Next Article in Journal
The Impact of ARMS2 (rs10490924), VEGFA (rs3024997), TNFRSF1B (rs1061622), TNFRSF1A (rs4149576), and IL1B1 (rs1143623) Polymorphisms and Serum Levels on Age-Related Macular Degeneration Development and Therapeutic Responses
Next Article in Special Issue
Integrated Biological Experiments and Proteomic Analyses of Nicotiana tabacum Xylem Sap Revealed the Host Response to Tomato Spotted Wilt Orthotospovirus Infection
Previous Article in Journal
Impact of Methylated Cyclodextrin KLEPTOSE® CRYSMEB on Inflammatory Responses in Human In Vitro Models
Previous Article in Special Issue
Strigolactones Negatively Regulate Tobacco Mosaic Virus Resistance in Nicotiana benthamiana
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Transcriptome Analysis Reveals the Effect of Oyster Mushroom Spherical Virus Infection in Pleurotus ostreatus

1
School of Agriculture, Ludong University, Yantai 264025, China
2
Department of Plant Science, University of Cambridge, Cambridge CB2 3EA, UK
3
Yantai Growth Drivers Conversion Research Institute and Yantai Science and Technology Achievement Transfer and Transformation Demonstration Base, Yantai 264001, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2024, 25(17), 9749; https://doi.org/10.3390/ijms25179749
Submission received: 24 August 2024 / Revised: 4 September 2024 / Accepted: 6 September 2024 / Published: 9 September 2024
(This article belongs to the Special Issue Advances in Plant Virus Diseases and Virus-Induced Resistance)

Abstract

Oyster mushroom spherical virus (OMSV) is a mycovirus that inhibits mycelial growth, induces malformation symptoms, and decreases the yield of fruiting bodies in Pleurotus ostreatus. However, the pathogenic mechanism of OMSV infection in P. ostreatus is poorly understood. In this study, RNA sequencing (RNA-seq) was conducted, identifying 354 differentially expressed genes (DEGs) in the mycelium of P. ostreatus during OMSV infection. Verifying the RNA-seq data through quantitative real-time polymerase chain reaction on 15 DEGs confirmed the consistency of gene expression trends. Both Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses highlighted the pivotal role of primary metabolic pathways in OMSV infection. Additionally, significant changes were noted in the gene expression levels of carbohydrate-active enzymes (CAZymes), which are crucial for providing the carbohydrates needed for fungal growth, development, and reproduction by degrading renewable lignocellulose. The activities of carboxymethyl cellulase, laccase, and amylase decreased, whereas chitinase activity increased, suggesting a potential mechanism by which OMSV influenced mycelial growth through modulating CAZyme activities. Therefore, this study provided insights into the pathogenic mechanisms triggered by OMSV in P. ostreatus.

1. Introduction

Mycoviruses are ubiquitously distributed across all major fungal taxa and were discovered later than viruses infecting plants, animals, and prokaryotes [1,2,3]. In 1962, the first fungal virus, La France isometric virus, was discovered to infect the economically important Agaricus bisporus [4]. To date, more than 60 distinct mycoviruses have been documented to infect edible fungi, encompassing double-stranded RNA (dsRNA), positive-sense single-stranded RNA (+ssRNA), and negative-sense single-stranded RNA (−ssRNA) viruses [5,6]. Most mycoviruses are latent or asymptomatic in edible fungi hosts, whereas some have deleterious effects, such as altering mycelial growth, colony morphology, sporulation, coloration, and virulence [7,8,9,10].
Virus infection involves an interaction between the virus and the host. During pathogenesis, transcriptional analysis can be performed to focus on the pathogenic strategy of the virus. RNA sequencing (RNA-seq) provides a novel approach to transcriptome analysis and is widely used to reveal the response of fungal hosts to mycoviral infection [11]. During the ssRNA mycovirus Cryphonectria hypovirus 1 (CHV1) infection, significant, yet specific, changes in primary and secondary metabolism occurred, and antiviral fungal metabolites were induced in Cryphonectria parasitica [12]. During Beauveria bassiana chrysovirus 2 infection in host fungi B. bassiana, transcriptome analysis showed that genes related to mycelial growth, insect epidermis penetration, and toxin metabolism were downregulated [13]. Recent data have shown that Bipolaris maydis partitivirus 36 (BmPV36) curtails the virulence of B. maydis by dismantling host cellular architecture, suppressing toxin and cell wall-degrading enzyme synthesis, and decelerating cellular metabolism [14]. The transcriptomic profiling of mushroom virus X (MVX) in Agaricus bisporus implied that the host attempted to curtail infection by dampening vesicular transport activities [15]. Despite these insights, exploration into mycoviruses infecting mushrooms remains limited.
Carbohydrate-active enzymes (CAZymes) are for hydrolyzing plant cell wall polysaccharides and are essential for substrate degradation processes [16]. Fungal CAZymes are categorized into five main families: glycoside hydrolase (GH), glycosyltransferase (GT), polysaccharide lyase (PL), carbohydrate esterase (CE), and auxiliary activities (AA) [17]. The CAZy database classifies laccase within the AA family, which is involved in lignin degradation. Cellulase, chitinase, and amylase belong to the GH family, and are responsible for degrading cellulose, chitin, and starch, respectively. Additionally, the activity levels of these enzymes can be influenced by various factors, including environmental conditions and the presence of pathogens or symbionts, such as mycoviruses. Several studies have demonstrated that mycovirus infection can alter the activities of host CAZymes. Laccase activities were significantly reduced in the dsRNA virus-infected C. parasitica [18]. Similarly, BmPV36 infection significantly decreased the expression of genes involved in the synthesis of cellulase, pectinesterase, and cutinase in B. maydis [14]. In addition, the dsRNA mycovirus Pleurotus ostreatus virus-ASI2792 influenced spawn growth and fruiting body development in P. ostreatus by reducing the expression and activities of certain CAZymes, including amylase and chitinase [19].
P. ostreatus, a globally cultivated edible mushroom, has high economic, nutritional, and therapeutic significance [20,21]. The oyster mushroom can be infected by several dsRNA and ssRNA mycoviruses [22,23,24,25,26,27]. The oyster mushroom spherical virus (OMSV), the first ssRNA virus identified in P. ostreatus, causes mushroom dieback disease. OMSV is a spherical virus, 27 nm in diameter, with a genome of 5784 bp encoding seven open-reading frames [28]. It has been detected in multiple regions in China, including Beijing City, Shandong Province, and Jilin Province [29,30,31]. In previous studies, an OMSV−China strain was isolated from P. ostreatus 8129, which could be transmitted horizontally to virus-free Pleurotus pulmonarius or Pleurotus floridanus strains and vertically propagated via basidiospores [32,33]. The OMSV infection caused mycelium retardation and fruiting body deformation, leading to reduced mushroom yields and a decline in their commercial value [31]. However, studies exploring the pathogenic mechanisms underlying OMSV infection remain scarce. Therefore, identifying and analyzing the host factors involved in OMSV infection and elucidating the OMSV pathogenic mechanism are essential.
In this study, RNA-seq was used for the first time to investigate the response of P. ostreatus to OMSV infection. Also, the activities of extracellular enzymes, including laccase, carboxymethyl cellulase (CMCase), amylase, and chitinase, were also analyzed during OMSV infection in P. ostreatus to examine the relationship between OMSV infection and the phenotypic changes it induced in P. ostreatus. This study offered a theoretical basis for deeper exploration of the pathogenic mechanisms of OMSV in P. ostreatus, thus assisting in developing disease-resistant varieties of edible fungi and preventing and controlling diseases.

2. Results

2.1. Transcriptome Data Assembly Results

Previous studies revealed that OMSV inhibited mycelial growth and induced deformities in the fruiting bodies of P. ostreatus [31,32]. The OMSV-free and OMSV-infected mycelia of strain P. ostreatus 8129 were collected for transcriptome sequencing to identify the genes associated with OMSV infection in P. ostreatus. As shown in Figure 1a, a significant decrease in the growth rate of OMSV−infected (OMSV) mycelia was observed compared with that of OMSV-free (Mock) mycelia of P. ostreatus after 7 days of inoculation. This was followed by reverse transcription–polymerase chain reaction (PCR) detection (Figure 1b). Two cDNA libraries, OMSV-free and OMSV-infected strains, were sequenced, and 41.21 Gb of clean data were obtained. The samples with Q30 above 92.63% (exceeding 90%) indicated high data quality. Additionally, the GC content above 50% indicated that the sequencing was not obviously biased (Table 1). The data quality was considered satisfactory, indicating that the sequencing data could be further analyzed for its quality and accuracy.

2.2. Expression Analysis

As depicted in Figure 2a, principal component 1 (PC1) accounted for 31.05% of the sample variability, whereas principal component 2 (PC2) accounted for 24.01%. The distribution of the highest, lowest, and median log10 fragments per kilobase of transcript per million mapped reads (FPKM) values of gene expression across different samples is displayed in a boxplot in Figure 2b. The results demonstrated that the gene expression in P. ostreatus was relatively concentrated, with the median log10 (FPKM) values for both the OMSV-infected and OMSV−free strains clustering around 1.

2.3. Differential Gene Analysis

Differentially expressed genes (DEGs) in OMSV infection were identified using a false discovery rate (FDR) corrected p-value ≤ 0.05 and a fold change ≥ 1.5. The sequencing results revealed 354 DEGs on comparing the OMSV−infected strain with the OMSV-free strain (Figure 3a). Among these 354 DEGs, 174 were upregulated and 180 were downregulated (Figure 3b). The heat map of the hierarchical cluster analysis further supported these results, confirming the difference between the two sample groups (Figure 3c).

2.4. KOG Functional Enrichment Analysis of DEGs

Sequences with Basic Local Alignment Search Tool (BLAST) software (version 2.2.26) hits were further classified through Eukaryotic Ortholog Group (KOG) pathway analysis. This analysis revealed that 134 DEGs were annotated and enriched into 19 functional classifications. Also, the DEGs were mainly distributed in the cluster related to “secondary metabolites biosynthesis, transport and catabolism, energy production and conversion, carbohydrate transport and metabolism, amino acid transport and metabolism, and lipid transport and metabolism”, all of which contained higher-than-average amounts of DEGs. The cluster of “secondary metabolites biosynthesis, transport and catabolism” accounted for 16% of the total annotated DEGs (Figure 4). Lectin is a protein that binds to carbohydrates and displays a wide range of biological properties, including antimicrobial, antifungal, and antiviral activities [34]. The transcriptome data analysis revealed that one gene-encoding lectin (g1097844) was significantly upregulated and belonged to the protein encoded by the ricin-type β-trefoil lectin domain.

2.5. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes Functional Enrichment Analysis of DEGs

The 230 DEGs annotated in the Gene Ontology (GO) database were dispersed across 30 functional categories, including 12 subclasses in biological process (BP), 11 subclasses in cell component (CC), and 7 subclasses in molecular function (MF). Among these 230 DEGs, 119 were upregulated and 111 were downregulated. In the BP branch, the three subcategories containing the most DEGs were metabolic processes, single-organism processes, and cellular processes with 111, 78, and 44 DEGs, respectively. In the CC branch, the 2 subclasses containing the most DEGs were membrane and membrane part, with 76 and 70 DEGs, respectively. In the MF branch, the 3 subclasses with the most DEGs were catalytic, binding, and transporter activities with 136, 99, and 21 DEGs, respectively (Figure 5a). GO functional enrichment analysis was performed to explore the infection mechanism of OMSV at the molecular level. This analysis was conducted for both upregulated and downregulated DEGs, yielding distinct and significant results. A significant enrichment of upregulated DEGs was noted in primary metabolism, including carbohydrate metabolic processes (GO: 0005975), oxidoreductase activity (GO: 0016491), and hydrolase activity (GO: 0004553), which are crucial for survival during viral infection. Moreover, the downregulated DEGs were mostly enriched in all three branches, including an integral component of the aromatic amino acid family biosynthetic process (GO: 0009073), heme binding (GO: 0020037), iron ion binding (GO: 0005506), monooxygenase activity (GO: 0004497), and membrane (GO: 0016021).
Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis indicated that 141 DEGs were mainly manifested in four pathways: “Cellular Processes” (10 DEGs), “Environmental Information Processing” (2 DEGs), “Genetic Information Processing” (16 DEGs), and “Metabolism” (113 DEGs). Among these, the number of DEGs related to glycine, serine, and threonine metabolism was the highest (Figure 5b). DEGs of OMSV-infected samples were annotated to 10 KEGG pathways (p-value < 0.05) (Figure 5c). The top three KEGG pathways with the largest numbers of DEGs were “glyoxylate and dicarboxylate metabolism”, “glycine, serine, and threonine metabolism”, and “fatty acid biosynthesis” (Table 2), indicating that the carbohydrate metabolism, amino acid metabolism, and lipid metabolism pathways in P. ostreatus were affected by OMSV infection. GO and KEGG analysis showed that OMSV infection significantly changed the primary metabolism in P. ostreatus.

2.6. Quantitative Reverse Transcription-PCR Validation of DEGs

CAZymes play a crucial role in the metabolism of glycoconjugates, polysaccharides, and oligosaccharides. Fungal CAZymes are categorized into five major families: GH, GT, PL, CE, and AA [17]. The investigation of CAZyme gene expression showed that 23 DEGs were related to CAZymes. Of these, 19 were GH family genes, with 15 upregulated (g1057808, g1081432, g35611, g1074848, g1035754, g1093467, g1046178, g696, g21100, g1035175, g49423, g1035282, g1098006, g1088664, and g53126) and 4 downregulated (g152719, g1077485, g160022, and g1103527) genes. The expression of one AA family gene (g51725) and one GT family gene (g1067151) was downregulated, and the expression of one PL family gene (g1036297) and one CE family gene (g1044335) was upregulated.
A total of 15 genes with high expression levels were selected for quantitative reverse transcription-PCR (qRT-PCR) verification, of which 7 belonged to genes encoding carbohydrate enzymes, to validate the RNA-seq results (Table 3). The qRT-PCR results showed that three genes (g1074848, g1088664, and g1036297) were upregulated and four genes (g1077485, g1103527, g1067151, and g51725) were downregulated, which were consistent with the results of RNA-seq. In addition, eight genes (g1073569, g1052256, g1047319, g1073665, g1088328, g1113424, g1044280, and g1046093) with high expression levels were randomly selected for qRT-PCR verification, and their results also aligned with those from RNA-seq (Figure 6).

2.7. Effect of OMSV Infection on CAZymes

As a member of the white-rot fungi, P. ostreatus uses CAZymes, including laccase, amylase, CMCase, and chitinase, to degrade lignocellulose and provide nutrients essential for mycelial growth [19]. The activities of laccase, chitinase, amylase, and CMCase were measured to investigate the impact on carbohydrate enzymes of OMSV infection. The enzyme activity results showed a gradual rise in laccase and amylase from 5 to 8 dpi, whereas the activities of CMCase and chitinase initially increased before declining, peaking on the seventh day of cultivation (Figure 7). OMSV-infected strains exhibited diminished activities of laccase, CMCase, and amylase compared with OMSV-free stains, along with a marked increase in chitinase activity. These findings suggest that the OMSV infection influenced the physiological responses of P. ostreatus, including the activities of CAZymes.

3. Discussion

Most mycoviruses are latent in their host fungi; however, some have been shown to affect the growth, pigmentation, and virulence of the host [7,9,35]. OMSV has been reported as a difficult-to-control pathogen responsible for causing oyster mushroom dieback disease [28]. A previous study found that OMSV induced not only retarded mycelial growth but also abnormal fruiting body development, resulting in significant declines in mushroom yield [31]. The present study was novel in describing the pathogenic mechanism of OMSV infection in P. ostreatus using transcriptomics. GO enrichment analysis showed that DEGs were significantly enriched in oxidoreductase activity, amino acid metabolism, and heme binding. Heme binding refers to the iron-complexed compound in the porphyrin (tetrapyrrole) ring. The heme assimilation pathway has been identified as a vital iron acquisition method in fungi [36,37,38]. Heme represents a paramount source of iron crucial for microorganisms, and iron is indispensable to nearly all living organisms due to its vital role in metabolism and energy generation [39]. During OMSV infection, significant enrichment of DEGs in the heme-binding pathway was observed. It was hypothesized that OMSV might influence the defense response of P. ostreatus by affecting iron formation, a defense strategy previously reported in Cordyceps militaris against Calcarisporium cordycipiticola [40]. Furthermore, OMSV infection significantly altered the primary metabolism of the host P. ostreatus, as evidenced by the enrichment of KEGG pathways linked to carbohydrate, fatty acid, and amino acid metabolism. Previous studies have shown that Rhizoctonia infection affects the primary metabolism of soybean seedlings, particularly through carbohydrate, amino acid, and carboxylic acid metabolisms [41]. Similarly, the infection of C. cordycipiticola in C. militaris significantly changed primary metabolism, including amino acid and 2-oxocarboxylic acid pathways [40].
The fungi can produce various secondary metabolites (such as terpenoids), lectins, and other bioactive substances as part of their chemical defense against viral infection [42,43,44]. Previous reports indicated that enrichment of secondary metabolite pathways plays a crucial role in Sclerotinia sclerotiorum defense against Sclerotinia sclerotiorum hypovirulence-associated DNA virus 1 (SsHADV-1) infection [45]. A recent study revealed changes in most secondary metabolites of C. parasitica, including alkaloids, terpenoids, and polyketides, which might serve as a barrier defense against CHV1 infection. Another study showed that C. parasitica defended against CHV1 infection by the changes in most secondary metabolites, including alkaloids, terpenoids, and polyketides [12]. The present study revealed significant enrichment of genes regulating secondary metabolites in the KOG pathways during OMSV infection. Edible mushrooms contain high amounts of lectins, which are carbohydrate-binding proteins of non-immune origin with a specific binding affinity for glycoconjugates [46,47,48,49,50]. Certain lectins are known for their roles in defense responses, although their characterization of these defenses remains limited [51,52]. The lectins isolated from Gymnopilus mushrooms were shown to inhibit the growth of Staphylococcus aureus and Aspergillus niger, indicating the role of lectins in defense responses [34,53]. In addition, recent studies have shown that the lectin gene Polec2 of P. ostreatus plays a role in defense against the mite predator Tyrophagus putrescentiae [54]. The present study demonstrated a pronounced elevation in the expression of lectin genes during OMSV infection, suggesting that lectins might be actively involved in the defense response against OMSV, a hypothesis that warrants further investigation.
P. ostreatus secretes various extracellular enzymes, including CAZymes, during growth and development. CAZymes can decompose natural macromolecules such as polysaccharides, proteins, and nucleic acids into small molecules that are easily absorbed by edible fungi hyphae and fruiting bodies, providing nutrients for mycelial growth, primordium formation, and fruiting body development. Therefore, these enzymes are essential for achieving optimal mushroom yields [55]. CAZy GH enzymes hydrolyze glycosidic bonds between two or more carbohydrates or between one carbohydrate and non-carbohydrate parts in basidiomycetes, and are key enzymes involved in carbohydrate metabolism [17]. In addition, GHs are common enzymes in nature that degrade the most abundant biomasses, such as cellulose, hemicellulose, and starch [56,57]. The enzymes involved in lignin degradation, such as laccase, which participate in the depolymerization of non-carbohydrate components like lignin, are categorized into AA families [58,59]. The transcriptome data of this study showed that the CMCase gene g152719, amylase gene g160022, and laccase gene g51725 were downregulated during OMSV infection in P.ostreatus. The enzyme activity results indicated that the activities of laccase, CMCase, and amylase decreased during OMSV infection, suggesting a potential mechanism by which OMSV influenced mycelial growth through modulating CAZyme activities. The study found that the genes regulating chitinase (g53126, g1057808, g1074848, g696, and g1098006) were significantly upregulated. Chitinase is involved in the defense response against plant pathogens. Studies have shown that the CaChiIII7 chitinase gene in peppers plays a pivotal defensive role against Colletotrichum acutatum [60]. Also, a recent study reported that three soybean chitinases (GmChi01, GmChi02, and GmChi16) were involved in defense against Fusarium oxysporum [61]. Similarly, the chitinase of Brassica napus played a role in defense against Leptosphaeria maculans [62]. Based on the upregulation of chitinase gene expression and increased enzyme activity during OMSV infection, it is speculated that chitinase and its active products may serve as signaling molecules, activating the expression of host defense-related genes, which deserves further validation.

4. Materials and Methods

4.1. RNA Extraction

The mycelium of OMSV-free and OMSV−infected P. ostreatus strains were cultivated in a constant temperature incubator at 24 °C for 7 days. Total RNA extraction from P. ostreatus mycelia was meticulously conducted utilizing the RNA extraction kit (Tiangen, Beijing, China), adhering strictly to the manufacturer’s protocol. For the detection of RNA purity and concentration, the NanoDrop 2000 spectrophotometer was used. The integrity of RNA is accurately detected using Agilent 2100 (Agilent Technologies, Santa Clara, CA, USA).

4.2. Reverse Transcription PCR

Preparation of the 20 μL RT master mixture for the RT reaction consisted of 5 μL of RNA, 4 μL of RT 5× buffer, 0.5 μL of reverse primer (OMSV-R), 0.25 μL of M-MLV reverse transcriptase, 0.25 μL of RNase Inhibitor, 1 μL of dNTP mix, and 9 μL of ddH2O. The RT process was carried out at 37 °C for 90 min. After the RT reaction, the PCR mixture was prepared containing 2 μL cDNA template, 10 μL 2 × Taq PCR MasterMix II (Tiangen, Beijing, China), 0.5 μL primers (OMSV-F/OMSV-R, ACCCCCCCAGGATCTCAAGCTTC/GAGATGTAGACRTTGAAAGC) for each, and 7 μL ddH2O final volume of 20 μL for PCR amplification. Amplification products were electrophoresis in 1% agarose gel.

4.3. cDNA Library Preparation and Illumina Sequencing

Following sample qualification, library construction proceeded, with eukaryotic mRNA enrichment using magnetic beads with Oligo (dT). First-strand cDNA was synthesized using fragmented mRNA as the template and random hexamers as primers. Subsequently, second-strand synthesis was performed using a DNA polymerase I system. The integrity and quality of the generated libraries were meticulously assessed using the Qubit 3.0 Fluorometer, quantitative real-time PCR (qRT-PCR), and the Qsep400 high-throughput analysis system. The cDNA library was sequenced using the Illumina NovaSeq 6000 platform at the Beijing Biomarker Technologies Co., Ltd. (Beijing, China).

4.4. Data Processing and Differential Expression Analysis

Raw sequencing reads underwent rigorous quality control, eliminating adapter sequences, reads harboring over 10% unknown nucleotides, and those of low quality, yielding a set of cleaned reads. These cleaned reads were then aligned to the reference genome of P. ostreatus utilizing the HISAT2 (version 2.2.0) alignment tool. Transcript abundances were estimated by employing the widely recognized metric of fragments per kilobase of transcript per million mapped reads (FPKM) [63]. Ultimately, we pinpointed DEGs through application of the DESeq2 methodology [64]. Throughout this differential expression analysis, genes with a fold change ≥ 1.5 and an FDR < 0.05 were deemed statistically significant and selected for further investigation.

4.5. Functional Analysis of DEGs

To elucidate the functional roles and pathways of the differentially expressed genes (DEGs), comprehensive analyses were conducted, encompassing Eukaryotic Ortholog Groups (KOGs), Gene Ontology (GO) functional annotation, and the Kyoto Encyclopedia of Genes and Genomes (KEGG). The corrected p-value < 0.05 was considered statistically significant.

4.6. Quantitative RT-PCR Validation

The samples subjected to qRT-PCR originated from RNA in transcriptome sequencing. Randomly selected 15 DEGs were quantitatively validated for their expression levels through qRT-PCR. All of the primers were designed using Primer 6.0 software (Premier, Ottawa, ON, Canada) (Table 4). The β-tubulin gene (Forward/Reverse primers, AGGCTTTCTTGCATTGGTACACGC/TATTCGCCTTCTTCCTCATCGGCA) was used as an endogenous control for normalization. Quantitative real-time PCR was carried out utilizing a CFX96 real-time PCR detection system. The composition of the qRT-PCR reaction mixture was meticulously prepared: 10 μL 2 × Taq Pro Universal SYBR qPCR Master Mix (Vazyme Biotech, Nanjing, China); 0.4 μL primers for each; 8.2 μL ddH2O, 1 μL cDNA, and the final volume was 20 μL. The reaction was performed on a qRT-PCR instrument using the following cycling parameters: 95 °C 120 s; followed by 39 cycles of 95 °C 5 s and 60 °C 30 s. Expression fold changes of the fifteen DEGs were calculated by adopting the 2−ΔΔCt method, with β-tubulin serving as the internal reference genes. Each qRT-PCR run incorporated triplicates for enhanced reliability.

4.7. Measurement of Enzyme Activity

Laccase activity was assessed utilizing 2,2′-azino-bis (3-ethylbenzthiazoline-6-sulphonate) (ABTS). A 3 mL reaction mixture was prepared, including 1 mL ABTS (1 M), 1.9 mL citric acid sodium-hydrogen-phosphate buffer (0.1 M, pH 5.0), and 0.1 mL supernatant. The progression of ABTS oxidation was monitored through an absorbance increase at 420 nm (ε = 36,000 M−1 cm−1). One unit of enzyme activity was established as the catalytic conversion of 1 μmol of ABTS within a minute [65]. CMCase activity determination was executed using the 3,5-dinitrosalicylic acid (DNS) method at 540 nm, with one unit established as the amount of enzyme releasing 1 µmol of reducing sugars equivalent to CMCase within a minute [66]. Chitinase activity measurement was carried out colorimetrically, employing colloidal chitin as the substrate. One unit of chitinase activity was established as the amount of enzyme producing 1 μmol of N-acetyl glucosamine under 37 °C within a minute [67]. Amylase activity assessment relied on the DNS method to quantify reducing sugars released from starch. Here, one unit of amylase activity was established as the quantity of enzyme required to produce 1 μmol of reducing sugar within a minute [68].

5. Conclusions

In this study, RNA-seq was used for the first time to investigate the response of P. ostreatus to OMSV infection. A total of 354 DEGs were identified and analyzed. Both GO and KEGG analyses highlighted the pivotal role of primary metabolic pathways in OMSV infection. Also, the activities of extracellular enzymes, including laccase, CMCase, amylase, and chitinase, were also analyzed during OMSV infection in P. ostreatus to examine the relationship between OMSV infection and the phenotypic changes it induced in P. ostreatus. This study offered a theoretical basis for deeper exploration of the pathogenic mechanisms of OMSV in P. ostreatus, thus assisting in developing disease-resistant varieties of edible fungi and preventing and controlling diseases.

Author Contributions

Conceptualization, Y.W., J.Y. and X.Z.; methodology, J.Y., G.S., H.H. and Y.W.; investigation, Y.W., J.Y., G.S., Z.S., H.H., L.Y., L.Z., J.W., Y.L. and M.S.; data curation, X.Z. and M.S.; validation, M.S.; writing—original draft preparation, X.Z. and Y.W.; writing—review and editing X.Z., Y.W. and M.S.; funding acquisition, X.Z. and X.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported in part by the Yantai Science and Technology Development Project, Shandong Province, China (2023JCYJ087), the Youth Innovation Technology Support Planning Project for Institution of Higher Education of Shandong Province (2022KJ121), the National Natural Science Foundation of China (31900139), and the Edible Fruiting bodies Genetic Breeding Innovation Team of Shandong Agricultural Industry Technology System (SDAIT-07-03).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw RNA-seq data of the present study were deposited into the NCBI database with an accession number of PRJNA1150065.

Acknowledgments

We sincerely thank Lei Sun (Ludong University, China) and Yanxiang Zhao (Qingdao Agricultural University, China) for their helpful comments on this research.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Doedt, T.; Krishnamurthy, S.; Bockmühl, D.P.; Tebarth, B.; Stempel, C.; Russell, C.L.; Brown, A.J.; Ernst, J.F. APSES proteins regulate morphogenesis and metabolism in Candida albicans. Mol. Biol. Cell 2004, 15, 3167–3180. [Google Scholar] [CrossRef] [PubMed]
  2. Sahin, E.; Akata, I. Viruses infecting macrofungi. Virusdisease 2018, 29, 1–18. [Google Scholar] [CrossRef] [Scilit]
  3. Hollings, M. Mycoviruses: Viruses that infect fungi. Adv. Virus Res. 1978, 22, 1–53. [Google Scholar]
  4. HOLLINGS, M. Viruses Associated with A Die-Back Disease of Cultivated Mushroom. Nature 1962, 196, 962–965. [Google Scholar] [CrossRef] [Scilit]
  5. Zhang, Y.J.; Gao, J.; Li, Y. Diversity of mycoviruses in edible fungi. Virus Genes 2022, 58, 377–391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Nibert, M.L.; Ghabrial, S.A.; Maiss, E.; Lesker, T.; Vainio, E.J.; Jiang, D.; Suzuki, N. Taxonomic reorganization of family Partitiviridae and other recent progress in partitivirus research. Virus Res. 2014, 188, 128–141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Ghabrial, S.A.; Castón, J.R.; Jiang, D.; Nibert, M.L.; Suzuki, N. 50-plus years of fungal viruses. Virology 2015, 479–480, 356–368. [Google Scholar] [CrossRef] [Scilit]
  8. Ghabrial, S.A.; Suzuki, N. Viruses of plant pathogenic fungi. Annu. Rev. Phytopathol. 2009, 47, 353–384. [Google Scholar] [CrossRef] [Scilit]
  9. Son, M.; Yu, J.; Kim, K.H. Five Questions about Mycoviruses. PLoS Pathog. 2015, 11, e1005172. [Google Scholar] [CrossRef] [Scilit]
  10. Xie, J.T.; Jiang, D.H. New insights into mycoviruses and exploration for the biological control of crop fungal diseases. Annu. Rev. Phytopathol. 2014, 52, 45–68. [Google Scholar] [CrossRef] [Scilit]
  11. Sun, X.Y.; Wang, Z.Y.; Gu, Q.S.; Li, H.L.; Han, W.L.; Shi, Y. Transcriptome analysis of Cucumis sativus infected by Cucurbit chlorotic yellows virus. Virol. J. 2017, 14, 18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Chun, J.; Ko, Y.H.; Kim, D.H. Transcriptome Analysis of Cryphonectria parasitica Infected with Cryphonectria hypovirus 1 (CHV1) Reveals Distinct Genes Related to Fungal Metabolites, Virulence, Antiviral RNA-Silencing, and Their Regulation. Front. Microbiol. 2020, 11, 1711. [Google Scholar] [CrossRef] [Scilit]
  13. Zhang, Z.K.; Guo, W.B.; Lu, Y.; Kang, Q.; Sui, L.; Liu, H.; Zhao, Y.; Zou, X.W.; Li, Q.Y. Hypovirulence-associated mycovirus epidemics cause pathogenicity degeneration of Beauveria bassiana in the field. Virol. J. 2023, 20, 255. [Google Scholar] [CrossRef] [Scilit]
  14. Wang, Y.J.; Li, Q.S.; Wu, Y.X.; Han, S.; Xiao, Y.; Kong, L.X. The Effects of Mycovirus BmPV36 on the Cell Structure and Transcription of Bipolaris maydis. J. Fungi 2024, 10, 133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. O’Connor, E.; Doyle, S.; Amini, A.; Grogan, H.; Fitzpatrick, D.A. Transmission of mushroom virus X and the impact of virus infection on the transcriptomes and proteomes of different strains of Agaricus bisporus. Fungal Biol. 2021, 125, 704–717. [Google Scholar] [CrossRef] [Scilit]
  16. André, I.; Potocki-Véronèse, G.; Barbe, S.; Moulis, C.; Remaud-Siméon, M. CAZyme discovery and design for sweet dreams. Curr. Opin. Chem. Biol. 2014, 19, 17–24. [Google Scholar] [CrossRef] [Scilit]
  17. Sista Kameshwar, A.K.; Qin, W. Comparative study of genome-wide plant biomass-degrading CAZymes in white rot, brown rot and soft rot fungi. Mycology 2018, 9, 93–105. [Google Scholar] [CrossRef] [Scilit]
  18. Rigling, D.; Van Alfen, N.K. Extra- and Intracellular Laccases of the Chestnut Blight Fungus, Cryphonectria parasitica. Appl. Environ. Microbiol. 1993, 59, 3634–3639. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Song, H.Y.; Kim, N.; Kim, D.H.; Kim, J.M. The PoV mycovirus affects extracellular enzyme expression and fruiting body yield in the oyster mushroom, Pleurotus ostreatus. Sci. Rep. 2020, 10, 1094. [Google Scholar] [CrossRef] [Scilit]
  20. Hoa, H.T.; Wang, C.L.; Wang, C.H. The Effects of Different Substrates on the Growth, Yield, and Nutritional Composition of Two Oyster Mushrooms (Pleurotus ostreatus and Pleurotus cystidiosus). Mycobiology 2015, 43, 423–434. [Google Scholar] [CrossRef] [Scilit]
  21. Chorváthová, V.; Bobek, P.; Ginter, E.; Klvanová, J. Effect of the oyster fungus on glycaemia and cholesterolaemia in rats with insulin-dependent diabetes. Physiol. Res. 1993, 42, 175–179. [Google Scholar] [PubMed]
  22. Lim, W.S.; Jeong, J.H.; Jeong, R.D.; Yoo, Y.B.; Yie, S.W.; Kim, K.H. Complete nucleotide sequence and genome organization of a dsRNA partitivirus infecting Pleurotus ostreatus. Virus Res. 2005, 108, 111–119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Ro, H.S.; Lee, N.J.; Lee, C.W.; Lee, H.S. Isolation of a novel mycovirus OMIV in Pleurotus ostreatus and its detection using a triple antibody sandwich-ELISA. J. Virol. Methods 2006, 138, 24–29. [Google Scholar] [CrossRef] [Scilit]
  24. Qiu, L.Y.; Li, Y.P.; Liu, Y.M.; Gao, Y.Q.; Qi, Y.C.; Shen, J.W. Particle and naked RNA mycoviruses in industrially cultivated mushroom Pleurotus ostreatus in China. Fungal Biol. 2010, 114, 507–513. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Kim, Y.J.; Kim, J.Y.; Kim, J.H.; Yoon, S.M.; Yoo, Y.B.; Yie, S.W. The identification of a novel Pleurotus ostreatus dsRNA virus and determination of the distribution of viruses in mushroom spores. J. Microbiol. 2008, 46, 95–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Song, H.Y.; Choi, H.J.; Jeong, H.; Choi, D.; Kim, D.H.; Kim, J.M. Viral Effects of a dsRNA Mycovirus (PoV-ASI2792) on the Vegetative Growth of the Edible Mushroom Pleurotus ostreatus. Mycobiology 2016, 44, 283–290. [Google Scholar] [CrossRef] [Scilit]
  27. Xiao, J.B.; Wang, X.; Zheng, Z.R.; Wu, Y.G.; Wang, Z.; Li, H.P.; Li, P.F. Molecular characterization of a novel deltaflexivirus infecting the edible fungus Pleurotus ostreatus. Arch. Virol. 2023, 168, 162. [Google Scholar] [CrossRef] [Scilit]
  28. Yu, H.J.; Lim, D.; Lee, H.S. Characterization of a novel single-stranded RNA mycovirus in Pleurotus ostreatus. Virology 2003, 314, 9–15. [Google Scholar] [CrossRef] [Scilit]
  29. Li, S.; Dai, J.; Zhang, Y.J.; Li, Y. Cloning of Coat Protein Gene of Oyster Mushroom Spherical Virus and Preliminary Analysis of Viral Pathogenicity. J. Northeast Agric. Sci. 2022, 47, 43–47. [Google Scholar]
  30. Shi, Y.C.; Xie, A.T.; Wang, X.L.; Wang, S.J.; Liu, X.D.; Zhou, T. Detection of oyster mushroom spherical virus in Beijing and its controlling measures. China Plant Prot. 2016, 36, 9–11+21+81. [Google Scholar]
  31. Hu, H.J.; Wang, J.R.; Cheng, X.H.; Liu, Y.; Zhang, X.Y. Preliminary Studies on the Effects of Oyster Mushroom Spherical Virus China Strain on the Mycelial Growth and Fruiting Body Yield of the Edible Mushroom Pleurotus ostreatus. Biology 2022, 11, 574. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Zhang, X.Y.; Hu, H.J.; Zhao, Y.X.; Wang, Y.F.; Zhang, W.J.; You, L.H.; Wang, J.R.; Liu, Y.; Cheng, X.H. Oyster Mushroom Spherical Virus Crosses the Species Barrier and Is Pathogenic to a New Host Pleurotus pulmonarius. Int. J. Mol. Sci. 2023, 24, 10584. [Google Scholar] [CrossRef] [Scilit]
  33. Wang, Y.F.; Wen, Z.D.; Yang, Y.Y.; Hu, X.T.; Song, Z.Z.; Hu, H.J.; Song, G.Y.; You, L.H.; Wang, J.R.; Liu, Y.; et al. Transmission of Oyster Mushroom Spherical Virus to Progeny via Basidiospores and Horizontally to a New Host Pleurotus floridanus. Int. J. Mol. Sci. 2024, 25, 5677. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Singh, R.S.; Walia, A.K.; Kennedy, J.F. Mushroom lectins in biomedical research and development. Int. J. Biol. Macromol. 2020, 151, 1340–1350. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Dawe, A.L.; Nuss, D.L. Hypoviruses and chestnut blight: Exploiting viruses to understand and modulate fungal pathogenesis. Annu. Rev. Genet. 2001, 35, 1–29. [Google Scholar] [CrossRef] [Scilit]
  36. Peng, Y.J.; Hou, J.; Zhang, H.; Lei, J.H.; Lin, H.Y.; Ding, J.L.; Feng, M.G.; Ying, S.H. Systematic contributions of CFEM domain-containing proteins to iron acquisition are essential for interspecies interaction of the filamentous pathogenic fungus Beauveria bassiana. Environ. Microbiol. 2022, 24, 3693–3704. [Google Scholar] [CrossRef] [Scilit]
  37. Haas, H. Fungal siderophore metabolism with a focus on Aspergillus fumigatus. Nat. Prod. Rep. 2014, 31, 1266–1276. [Google Scholar] [CrossRef] [Scilit]
  38. Roy, U.; Kornitzer, D. Heme-iron acquisition in fungi. Curr. Opin. Microbiol. 2019, 52, 77–83. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Pinsky, M.; Roy, U.; Moshe, S.; Weissman, Z.; Kornitzer, D. Human Serum Albumin Facilitates Heme-Iron Utilization by Fungi. mBio 2020, 11, e00607-20. [Google Scholar] [CrossRef] [Scilit]
  40. Liu, Q.; Dong, C. Dual Transcriptomics Reveals Interspecific Interactions between the Mycoparasite Calcarisporium cordycipiticola and Its Host Cordyceps militaris. Microbiol. Spectr. 2023, 11, e0480022. [Google Scholar] [CrossRef] [Scilit]
  41. Aliferis, K.A.; Faubert, D.; Jabaji, S. A metabolic profiling strategy for the dissection of plant defense against fungal pathogens. PLoS ONE 2014, 9, e111930. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. García-Pedrajas, M.D.; Cañizares, M.C.; Sarmiento-Villamil, J.L.; Jacquat, A.G.; Dambolena, J.S. Mycoviruses in Biological Control: From Basic Research to Field Implementation. Phytopathology 2019, 109, 1828–1839. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Nerva, L.; Chitarra, W.; Siciliano, I.; Gaiotti, F.; Ciuffo, M.; Forgia, M.; Varese, G.C.; Turina, M. Mycoviruses mediate mycotoxin regulation in Aspergillus ochraceus. Environ. Microbiol. 2019, 21, 1957–1968. [Google Scholar] [CrossRef] [Scilit]
  44. Li, H.P.; Yang, W.J.; Qu, S.X.; Pei, F.; Luo, X.; Mariga, A.M.; Ma, L. Variation of volatile terpenes in the edible fungi mycelia Flammulina velutipes and communications in fungus-mite interactions. Food Res. Int. 2018, 103, 150–155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Ding, F.; Cheng, J.S.; Fu, Y.P.; Chen, T.; Li, B.; Jiang, D.H.; Xie, J.T. Early Transcriptional Response to DNA Virus Infection in Sclerotinia sclerotiorum. Viruses 2019, 11, 278. [Google Scholar] [CrossRef] [Scilit]
  46. Liu, Q.H.; Wang, H.X.; Ng, T.B. Isolation and characterization of a novel lectin from the wild mushroom Xerocomus spadiceus. Peptides 2004, 25, 7–10. [Google Scholar] [CrossRef] [Scilit]
  47. Pohleven, J.; Obermajer, N.; Sabotic, J.; Anzlovar, S.; Sepcić, K.; Kos, J.; Kralj, B.; Strukelj, B.; Brzin, J. Purification, characterization and cloning of a ricin B-like lectin from mushroom Clitocybe nebularis with antiproliferative activity against human leukemic T cells. Biochim. Biophys. Acta 2009, 1790, 173–181. [Google Scholar] [CrossRef] [Scilit]
  48. Kim, S. A novel core 1 O-linked glycan-specific binding lectin from the fruiting body of Hericium erinaceus. Int. J. Biol. Macromol. 2018, 107 Pt B, 1528–1537. [Google Scholar] [CrossRef] [Scilit]
  49. Singh, S.S.; Wang, H.; Chan, Y.S.; Pan, W.; Dan, X.; Yin, C.M.; Akkouh, O.; Ng, T.B. Lectins from edible mushrooms. Molecules 2014, 20, 446–469. [Google Scholar] [CrossRef] [Scilit]
  50. Imberty, A.; Mitchell, E.P.; Wimmerová, M. Structural basis of high-affinity glycan recognition by bacterial and fungal lectins. Curr. Opin. Struct. Biol. 2005, 15, 525–534. [Google Scholar] [CrossRef] [Scilit]
  51. Bleuler-Martinez, S.; Stutz, K.; Sieber, R.; Collot, M.; Mallet, J.M.; Hengartner, M.; Schubert, M.; Varrot, A.; Künzler, M. Dimerization of the fungal defense lectin CCL2 is essential for its toxicity against nematodes. Glycobiology 2017, 27, 486–500. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Tayyrov, A.; Schmieder, S.S.; Bleuler-Martinez, S.; Plaza, D.F.; Künzler, M. Toxicity of Potential Fungal Defense Proteins towards the Fungivorous Nematodes Aphelenchus avenae and Bursaphelenchus okinawaensis. Appl. Environ. Microbiol. 2018, 84, e02051-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Alborés, S.; Mora, P.; Bustamante, M.J.; Cerdeiras, M.P.; Franco Fraguas, L. Purification and applications of a lectin from the mushroom Gymnopilus spectabilis. Appl. Biochem. Biotechnol. 2014, 172, 2081–2090. [Google Scholar] [CrossRef] [Scilit]
  54. Liu, J.J.; Li, H.P.; Luo, X.; Ma, L.; Li, C.X.; Qu, S.X. A lectin gene is involved in the defense of Pleurotus ostreatus against the mite predator Tyrophagus putrescentiae. Front. Microbiol. 2023, 14, 1191500. [Google Scholar] [CrossRef] [Scilit]
  55. Shen, C.Y.; Li, Y.T.; Liu, X.M.; Wang, Y.H.; Feng, Z.G.; Shi, Y. Effect of Selenium on Extracellular Enzyme Activities of Pleurotus ostreatus. J. Anhui Agric. Sci. 2023, 51, 42–44+56. [Google Scholar]
  56. Yu, X.; Li, B.; Fu, Y.; Jiang, D.H.; Ghabrial, S.A.; Li, G.Q.; Peng, Y.L.; Xie, J.T.; Cheng, J.S.; Huang, J.B.; et al. A geminivirus-related DNA mycovirus that confers hypovirulence to a plant pathogenic fungus. Proc. Natl. Acad. Sci. USA 2010, 107, 8387–8392. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Yu, X.; Li, B.; Fu, Y.; Xie, J.T.; Cheng, J.S.; Ghabrial, S.A.; Li, G.Q.; Yi, X.H.; Jiang, D.H. Extracellular transmission of a DNA mycovirus and its use as a natural fungicide. Proc. Natl. Acad. Sci. USA 2013, 110, 1452–1457. [Google Scholar] [CrossRef] [Scilit]
  58. Lombard, V.; Golaconda Ramulu, H.; Drula, E.; Coutinho, P.M.; Henrissat, B. The carbohydrate-active enzymes database (CAZy) in 2013. Nucleic Acids Res. 2014, 42, D490–D495. [Google Scholar] [CrossRef] [Scilit]
  59. Levasseur, A.; Drula, E.; Lombard, V.; Coutinho, P.M.; Henrissat, B. Expansion of the enzymatic repertoire of the CAZy database to integrate auxiliary redox enzymes. Biotechnol. Biofuels 2013, 6, 41. [Google Scholar] [CrossRef] [Scilit]
  60. Ali, M.; Li, Q.H.; Zou, T.; Wei, A.M.; Gombojab, G.; Lu, G.; Gong, Z.H. Chitinase Gene Positively Regulates Hypersensitive and Defense Responses of Pepper to Colletotrichum acutatum Infection. Int. J. Mol. Sci. 2020, 21, 6624. [Google Scholar] [CrossRef] [Scilit]
  61. Chen, J.Y.; Sang, H.; Chilvers, M.I.; Wu, C.H.; Chang, H.X. Characterization of soybean chitinase genes induced by rhizobacteria involved in the defense against Fusarium oxysporum. Front. Plant Sci. 2024, 15, 1341181. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  62. Shah, U.A.; Kotta-Loizou, I.; Fitt, B.D.L.; Coutts, R.H.A. Mycovirus-Induced Hypervirulence of Leptosphaeria biglobosa Enhances Systemic Acquired Resistance to Leptosphaeria maculans in Brassica napus. Mol. Plant-Microbe Interact. MPMI 2020, 33, 98–107. [Google Scholar] [CrossRef] [Scilit]
  63. Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; van Baren, M.J.; Salzberg, S.L.; Wold, B.J.; Pachter, L. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 2010, 28, 511–515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Manavalan, A.; Manavalan, T.; Murugesan, K.; Kutzner, A.; Thangavelu, K.P.; Heese, K. Characterization of a solvent, surfactant and temperature-tolerant laccase from Pleurotus sp. MAK-II and its dye decolorizing property. Biotechnol. Lett. 2015, 37, 2403–2409. [Google Scholar] [CrossRef] [Scilit]
  66. König, J.; Grasser, R.; Pikor, H.; Vogel, K. Determination of xylanase, beta-glucanase, and cellulase activity. Anal. Bioanal. Chem. 2002, 374, 80–87. [Google Scholar]
  67. Yin, D.; Deng, X.; Chet, I.; Song, R. Physiological responses of Pinus sylvestris var. mongolica seedlings to the interaction between Suillus luteus and Trichoderma Virens. Curr. Microbiol. 2014, 69, 334–342. [Google Scholar]
  68. Zaferanloo, B.; Bhattacharjee, S.; Ghorbani, M.M.; Mahon, P.J.; Palombo, E.A. Amylase production by Preussia minima, a fungus of endophytic origin: Optimization of fermentation conditions and analysis of fungal secretome by LC-MS. BMC Microbiol. 2014, 14, 55. [Google Scholar] [CrossRef] [Scilit]
Figure 1. The mycelium growth of OMSV-free (Mock) and OMSV−infected (OMSV) P. ostreatus strains. (a) The mycelium growth on PDA plates after seven days of cultivation. (b) RT-PCR detection of OMSV. Lane M, DNA Marker2000. Numbers 1–3 represent three biological replicates.
Figure 1. The mycelium growth of OMSV-free (Mock) and OMSV−infected (OMSV) P. ostreatus strains. (a) The mycelium growth on PDA plates after seven days of cultivation. (b) RT-PCR detection of OMSV. Lane M, DNA Marker2000. Numbers 1–3 represent three biological replicates.
Ijms 25 09749 g001
Figure 2. Gene expression analysis of OMSV-free (Mock) and OMSV-infected (OMSV) strains of P. ostreatus. (a) Principal component analysis (PCA) of each sample. The FPKM values of each sample were used to perform PCA. (b) The FPKM box plots of each sample. The horizontal axis represents the sample names, while the vertical axis displays the log10 (FPKM) values. Different colors denote distinct samples.
Figure 2. Gene expression analysis of OMSV-free (Mock) and OMSV-infected (OMSV) strains of P. ostreatus. (a) Principal component analysis (PCA) of each sample. The FPKM values of each sample were used to perform PCA. (b) The FPKM box plots of each sample. The horizontal axis represents the sample names, while the vertical axis displays the log10 (FPKM) values. Different colors denote distinct samples.
Ijms 25 09749 g002
Figure 3. Differential gene analysis of OMSV-free (Mock) and OMSV-infected (OMSV) P. ostreatus strains. (a) Volcano plot of all identified genes. Genes with upregulated expression are indicated by red dots, those with downregulated expression by blue dots, and genes not differentially expressed by gray dots. (b) The statistical map of DEGs. The horizontal axis indicates the comparison names, and the vertical axis indicates the number of DEGs. (c) Heatmap displaying the clustering analysis of all DEGs for the OMSV-free and OMSV-infected strains of P. ostreatus. The expression levels of DEGs were normalized using the log10 FPKM method. Each row represents a single gene, and each column corresponds to a sample group. The color gradient from blue to red indicates that the FPKM value ranges from low to high.
Figure 3. Differential gene analysis of OMSV-free (Mock) and OMSV-infected (OMSV) P. ostreatus strains. (a) Volcano plot of all identified genes. Genes with upregulated expression are indicated by red dots, those with downregulated expression by blue dots, and genes not differentially expressed by gray dots. (b) The statistical map of DEGs. The horizontal axis indicates the comparison names, and the vertical axis indicates the number of DEGs. (c) Heatmap displaying the clustering analysis of all DEGs for the OMSV-free and OMSV-infected strains of P. ostreatus. The expression levels of DEGs were normalized using the log10 FPKM method. Each row represents a single gene, and each column corresponds to a sample group. The color gradient from blue to red indicates that the FPKM value ranges from low to high.
Ijms 25 09749 g003
Figure 4. KOG analysis of the DEGs of OMSV-free and OMSV-infected P. ostreatus strains. The vertical axis indicates the number of DEGs within a specific functional cluster, while the horizontal axis represents the functional classes.
Figure 4. KOG analysis of the DEGs of OMSV-free and OMSV-infected P. ostreatus strains. The vertical axis indicates the number of DEGs within a specific functional cluster, while the horizontal axis represents the functional classes.
Ijms 25 09749 g004
Figure 5. GO and KEGG function classification of DEGs of OMSV-free and OMSV-infected P. ostreatus strains. (a) GO pathway-annotated genes. The vertical axis represented the name of the enriched GO term, while the horizontal axis indicated the number of DEGs within the corresponding term. Different colors represent three different categories. (b) KEGG pathway-annotated genes. Different colors represent four different categories. (c) Statistics of KEGG enrichment.
Figure 5. GO and KEGG function classification of DEGs of OMSV-free and OMSV-infected P. ostreatus strains. (a) GO pathway-annotated genes. The vertical axis represented the name of the enriched GO term, while the horizontal axis indicated the number of DEGs within the corresponding term. Different colors represent three different categories. (b) KEGG pathway-annotated genes. Different colors represent four different categories. (c) Statistics of KEGG enrichment.
Ijms 25 09749 g005aIjms 25 09749 g005b
Figure 6. Validation of selected DEGs of OMSV-free (Mock) and OMSV−infected (OMSV) strains of P. ostreatus using qRT-PCR. The statistical analysis included a one-way analysis of variance (ANOVA) and t-tests, * p < 0.05, ** p < 0.01, and *** p < 0.001.
Figure 6. Validation of selected DEGs of OMSV-free (Mock) and OMSV−infected (OMSV) strains of P. ostreatus using qRT-PCR. The statistical analysis included a one-way analysis of variance (ANOVA) and t-tests, * p < 0.05, ** p < 0.01, and *** p < 0.001.
Ijms 25 09749 g006
Figure 7. The enzyme activity of OMSV-free (Mock) and OMSV−infected (OMSV) P. ostreatus strains during mycelial growth. (a) Laccase activity; (b) amylase activity; (c) CMCase activity; (d) chitinase activity. Numbers 5–8 denote the days of mycelial growth in liquid medium. The statistical analysis included a one-way analysis of variance (ANOVA) and t-tests, * p < 0.05, ** p < 0.01, and *** p < 0.001.
Figure 7. The enzyme activity of OMSV-free (Mock) and OMSV−infected (OMSV) P. ostreatus strains during mycelial growth. (a) Laccase activity; (b) amylase activity; (c) CMCase activity; (d) chitinase activity. Numbers 5–8 denote the days of mycelial growth in liquid medium. The statistical analysis included a one-way analysis of variance (ANOVA) and t-tests, * p < 0.05, ** p < 0.01, and *** p < 0.001.
Ijms 25 09749 g007
Table 1. Reads in the reference genome alignment results.
Table 1. Reads in the reference genome alignment results.
SamplesClean ReadsClean BasesGC Content% ≥ Q30
Mock-120,965,2866,276,707,34253.67%92.68%
Mock-223,424,5777,016,262,21053.80%94.51%
Mock-322,083,0236,613,712,74253.68%92.63%
OMSV-124,515,6597,343,439,53054.18%94.47%
OMSV-224,050,0377,202,732,60454.08%94.54%
OMSV-322,548,2936,753,639,98654.24%94.88%
Table 2. The number of DEGs in the top 10 KEGG pathways.
Table 2. The number of DEGs in the top 10 KEGG pathways.
PathwayDEGs with Pathway
Annotation
Pathway IDp-Value
Glyoxylate and dicarboxylate metabolism6 (6.12%)ko006300.000953
Glycine, serine, and threonine metabolism9 (9.18%)ko002600.000997
Fatty acid biosynthesis5 (5.10%)ko000610.003113
Penicillin and cephalosporin biosynthesis2 (2.04%)ko003110.005509
D-Arginine and D-ornithine metabolism2 (2.04%)ko004720.005509
Propanoate metabolism5 (5.10%)ko006400.008949
One carbon pool by folate3 (3.06%)ko006700.010096
Phenylalanine, tyrosine, and tryptophan biosynthesis3 (3.06%)ko004000.014425
Non-homologous end-joining3 (3.06%)ko034500.014425
Cutin, suberine, and wax biosynthesis2 (2.04%)ko000730.018137
Table 3. The 15 DEGs verified by qRT-PCR.
Table 3. The 15 DEGs verified by qRT-PCR.
GenesAnnotationlog2FoldChange2−ΔΔCt
g1073569Methylenetetrahydrofolate dehydrogenase −1.920.97
g1052256S-adenosylmethionine synthetase−1.480.34
g1047319Polyketide synthase−3.640.80
g1073665Aryl-alcohol dehydrogenase−1.930.05
g1088328Enoyl-(Acyl carrier protein) reductase1.702.16
g1113424Cytochrome P450−2.140.18
g1074848Chitinase1.751.32
g1077485Nicotinate-nucleotide pyrophosphorylase−0.700.85
g10886641,3-beta-glucosidase0.661.26
g1103527Beta-glucan synthesis-associated protein−0.820.64
g1036297Polysaccharide lyase family 8 protein1.032.29
g51725Laccase−0.600.77
g1067151Chitin synthase−2.410.09
g1044280Lipase1.961.06
g104609350S ribosome-binding GTPase3.505.81
Table 4. Candidate gene primer sequences.
Table 4. Candidate gene primer sequences.
Gene IDForward Primer (5′→3′)Reverse Primer (5′→3′)Size (bp)
g1073569GAAGTCGGAGGCCGTATCAGCATACGTCGAGGAATCGGGG103
g1052256TGGTCACCACTGTCGTCTTGCGATGCGTGTAGAAGGTGGT114
g1047319TGACCGCTCGCAGACAAATCTTCTCGATAAGCTCAGCCTTGG74
g1088328TTGTTACCGGCCAGGTGATGAAACATCGAGTTTGCATCGCT76
g1044280TTTCTGGGTTTCCACCACCCTCTTGGCCTGGACAGGAAAC80
g1073665ACAGTTCATCGGTGAGTGGGGCCGTGTACTTGGTCGAGATA72
g1067151GGGAGCTGCTTTGGATGAGTACTGTGAGGCACAGCGATAG86
g1113424AGTGGCAGGTTCTTGGTCTGCAAAGGTAAGGCGAACGACG115
g1046093TGGATCTTCCTGAAACCGCCTAGCACGAGGGAAGAGTTAAGTG145
g1074848TTCGGGCACATCTTATTGGGGATCGATGGAATCGTCCTGGC106
g1077485ATGTTCGTCGTGGCACTTCTCAGCGATATGAGAGTGGCGT100
g1088664CCCATCGTCTCAGCCTTCAAACTCTACTCACGGTCTGCGA91
g1103527ACCTCGGTTTCTCTCCCAGGGCTCTGCCGAGATTACCCAT80
g1036297TGGTACACCGTGGACGCAATCATTCTGTGTTGACGGTGCG70
g51725GGATGGATACAGTCGCCAGGCAATCTGAAGGTGTCGCCCT88
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, Y.; Yan, J.; Song, G.; Song, Z.; Shi, M.; Hu, H.; You, L.; Zhang, L.; Wang, J.; Liu, Y.; et al. Transcriptome Analysis Reveals the Effect of Oyster Mushroom Spherical Virus Infection in Pleurotus ostreatus. Int. J. Mol. Sci. 2024, 25, 9749. https://doi.org/10.3390/ijms25179749

AMA Style

Wang Y, Yan J, Song G, Song Z, Shi M, Hu H, You L, Zhang L, Wang J, Liu Y, et al. Transcriptome Analysis Reveals the Effect of Oyster Mushroom Spherical Virus Infection in Pleurotus ostreatus. International Journal of Molecular Sciences. 2024; 25(17):9749. https://doi.org/10.3390/ijms25179749

Chicago/Turabian Style

Wang, Yifan, Junjie Yan, Guoyue Song, Zhizhong Song, Matthew Shi, Haijing Hu, Lunhe You, Lu Zhang, Jianrui Wang, Yu Liu, and et al. 2024. "Transcriptome Analysis Reveals the Effect of Oyster Mushroom Spherical Virus Infection in Pleurotus ostreatus" International Journal of Molecular Sciences 25, no. 17: 9749. https://doi.org/10.3390/ijms25179749

APA Style

Wang, Y., Yan, J., Song, G., Song, Z., Shi, M., Hu, H., You, L., Zhang, L., Wang, J., Liu, Y., Cheng, X., & Zhang, X. (2024). Transcriptome Analysis Reveals the Effect of Oyster Mushroom Spherical Virus Infection in Pleurotus ostreatus. International Journal of Molecular Sciences, 25(17), 9749. https://doi.org/10.3390/ijms25179749

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop