develop the resistant varieties based on the physiological races of P. xanthii present on the particular region. Therefore, there is a continuous need for the identification of new resistance genes and the development of their molecular markers.
Even though a few dominant resistance genes were reported in melon against the powdery mildew, their genetic relationship is still not clear [59]. Most of the reported R genes and/or QTLs were mapped to the six melon linkage groups. The uses of molecular markers in the breeding have more advantages than the classical breeding. With the help of the molecular markers, we can identify the R gene/QTLs that linked to any phenotypic trait. These linked markers can also be used in the marker-assisted breeding program to pyramid more genes in single variety for durable resistance. The combination of dominant and recessive genes may play an essential role in conferring durable resistance in melon.
There are many studies, reporting the presence of various races of P. xanthii causing powdery mildew and their resistant sources of melons in different countries [8,11,18,31,42,60,61,62,63,64,65,66,67,68]. Development of resistant varieties should be based on race specific and/or region specific factors. Up to this point, no reports of a resistance source were reported against the KN2 race of Px. This study is the first attempt made for the identification of resistant sources and understand the inheritance of resistance in melon against KN2 race.
Our research group isolated and identified this race as a new strain of P. xanthii [20]. To evaluate race KN2 of powdery mildew, we used eight selected melon lines, and the results were the same as those reported by Hong et al. [20]. We have also screened four breeding lines against this KN2 race and identified the IML107 line to be resistant against the KN2 race. The inheritance of resistance of IML107 indicated that it is governed by the single dominant gene that controls the resistance against the KN2 race of P. xanthii. A similar inheritance study was reported in resistant line, Zimbabwean melon TGR-1551 resistance against 1, 2 and 5 of P. xanthii. Based on the genetic analysis, it is reported to carry two independent genes, one dominant and one recessive [69]. Similarly, the PMR 5 resistant line carries a single dominant gene against race 5 of Px [70]. Similarly, another dominant gene was reported from the PI 371795 cultivar and named the Pm-1 gene. Another PI 124112 accession was reported to be resistant against race 5 [21]. A single dominant gene identified in the PI 414723 accession confer resistance to race 1 and 2 of P. xanthii [35]. Another genotype WMR 29 was reported to carry a single dominant gene against the races 1, 2 and 3 of P. xanthii [36].
Previous studies have successfully mapped R-genes, and QTLs associated with P. xanthii resistance in melon on chromosomes 2, 5, and 12 [24,27,29,35,36,38,39,40,71,72]. Since most of the reported genes of P. xanthii were located on the chromosomes 2, 5 and 12 of melon genome. To further fine map the genes present in delimited regions of these chromosomes, the four SNP markers were identified and used for parental polymorphism and in F2 mapping population in our study. Our genotyping results showed an accuracy of 94.28%, with Pm-2-HRM-1 surpassing other markers previously employed. However, chromosome 2 may contain a potential gene associated with race KN2. Similarly, using the SNP markers putative candidate genes associated with race 5 specific were reported in Cucumis melo L. [73]. Two QTLs, Pm-R1-2, against races 1 and 2, and Pm-R5 against race 5 on LG V, which are reported to be linked to powdery mildew resistance in the TGR-1551 line [24,28,35,36]. Furthermore, using the SSR markers, the linkage analysis was performed and showed PmV.1 QTL against races 1, 2, and 3, and the PmXII.1 QTL against races 1, 2, and 5 on LG XII in the PI124112 line [29,40]. Similarly, around seventeen resistant genes have been located within the Pm12.1 resistant quantitative trait locus and in linkage group XII (chromosome XII), providing resistance against race 1 of powdery mildew in the melon line MR1 [39,41].
F-box/Leucine Rich Protein family proteins are one of the super protein families in plants, and several studies have demonstrated that they play diverse roles in various key plant development and physiological processes, including germination [74], regulation of hormone signaling transduction [75,76,77,78,79], plant response to stress conditions [80,81,82,83,84,85,86,87,88], and plant primary and secondary metabolism [89,90,91]. This gene is reported to be associated with the disease resistance in several plants [92,93].
In our study, one of the LRR gene showed 94% of segregation in the mapping population, suggesting that this could be the candidate gene involved in the resistance in IML107 against KN2 race of Px. Likewise, this class of gene were reported to be involved in defense against powdery mildew in wheat [94,95]. Through the whole genome-based approach, these NBS-LRR or LRR genes were found to be putative candidate genes for Pm1 gene in Cannabis sativa [96]. Similarly, in another study NBS-LRR was reported to be putative candidate gene in melon against powdery mildew [69]. Hence, all these findings suggest that the F-Box gene may be the putative candidate gene and the marker developed in this study will be used in the marker assisted breeding programs.

4. Materials and Methods

4.1. Plant Material and Screening against Pathogen

A set of eight differential lines are reported to differ in their reaction pattern against the powdery mildew races. These lines were screened to characterize against the race KN2 under glasshouse conditions at Sunchon National University (Figure 1 and Table 1).
Another set of four breeding lines were screened against KN2 race to identify the resistant and susceptible lines under glasshouse conditions at Sunchon National University (Figure 2).

4.2. Mapping Population

A mapping population was developed from a cross between IML197 (susceptible parent) and IML107 (resistant parent) in this study. From this cross around 15 F1 plants were obtained and checked for reaction against KN1 race. The positive F1 plant was selfed to produce the F2 populations. All the 138 F2 lines along with the parents were raised in nursery tray (50 holes) containing artificial soil mix under the controlled plant growth chamber with 25 ± 2 °C, 16 h day length, 80–120 μmol/m2/s light intensity and 65–75% relative humidity. All the 138 F2 population were subjected to screening against the KN2 race under glasshouse conditions.

4.3. Pathogen Isolate

The infected samples were collected from the melon fields in Jangheung, South Korea and maintained on the melon line SCNU1154 to obtain the pure culture. Before screening the mapping population, this pure culture was tested in the reported eight differential lines to check the reaction pattern. Later, this isolate was used for screening of P1, P2, F1 and 138 F2 plants under glasshouse conditions.

4.4. Inoculation and Disease Assessment

Plants were allowed to grow in the growth chamber until the third true leaf opened. At this stage the plants were inoculated with the culture by spraying. The inoculum was prepared by rinsing the spores from the heavily sporulating leaves in sterile water using a sterile paintbrush and then mixed with 0.02% Tween 20. The liquid suspension was filtered through a four-layered Mira-cloth (EMD Millipore Corporation, USA) to eliminate mycelia. The spore concentration of powdery mildew was adjusted with a haemocytometer and light microscope (Leica DM750, Leica, Switzerland) to measure a concentration of 5 × 105 spores/mL by dilution with distilled water. This inoculum was sprayed on the plants using a hand sprayer. After two weeks of inoculation the disease was scored. The disease response on the melon lines was characterized visually as resistant, susceptible, and intermediate resistant based on the severity of the spread of fungal spores on the leaves of inoculated plants as estimated by the percentage of the infected area of leaf discs (0%–10%, 11%–30%, and 31%–100%, respectively) after two weeks of inoculation.

4.5. DNA Extraction

Genomic DNA was extracted from the 2-week-old fresh leaf samples of the two parental lines (15 from each parent), 15 F1 plants and 138 F2 plants using a DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. The concentration of extracted gDNA was checked using a NanoDrop Spectrophotometer ND-100 (NanoDrop Technologies, Wilmington, DE, USA) and stored at −20 °C for further use.

4.6. Genotyping with the Reported Molecular Markers

Up to this point, all the reported QTLs for PM resistance were located on the three chromosomes 02, 05 and 12 of melon genome. In this study, we have selected four linked markers from the three reported chromosomes. Based on the earlier reports of Zhang, Wang, and Li [24,38,41] the SNP sites near the reported locations were identified and HRM markers were designed. The SNP sites were used to design the probe. HybProbe was synthesized by Bioneer, Daejeon, Republic of Korea. A PCR was performed by using SYTO 9 green-fluorescent nucleic acid stain (Invitrogen, Waltham, MA, USA; Thermo Fisher Scientific, Waltham, MA, USA) to generate melting curves characteristic for the genotype corresponding to the probe. The reactions were carried out in a final volume of 10 μL containing the HRM PCR mix of 1 μL genomic DNA at 50 ng μL−1, 5 μL HS prime LP premix (GENETBIO, Daejeon, Republic of Korea), and 2.6 μL double-distilled H2O, 0.1 μL forward and 0.5 μL reverse primers (10 pmol), 0.5 μL probe (10 pmol), 0.3 μL SYTO 9 fluorescent dye. The PCR before the HRM was conducted with the following conditions: an initial preincubation at 95 °C for 5 min followed by 45 cycles of 95 °C for 20 s, annealing at 64 °C and 56 °C for 15 s under touchdown command, i.e., by decreasing temperature by 1 °C at each step and then extension at 72 °C for 15 s. Melt analysis was recorded by ramping the temperature to 95 °C for 60 s to 40 °C for 60 s and 97 °C for 1 s with continuous acquisition of fluorescence. HRM curve analysis was conducted using LightCycler®® 96 SW1.1 software (Roche, Mannheim, Germany) at 75% discrimination for both delta Tm and curve shape with a 0.2 positive/negative threshold level.

4.7. Identification of Candidate Genes

Based on the earlier reports and our analysis on the reported linked markers, we targeted the chromosome 2 for Insilico analysis. Based on the earlier reports we have selected all the LRR, TIR-LRR, CC-LRR, NB-LRR and Pathogenesis related genes by using keyword search in the cucurbit database (http://cucurbitgenomics.org/; accessed on 2 September 2022). Around 23 genes were selected as putative candidate genes for further analysis. The primers were designed for these 23 genes using the primer3 web-based tool (https://primer3.ut.ee/; accessed on 14 September 2022). All these 23 primer pairs were used for parental polymorphism and their sequence details were given in (Table S1). A linkage map was prepared using the linkage function of the QTL cartographer 2.0.

4.8. Statistical Analysis

Microsoft excel was used to calculate discrepancies between observed data and anticipated segregation ratios using a chi-square test for goodness-of-fit. The threshold for statistical significance was p < 0.05.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms25021134/s1.

Author Contributions

H.-T.K. and J.-I.P. conceived the idea and set the experimentation plan. S.K. and S.-H.C. performed the experiments. N.S. wrote the initial manuscript. H.-T.K. improvised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research work was supported by the “Regional Innovation Strategy” (RIS) from the National Research Foundation of Korea (NRF) funded by the Ministry of Education (MOE) (2021RIS-002) and Sunchon National University Research Fund in 2020 (Grant number: 2020-0191). The authors are very thankful for the support to carry out this research.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data is contained within the article and supplementary files.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Garcia-Mas, J.; Benjak, A.; Sanseverino, W.; Bourgeois, M.; Mir, G.; González, V.M.; Hénaff, E.; Câmara, F.; Cozzuto, L.; Lowy, E.; et al. The genome of melon (Cucumis melo L.). Proc. Natl. Acad. Sci. USA 2012, 109, 11872–11877. [Google Scholar] [CrossRef]
  2. Food and Agriculture Organization of the United Nations. The FAO Statistical Database-Agriculture. 2023. Available online: https://www.fao.org/statistics/en/ (accessed on 11 April 2023).
  3. Agrios, G. How plants defend themselves against pathogens. Plant Pathol. 2005, 93, 114. [Google Scholar]
  4. Damm, U.; Cannon, P.F.; Liu, F.; Barreto, R.W.; Guatimosim, E.; Crous, P.W. The Colletotrichum orbiculare species complex: Important pathogens of field crops and weeds. Fungal Divers. 2013, 61, 29–59. [Google Scholar] [CrossRef]
  5. Wang, Y.-H.; Wu, D.-H.; Huang, J.-H.; Tsao, S.-J.; Hwu, K.-K.; Lo, H.-F. Mapping quantitative trait loci for fruit traits and powdery mildew resistance in melon (Cucumis melo). Bot. Stud. 2016, 57, 19. [Google Scholar] [CrossRef] [PubMed]
  6. Kasiamdari, R.S.; Riefani, M.K.; Daryono, B.S. The occurrence and identification of powdery mildew on melon in Java, Indonesia. In Proceedings of the 4th International Conference on Biological Science, Yogyakarta, Indonesia, 18–19 September 2015; p. 020050. [Google Scholar]
  7. Epinat, C.; Pitrat, M.; Bertrand, F. Genetic analysis of resistance of five melon lines to powdery mildews. Euphytica 1992, 65, 135–144. [Google Scholar] [CrossRef]
  8. Mohamed, Y.F.; Bardin, M.; Nicot, P.C.; Pitrat, M. Causal Agents of Powdery Mildew of Cucurbits in Sudan. Plant Dis. 1995, 79, 634–636. [Google Scholar] [CrossRef]
  9. McCreight, J.D.; Pitrat, M.; Thomas, C.E.; Kishaba, A.N.; Bohn, G.W. Powdery Mildew Resistance Genes in Muskmelon. J. Am. Soc. Hortic. Sci. 1987, 112, 156–160. [Google Scholar] [CrossRef]
  10. Cohen, Y.; Eyal, H. Differential expression of resistance to powdery mildew incited by race 1 or 2 ofsphaerotheca fuliginea in Cucumis melo genotypes at various stages of plant development. Phytoparasitica 1995, 23, 223–230. [Google Scholar] [CrossRef]
  11. Hosoya, K.; Narisawa, K.; Pitrat, M.; Ezura, H. Race identification in powdery mildew (Sphaerotheca fuliginea) on melon (Cucumis melo) in Japan. Plant Breed. 1999, 118, 259–262. [Google Scholar] [CrossRef]
  12. Hosoya, K.; Kuzuya, M.; Murakami, T.; Kato, K.; Narisawa, K.; Ezura, H. Impact of resistant melon cultivars on Sphaerotheca fuliginea. Plant Breed. 2000, 119, 286–288. [Google Scholar] [CrossRef]
  13. Robinson, R.W.; Decker-Walters, D.S. Diseases and nematodes. In Cucurbits; CAB International: Wallingford, UK, 1997; pp. 164–189. [Google Scholar]
  14. McCreight, J.D. Genes for Resistance to Powdery Mildew Races 1 and 2U.S. in Melon PI 313970. HortScience 2003, 38, 591–594. [Google Scholar] [CrossRef]
  15. Kacem, K.; Chikh-Rouhou, H. Preliminary Selection and Phenotypic Characterization of Melon Landraces Exhibiting Re-sistance to Powdery Mildew. Int. J. Phytopathol. 2022, 11, 115–123. [Google Scholar] [CrossRef]
  16. McGrath, M.T.; Thomas, C.E. Powdery mildew. In Compendium of Cucurbit Diseases; Zitter, T.A., Hopkins, D.L., Thomas, C.E., Eds.; Springer: Berlin/Heidelberg, Germany; pp. 28–30.
  17. Křístková, E.; Lebeda, A.; Sedláková, B. Species spectra, distribution and host range of cucurbit powdery mildews in the Czech Republic, and in some other European and Middle Eastern countries. Phytoparasitica 2009, 37, 337–350. [Google Scholar] [CrossRef]
  18. McCreight, J.D. Melon-Powdery Mildew Interactions Reveal Variation in Melon Cultigens and Podosphaera xanthii Races 1 and 2. J. Am. Soc. Hortic. Sci. 2006, 131, 59–65. [Google Scholar] [CrossRef]
  19. Kim, H.-T.; Park, J.-I.; Robin, A.H.K.; Ishikawa, T.; Kuzuya, M.; Horii, M.; Yashiro, K.; Nou, I.-S. Identification of a New Race and Development of DNA Markers Associated with Powdery Mildew in Melon. Plant Breed. Biotechnol. 2016, 4, 225–233. [Google Scholar] [CrossRef][Green Version]
  20. Hong, Y.-J.; Hossain, M.R.; Kim, H.-T.; Park, J.-I.; Nou, I.-S. Identification of Two New Races of Podosphaera xanthii Causing Powdery Mildew in Melon in South Korea. Plant Pathol. J. 2018, 34, 182–190. [Google Scholar] [CrossRef]
  21. Bardin, M.; Carlier, J.; Nicot, P.C. Genetic differentiation in the French population of Erysiphe cichoracearum, a causal agent of powdery mildew of cucurbits. Plant Pathol. 1999, 48, 531–540. [Google Scholar] [CrossRef]
  22. Rabelo, H.D.O.; Santos, L.D.S.; Diniz, G.M.M.; Marin, M.V.; Braz, L.T.; McCreight, J.D. Cucurbits powdery mildew race identity and reaction of melon genotypes1. Pesqui. Agropecuária Trop. 2017, 47, 440–447. [Google Scholar] [CrossRef]
  23. Ning, X.; Wang, X.; Gao, X.; Zhang, Z.; Zhang, L.; Yan, W.; Li, G. Inheritance and location of powdery mildew resistance gene in melon PMR6. PMRActa Hortic Sin. 2015, 42, 1121. [Google Scholar]
  24. Wang, X.; Li, G.; Gao, X.; Xiong, L.; Wang, W.; Han, R. Powdery mildew resistance gene (Pm-AN) located in a segregation distortion region of melon LGV. Euphytica 2011, 180, 421–428. [Google Scholar] [CrossRef]
  25. Hollomon, D.W.; Wheeler, I.E. Controlling powdery mildews with chemistry. In The Powdery Mildews: A Comprehensive Treatise; CABI: Wallingford, UK, 2002; pp. 249–255. [Google Scholar]
  26. Lebeda, A.; McGrath, M.T.; Sedláková, B. Fungicide resistance in cucurbit powdery mildew fungi. Fungicides 2010, 11, 221–246. [Google Scholar]
  27. Ning, X.; Wang, X.; Gao, X.; Zhang, Z.; Zhang, L.; Yan, W.; Li, G. Inheritances and location of powdery mildew resistance gene in melon Edisto47. Euphytica 2013, 195, 345–353. [Google Scholar] [CrossRef]
  28. Yuste-Lisbona, F.J.; Capel, C.; Gómez-Guillamón, M.L.; Capel, J.; López-Sesé, A.I.; Lozano, R. Codominant PCR-based markers and candidate genes for powdery mildew resistance in melon (Cucumis melo L.). Theor. Appl. Genet. 2011, 122, 747–758. [Google Scholar] [CrossRef]
  29. Yuste-Lisbona, F.J.; Capel, C.; Sarria, E.; Torreblanca, R.; Gómez-Guillamón, M.L.; Capel, J.; Lozano, R.; López-Sesé, A.I. Genetic linkage map of melon (Cucumis melo L.) and localization of a major QTL for powdery mildew resistance. Mol. Breed. 2010, 27, 181–192. [Google Scholar] [CrossRef]
  30. Daryono, B.S.; Yambise, H.C. Deteksi Gen Ketahanan Terhadap Powdery Mildew Pada Melon (Cucumis melo L. ‘Aramis’). Biog. J. Ilm. Biol. 2018, 6, 124–130. [Google Scholar] [CrossRef]
  31. McCreight, J.D. Reactions of 20 melon cultigens to powdery mildew race 2U. In Cucurbitaceae Proceedings 2002; Crop Improvement and Protection Research: Salinas, CA, USA, 2002; pp. 72–77. [Google Scholar]
  32. McCreight, J.D.; Coffey, M.D.; Turini, T.A.; Matheron, M.E. Field Evidence for a New Race of Powdery Mildew on Melon. HortScience 2005, 40, 888a-888. [Google Scholar] [CrossRef]
  33. Cohen, Y.; Eyal, H.; Hanania, J. Ultrastructure, autofluorescence, callose deposition and lignification in susceptible and resistant muskmelon leaves infected with the powdery mildew fungus Sphaerotheca fuliginea. Physiol. Mol. Plant Pathol. 1990, 36, 191–204. [Google Scholar] [CrossRef]
  34. Dogimont, C. 2011 gene list for melon. Cucurbit Genetics Cooperative Report. HortScience 2010, 33, 104–133. [Google Scholar]
  35. Périn, C.; Hagen, L.; De Conto, V.; Katzir, N.; Danin-Poleg, Y.; Portnoy, V.; Baudracco-Arnas, S.; Chadoeuf, J.; Dogimont, C.; Pitrat, M. A reference map of Cucumis melo based on two recombinant inbred line populations. Theor. Appl. Genet. 2002, 104, 1017–1034. [Google Scholar] [CrossRef] [PubMed]
  36. Pitrat, M. Linkage Groups in Cucumis melo L. J. Hered. 1991, 82, 406–411. [Google Scholar] [CrossRef]
  37. Dallagnol, L.J.; Fazza, A.C.; Monteiro, C.C.; de Lima, B.M.; Wassano, D.T.; Camargo, L.E.A. Mapping of resistance genes to races 1, 3 and 5 of Podosphaera xanthii in melon PI 414723. Crop. Breed. Appl. Biotechnol. 2013, 13, 349–355. [Google Scholar] [CrossRef]
  38. Zhang, C.; Ren, Y.; Guo, S.; Zhang, H.; Gong, G.; Du, Y.; Xu, Y. Application of comparative genomics in developing markers tightly linked to the Pm-2F gene for powdery mildew resistance in melon (Cucumis melo L.). Euphytica 2012, 190, 157–168. [Google Scholar] [CrossRef]
  39. Fukino, N.; Ohara, T.; Monforte, A.J.; Sugiyama, M.; Sakata, Y.; Kunihisa, M.; Matsumoto, S. Identification of QTLs for resistance to powdery mildew and SSR markers diagnostic for powdery mildew resistance genes in melon (Cucumis melo L.). Theor. Appl. Genet. 2008, 118, 165–175. [Google Scholar] [CrossRef]
  40. Perchepied, L.; Bardin, M.; Dogimont, C.; Pitrat, M.; Branham, S.; Kousik, C.S.; Mandal, M.; Wechter, P.; Haonan, C.; Zhuo, D.; et al. Relationship Between Loci Conferring Downy Mildew and Powdery Mildew Resistance in Melon Assessed by Quantitative Trait Loci Mapping. Phytopathology 2005, 95, 556–565. [Google Scholar] [CrossRef]
  41. Li, B.; Zhao, Y.; Zhu, Q.; Zhang, Z.; Fan, C.; Amanullah, S.; Gao, P.; Luan, F. Mapping of powdery mildew resistance genes in melon (Cucumis melo L.) by bulked segregant analysis. Sci. Hortic. 2017, 220, 160–167. [Google Scholar] [CrossRef]
  42. McCreight, J.D.; Coffey, M.D. Inheritance of Resistance in Melon PI 313970 to Cucurbit Powdery Mildew Incited by Podosphaera xanthii Race S. HortScience 2011, 46, 838–840. [Google Scholar] [CrossRef]
  43. McDowell, J.M.; Woffenden, B.J. Plant disease resistance genes: Recent insights and potential applications. Trends Biotechnol. 2003, 21, 178–183. [Google Scholar] [CrossRef] [PubMed]
  44. Van der Hoorn, R.A.L.; Kruijt, M.; Roth, R.; Brandwagt, B.F.; Joosten, M.H.A.J.; De Wit, P.J.G.M. Intragenic recombination generated two distinct Cf genes that mediate AVR9 recognition in the natural population of Lycopersicon pimpinellifolium. Proc Natl. Acad. Sci. USA 2001, 98, 10493–10498. [Google Scholar] [CrossRef]
  45. Dodds, P.N.; Lawrence, G.J.; Catanzariti, A.-M.; Teh, T.; Wang, C.-I.A.; Ayliffe, M.A.; Kobe, B.; Ellis, J.G. Direct protein interaction underlies gene-for-gene specificity and coevolution of the flax resistance genes and flax rust avirulence genes. Proc. Natl. Acad. Sci. USA 2006, 103, 8888–8893. [Google Scholar] [CrossRef] [PubMed]
  46. Tao, Y.; Yuan, F.; Leister, R.T.; Ausubel, F.M.; Katagiri, F. Mutational Analysis of the Arabidopsis Nucleotide Binding Site–Leucine-Rich Repeat Resistance Gene RPS2. Plant Cell 2000, 12, 2541–2554. [Google Scholar] [CrossRef] [PubMed][Green Version]
  47. Hwang, C.-F.; Bhakta, A.V.; Truesdell, G.M.; Pudlo, W.M.; Williamson, V.M. Evidence for a Role of the N Terminus and Leucine-Rich Repeat Region of the Mi Gene Product in Regulation of Localized Cell Death. Plant Cell 2000, 12, 1319–1329. [Google Scholar] [CrossRef] [PubMed]
  48. Zhu, X.; Lu, C.; Du, L.; Ye, X.; Liu, X.; Coules, A.; Zhang, Z. The wheat NB-LRR gene TaRCR1 is required for host defence response to the necrotrophic fungal pathogen Rhizoctonia cerealis. Plant Biotechnol. J. 2017, 15, 674–687. [Google Scholar] [CrossRef] [PubMed]
  49. Zhang, C.; Chen, H.; Cai, T.; Deng, Y.; Zhuang, R.; Zhang, N.; Zeng, Y.; Zheng, Y.; Tang, R.; Pan, R.; et al. Overexpression of a novel peanut NBS-LRR gene AhRRS5 enhances disease resistance to Ralstonia solanacearum in tobacco. Plant Biotechnol. J. 2016, 15, 39–55. [Google Scholar] [CrossRef] [PubMed]
  50. Xu, Y.; Liu, F.; Zhu, S.; Li, X. The Maize NBS-LRR Gene ZmNBS25 Enhances Disease Resistance in Rice and Arabidopsis. Front. Plant Sci. 2018, 9, 1033. [Google Scholar] [CrossRef] [PubMed]
  51. Wang, W.; Chen, L.; Fengler, K.; Bolar, J.; Llaca, V.; Wang, X.; Clark, C.B.; Fleury, T.J.; Myrvold, J.; Oneal, D.; et al. A giant NLR gene confers broad-spectrum resistance to Phytophthora sojae in soybean. Nat. Commun. 2021, 12, 6263. [Google Scholar] [CrossRef] [PubMed]
  52. Zhou, L.; Deng, S.; Xuan, H.; Fan, X.; Sun, R.; Zhao, J.; Wang, H.; Guo, N.; Xing, H. A novel TIR-NBS-LRR gene regulates immune response to Phytophthora root rot in soybean. Crop. J. 2022, 10, 1644–1653. [Google Scholar] [CrossRef]
  53. Yang, H.; Wang, H.; Jiang, J.; Liu, M.; Liu, Z.; Tan, Y.; Zhao, T.; Zhang, H.; Chen, X.; Li, J.; et al. The Sm gene conferring resistance to gray leaf spot disease encodes an NBS-LRR (nucleotide-binding site-leucine-rich repeat) plant resistance protein in tomato. Theor. Appl. Genet. 2022, 135, 1467–1476. [Google Scholar] [CrossRef]
  54. Lester, G.E.; Eischen, F. Beta-carotene content of postharvest orange-fleshed muskmelon fruit: Effect of cultivar, growing location and fruit size. Plant Foods Hum. Nutr. 1996, 49, 191–197. [Google Scholar] [CrossRef] [PubMed]
  55. Lester, G.E.; Crosby, K.M. Ascorbic Acid, Folic Acid, and Potassium Content in Postharvest Green-flesh Honeydew Muskmelons: Influence of Cultivar, Fruit Size, Soil Type, and Year. J. Am. Soc. Hortic. Sci. 2002, 127, 843–847. [Google Scholar] [CrossRef]
  56. Lester, G.E. Antioxidant, Sugar, Mineral, and Phytonutrient Concentrations across Edible Fruit Tissues of Orange-Fleshed Honeydew Melon (Cucumis melo L.). J. Agric. Food Chem. 2008, 56, 3694–3698. [Google Scholar] [CrossRef] [PubMed]
  57. Kim, H.-T.; Park, J.-I.; Nou, I.-S. Identification of fungal races that cause powdery mildew in melon (Cucumis melo L.) and selection of resistant commercial melon cultivars against the identified races in Korea. J. Plant Biotechnol. 2016, 43, 58–65. [Google Scholar] [CrossRef]
  58. Varshney, R.K.; Ribaut, J.-M.; Buckler, E.S.; Tuberosa, R.; Rafalski, J.A.; Langridge, P. Can genomics boost productivity of orphan crops? Nat. Biotechnol. 2012, 30, 1172–1176. [Google Scholar] [CrossRef] [PubMed]
  59. Lebeda, A.; Krístková, E.; Sedláková, B.; Coffey, M.D.; McCreight, J.D. Gaps and perspectives of pathotype and race determination in Golovinomyces cichoracearum and Podosphaera xanthii. Mycoscience 2011, 52, 159–164. [Google Scholar] [CrossRef]
  60. Alvarez, J.; Gómez-Guillamón, M.; Torés, N.; Cánovas, I.; Floris, E. Virulence Differences Between Two Spanish Isolates of Sphaerotheca Fuliginea Race 2 On Melon. Acta. Hortic. 2000, 510, 67–70. [Google Scholar] [CrossRef]
  61. Bertrand, F. AR Hale’s Best Jumbo, a new differential melon variety for Sphaerotheca fuliginea races in leaf disk test. In Cucur-bitaceae; ASHS Press: Alexandria, VA, USA, 2002; pp. 234–237. [Google Scholar]
  62. Cohen, R.; Burger, Y.; Shraiber, S. Physiological races of Sphaerotheca fuliginea: Factors affecting their identification and the sig-nificance of this knowledge. In Cucurbitaceae 2002; ASHS Press: Alexandria, VA, USA, 2002; pp. 181–187. [Google Scholar]
  63. Floris, E.; Alvarez, J.M. Genetic analysis of resistance of three melon lines to Sphaerotheca fuliginea. Euphytica 1995, 81, 181–186. [Google Scholar] [CrossRef]
  64. Harwood, R.R.; Markarian, D. A Genetic Survey of Resistance to Powdery Mildew in Muskmelon. J. Hered. 1968, 59, 213–217. [Google Scholar] [CrossRef]
  65. Jagger, I.C. A new biologic form of powdery mildew on muskmelons in the Imperial Valley of California. Plant Dis. Rep. 1938, 22, 275–276. [Google Scholar]
  66. Pitrat, M.; Dogimont, C.; Bardin, M. Resistance to fungal diseases of foliage in melon. In Cucurbitaceae; ASHS Press: Alexandria, VA, USA, 1998; pp. 167–173. [Google Scholar]
  67. Sowell, G.; Corley, W.L. Severity of Race 2 of Sphaerotheca fuliginea (Schlecht.) Poll. on Muskmelon Introductions Reported Resistant to Powdery Mildew1. HortScience 1974, 9, 398–399. [Google Scholar] [CrossRef]
  68. Thomas, C.E. A new biological race of powdery mildew [Sphaerotheca fuliginea] of cantaloups. Plant Dis. Rep. 1978, 62, 223. [Google Scholar]
  69. López-Martín, M.; Pérez-De-Castro, A.; Picó, B.; Gómez-Guillamón, M.L. Advanced Genetic Studies on Powdery Mildew Resistance in TGR-1551. Int. J. Mol. Sci. 2022, 23, 12553. [Google Scholar] [CrossRef]
  70. Hong, J.-E.; Hossain, M.R.; Jung, H.-J.; Nou, I.-S. Inheritance of Resistance to Race 5 of Powdery Mildew Fungus Podosphaera xanthii in Melon and Development of Race 5-Specific High Resolution Melting Markers. Plant Breed. Biotechnol. 2022, 10, 272–281. [Google Scholar] [CrossRef]
  71. Teixeira, A.P.M.; Barreto, F.A.d.S.; Camargo, L.E.A. An AFLP marker linked to the Pm-1 gene that confers resistance to Podosphaera xanthii race 1 in Cucumis melo. Genet. Mol. Biol. 2008, 31, 547–550. [Google Scholar] [CrossRef]
  72. Liu, L.; Chen, Y.; Su, Z.; Zhang, H.; Zhu, W. A Sequence-amplified Characterized Region Marker for a Single, Dominant Gene in Melon PI 134198 that Confers Resistance to a Unique Race of Podosphaera xanthii in China. HortScience 2010, 45, 1407–1410. [Google Scholar] [CrossRef]
  73. Howlader, J.; Hong, Y.; Natarajan, S.; Sumi, K.R.; Kim, H.-T.; Park, J.-I.; Nou, I.-S. Development of powdery mildew race 5-specific SNP markers in Cucumis melo L. using whole-genome resequencing. Hortic. Environ. Biotechnol. 2020, 61, 347–357. [Google Scholar] [CrossRef]
  74. Majee, M.; Kumar, S.; Kathare, P.K.; Wu, S.; Gingerich, D.; Nayak, N.R.; Salaita, L.; Dinkins, R.; Martin, K.; Goodin, M.; et al. KELCH F-BOX protein positively influences Arabidopsis seed germination by targeting Phytochrome-Interacting Factor1. Proc. Nat. Acad. Sci. Biol. 2018, 115, E4120–E4129. [Google Scholar] [CrossRef] [PubMed]
  75. McSteen, P.; Zhao, Y. Plant Hormones and Signaling: Common Themes and New Developments. Dev. Cell 2008, 14, 467–473. [Google Scholar] [CrossRef] [PubMed]
  76. Kepinski, S.; Leyser, O. The Arabidopsis F-box protein TIR1 is an auxin receptor. Nature 2005, 435, 446–451. [Google Scholar] [CrossRef] [PubMed]
  77. Dill, A.; Thomas, S.G.; Hu, J.; Steber, C.M.; Sun, T.-P. The Arabidopsis F-Box Protein SLEEPY1 Targets Gibberellin Signaling Repressors for Gibberellin-Induced Degradation. Plant Cell 2004, 16, 1392–1405. [Google Scholar] [CrossRef]
  78. Binder, B.M.; Walker, J.M.; Gagne, J.M.; Emborg, T.J.; Hemmann, G.; Bleecker, A.B.; Vierstra, R.D. The Arabidopsis EIN3 Binding F-Box Proteins EBF1 and EBF2 Have Distinct but Overlapping Roles in Ethylene Signaling. Plant Cell 2007, 19, 509–523. [Google Scholar] [CrossRef]
  79. Thines, B.; Katsir, L.; Melotto, M.; Niu, Y.; Mandaokar, A.; Liu, G.; Nomura, K.; He, S.Y.; Howe, G.A.; Browse, J. JAZ repressor proteins are targets of the SCFCOI1 complex during jasmonate signalling. Nature 2007, 448, 661–665. [Google Scholar] [CrossRef]
  80. Song, J.B.; Wang, Y.X.; Li, H.B.; Li, B.W.; Zhou, Z.S.; Gao, S.; Yang, Z.M. The F-box family genes as key elements in response to salt, heavy mental, and drought stresses in Medicago truncatula. Funct. Integr. Genom. 2015, 15, 495–507. [Google Scholar] [CrossRef]
  81. Zhou, S.-M.; Kong, X.-Z.; Kang, H.-H.; Sun, X.-D.; Wang, W. The Involvement of Wheat F-Box Protein Gene TaFBA1 in the Oxidative Stress Tolerance of Plants. PLoS ONE 2015, 10, e0122117. [Google Scholar] [CrossRef]
  82. Bu, Q.; Lv, T.; Shen, H.; Luong, P.; Wang, J.; Wang, Z.; Huang, Z.; Xiao, L.; Engineer, C.; Kim, T.H.; et al. Regulation of Drought Tolerance by the F-Box Protein MAX2 in Arabidopsis. Plant Physiol. 2013, 164, 424–439. [Google Scholar] [CrossRef]
  83. Jain, M.; Nijhawan, A.; Arora, R.; Agarwal, P.; Ray, S.; Sharma, P.; Kapoor, S.; Tyagi, A.K.; Khurana, J.P. F-Box Proteins in Rice. Genome-Wide Analysis, Classification, Temporal and Spatial Gene Expression during Panicle and Seed Development, and Regulation by Light and Abiotic Stress. Plant Physiol. 2007, 143, 1467–1483. [Google Scholar] [CrossRef]
  84. Kim, H.S.; Delaney, T.P. Arabidopsis SON1 is an F-Box Protein That Regulates a Novel Induced Defense Response Independent of Both Salicylic Acid and Systemic Acquired Resistance. Plant Cell 2002, 14, 1469–1482. [Google Scholar] [CrossRef]
  85. Calderón-Villalobos, L.I.A.; Nill, C.; Marrocco, K.; Kretsch, T.; Schwechheimer, C. The evolutionarily conserved Arabidopsis thaliana F-box protein AtFBP7 is required for efficient translation during temperature stress. Gene 2007, 392, 106–116. [Google Scholar] [CrossRef]
  86. Cao, Y.; Yang, Y.; Zhang, H.; Li, D.; Zheng, Z.; Song, F. Overexpression of a rice defense-related F-box protein gene OsDRF1 in tobacco improves disease resistance through potentiation of defense gene expression. Physiol. Plant. 2008, 134, 440–452. [Google Scholar] [CrossRef] [PubMed]
  87. Piisilä, M.; A Keceli, M.; Brader, G.; Jakobson, L.; Jõesaar, I.; Sipari, N.; Kollist, H.; Palva, E.T.; Kariola, T. The F-box protein MAX2 contributes to resistance to bacterial phytopathogens in Arabidopsis thaliana. BMC Plant Biol. 2015, 15, 53. [Google Scholar] [CrossRef]
  88. Stefanowicz, K.; Lannoo, N.; Zhao, Y.; Eggermont, L.; Van Hove, J.; Al Atalah, B.; Van Damme, E.J.M. Glycan-binding F-box protein from Arabidopsis thaliana protects plants from Pseudomonas syringae infection. BMC Plant Biol. 2016, 16, 213. [Google Scholar] [CrossRef]
  89. Zhang, X.; Abrahan, C.; Colquhoun, T.A.; Liu, C.-J. A Proteolytic Regulator Controlling Chalcone Synthase Stability and Flavonoid Biosynthesis in Arabidopsis. Plant Cell 2017, 29, 1157–1174. [Google Scholar] [CrossRef]
  90. Kim, Y.Y.; Jung, K.W.; Jeung, J.U.; Shin, J.S. A novel F-box protein represses endothecial secondary wall thickening for anther dehiscence in Arabidopsis thaliana. J. Plant Physiol. 2012, 169, 212–216. [Google Scholar] [CrossRef]
  91. Chen, Y.; Xu, Y.; Luo, W.; Li, W.; Chen, N.; Zhang, D.; Chong, K. The F-Box Protein OsFBK12 Targets OsSAMS1 for Degradation and Affects Pleiotropic Phenotypes, Including Leaf Senescence, in Rice. Plant Physiol. 2013, 163, 1673–1685. [Google Scholar] [CrossRef]
  92. Harris, C.J.; Slootweg, E.J.; Goverse, A.; Baulcombe, D.C. Stepwise artificial evolution of a plant disease resistance gene. Proc. Nat. Acad. Sci. Biol. 2013, 110, 21189–21194. [Google Scholar] [CrossRef]
  93. Kourelis, J.; Van Der Hoorn, R.A.L. Defended to the Nines: 25 Years of Resistance Gene Cloning Identifies Nine Mechanisms for R Protein Function. Plant Cell 2018, 30, 285–299. [Google Scholar] [CrossRef] [PubMed]
  94. Zou, S.; Wang, H.; Li, Y.; Kong, Z.; Tang, D. The NB-LRR gene Pm60 confers powdery mildew resistance in wheat. New Phytol. 2017, 218, 298–309. [Google Scholar] [CrossRef] [PubMed]
  95. Jin, Y.; Liu, H.; Gu, T.; Xing, L.; Han, G.; Ma, P.; Li, X.; Zhou, Y.; Fan, J.; Li, L.; et al. PM2b, a CC-NBS-LRR protein, interacts with TaWRKY76-D to regulate powdery mildew resistance in common wheat. Front. Plant Sci. 2022, 13, 973065. [Google Scholar] [CrossRef] [PubMed]
  96. Mihalyov, P.D.; Garfinkel, A.R. Discovery and Genetic Mapping of PM1, a Powdery Mildew Resistance Gene in Cannabis sativa L. Front. Agron. 2021, 3, 720215. [Google Scholar] [CrossRef]
Figure 1. Disease assessment on eight differential cultivars against race KN2.
Figure 1. Disease assessment on eight differential cultivars against race KN2.
Ijms 25 01134 g001
Figure 2. Disease reaction on resistant melon line IML107 and susceptible melon line IML197 against race KN2; R = Resistant; S = Susceptible.
Figure 2. Disease reaction on resistant melon line IML107 and susceptible melon line IML197 against race KN2; R = Resistant; S = Susceptible.
Ijms 25 01134 g002
Figure 3. High Resolution Melting analysis with PM resistant markers (a) Pm-2-HRM-1 on Chr2, (b) Pm-5-HRM-1 on Chr5 and (c) Pm-12-HRM-1on chr12; Yellow curves represent R lines, red curves represent S lines and purple curves represents the heterozygotes which are marked by yellow, red and purple arrows, respectively.
Figure 3. High Resolution Melting analysis with PM resistant markers (a) Pm-2-HRM-1 on Chr2, (b) Pm-5-HRM-1 on Chr5 and (c) Pm-12-HRM-1on chr12; Yellow curves represent R lines, red curves represent S lines and purple curves represents the heterozygotes which are marked by yellow, red and purple arrows, respectively.
Ijms 25 01134 g003
Figure 4. Gel picture showing the amplification pattern of 23 LRR primers on chromosome 2; P1—IML107 DNA, P2—IML197 DNA, F1—IML107 × IML197 DNA, numbers in red indicates the polymorphic marker.
Figure 4. Gel picture showing the amplification pattern of 23 LRR primers on chromosome 2; P1—IML107 DNA, P2—IML197 DNA, F1—IML107 × IML197 DNA, numbers in red indicates the polymorphic marker.
Ijms 25 01134 g004
Figure 5. Linkage Map for three selected markers on chromosome 2 tested with 39 F2 plants.
Figure 5. Linkage Map for three selected markers on chromosome 2 tested with 39 F2 plants.
Ijms 25 01134 g005
Table 1. Characterization of race KN2 on eight differential cultivars.
Table 1. Characterization of race KN2 on eight differential cultivars.
S. No.Melon LinePodosphaera xanthii
KN2
1.SCNU1154S
2.PMR45S
3.WMR29S
4.PI414723S
5.PMR5R
6.MR-1R
7.PI124112R
8.Edisto 47R
R = Resistant; S = Susceptible.
Table 2. Genetic inheritance of resistance against race KN2.
Table 2. Genetic inheritance of resistance against race KN2.
MaterialsPlant TypeResistantSusceptibleExpected Ratio (R:S)Chi-Squarep Value
IML107P1150---
IML197P2015---
IML107 × IML197F1150---
IML107 × IML197F2100383:10.170.68
Table 3. Information of polymorphic LRR markers in the study.
Table 3. Information of polymorphic LRR markers in the study.
No.Marker Name‘F’-Sequence‘R’-SequenceProduct Size (bp)
1MELO C2-1GAAGGAGGTGAGGTTGGATAAGTTTGGAACTGCTTGGGAAATG997
2MELO C2-6ACTTGGTTGCCGTCCATTATGGTGTCTGGTAGCCTTGTTAG360
3MELO C2-13GCGGAGGGATTGGCTTATTCAGCATGCACCCGTATTCTA805
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kheng, S.; Choe, S.-H.; Sahu, N.; Park, J.-I.; Kim, H.-T. Identification of Gene Responsible for Conferring Resistance against Race KN2 of Podosphaera xanthii in Melon. Int. J. Mol. Sci. 2024, 25, 1134. https://doi.org/10.3390/ijms25021134

AMA Style

Kheng S, Choe S-H, Sahu N, Park J-I, Kim H-T. Identification of Gene Responsible for Conferring Resistance against Race KN2 of Podosphaera xanthii in Melon. International Journal of Molecular Sciences. 2024; 25(2):1134. https://doi.org/10.3390/ijms25021134

Chicago/Turabian Style

Kheng, Sopheak, San-Ha Choe, Nihar Sahu, Jong-In Park, and Hoy-Taek Kim. 2024. "Identification of Gene Responsible for Conferring Resistance against Race KN2 of Podosphaera xanthii in Melon" International Journal of Molecular Sciences 25, no. 2: 1134. https://doi.org/10.3390/ijms25021134

APA Style

Kheng, S., Choe, S.-H., Sahu, N., Park, J.-I., & Kim, H.-T. (2024). Identification of Gene Responsible for Conferring Resistance against Race KN2 of Podosphaera xanthii in Melon. International Journal of Molecular Sciences, 25(2), 1134. https://doi.org/10.3390/ijms25021134

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop