DGAT1 and DGAT2 Inhibitors for Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD) Management: Benefits for Their Single or Combined Application
Abstract
1. Introduction
2. Results
2.1. Determining Concentrations and Efficacy of iDGAT1 and iDGAT2
2.2. iDGAT1/2 Treatment Reduces TG Synthesis and DNL in HepG2 Cells Incubated with SLD-Medium
2.2.1. iDGAT1/2 Administration Attenuates Inflammation and Oxidative Stress in HepG2 Cells under SLD-Medium
2.2.2. Functional Role of iDGAT1 and iDGAT2 in Mitochondrial Activity Restoration in HepG2 under SLD-Medium
2.3. iDGAT1/2 Treatment Reduces TG Synthesis and DNL in HepG2 Cells Incubated with MASH Medium
2.3.1. Impact of iDGAT1 and iDGAT2 on Inflammatory Response in HepG2 Cells Treated with MASH-Medium
2.3.2. iDGAT1/2 Treatment Restores Mitochondrial Activity in HepG2 Cells Incubated with MASH Medium
2.4. iDGAT1/2 Supplementation Mitigates Fibrotic Pathways and LX2 Cell Activation under SLD and MASH Media
2.5. Efficacy of MitoQ as Supplementary Treatment in Clearing FFA Outflow
3. Discussion
4. Materials and Methods
4.1. Cell Models and Treatments
4.2. Oil Red O (ORO) Staining
4.3. Gene Expression Analysis
4.4. Western Blot Analysis
4.5. Immunocytochemistry (ICC)
4.6. ELISA Assays in Live Cells
4.7. ELISA Assays in Cell Lysates
- -
- Triglyceride Quantification Assay (MAK266, Sigma Aldrich, St. Louis, MO, USA)
- -
- Lipid Peroxidation (MDA) Colorimetric Assay (ab118970, Abcam, Cambridge, UK)
- -
- Citrate Synthase Activity Assay (MAK193, Sigma Aldrich, St. Louis, MO, USA)
- -
- Mitochondrial Complex I Activity Colorimetric Assay (ab287847, Abcam, Cambridge, UK)
- -
- Mitochondrial Complex III Activity Assay (ab287844, Abcam, Cambridge, UK)
- -
- ATP Synthase Enzyme Activity Assay Kit (ab109714, Abcam, Cambridge, UK)
- -
- Il1β/IL-F2 ELISA assays (DLB50, Biotechne R&D Systems, Minneapolis, MN, USA)
- -
- IL6 ELISA assays (DLB50, Biotechne R&D Systems, Minneapolis, USA)
- -
- TNF-α ELISA assays (DLB50, Biotechne R&D Systems, Minneapolis, USA)
- -
- MCP1 ELISA assays (DLB50, Biotechne R&D Systems, Minneapolis, USA)
4.8. Cell Viability and Proliferation Assay
4.9. Invasion Assay
4.10. Scratch Assay
4.11. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Powell, E.E.; Wong, V.W.; Rinella, M. Non-alcoholic fatty liver disease. Lancet 2021, 397, 2212–2224. [Google Scholar] [CrossRef] [Scilit]
- Meroni, M.; Longo, M.; Tria, G.; Dongiovanni, P. Genetics Is of the Essence to Face NAFLD. Biomedicines 2021, 9, 1359. [Google Scholar] [CrossRef] [Scilit]
- Shah, P.A.; Patil, R.; Harrison, S.A. NAFLD-related hepatocellular carcinoma: The growing challenge. Hepatology 2023, 77, 323–338. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dongiovanni, P.; Meroni, M.; Longo, M.; Fargion, S.; Fracanzani, A.L. Genetics, Immunity and Nutrition Boost the Switching from NASH to HCC. Biomedicines 2021, 9, 1524. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dongiovanni, P.; Romeo, S.; Valenti, L. Hepatocellular carcinoma in nonalcoholic fatty liver: Role of environmental and genetic factors. World J. Gastroenterol. 2014, 20, 12945–12955. [Google Scholar] [CrossRef] [Scilit]
- Younossi, Z.M.; Koenig, A.B.; Abdelatif, D.; Fazel, Y.; Henry, L.; Wymer, M. Global epidemiology of nonalcoholic fatty liver disease-Meta-analytic assessment of prevalence, incidence, and outcomes. Hepatology 2016, 64, 73–84. [Google Scholar] [CrossRef] [Scilit]
- Dongiovanni, P.; Valenti, L. Genetics of nonalcoholic fatty liver disease. Metabolism 2016, 65, 1026–1037. [Google Scholar] [CrossRef] [Scilit]
- Harrison, S.A.; Bedossa, P.; Guy, C.D.; Schattenberg, J.M.; Loomba, R.; Taub, R.; Labriola, D.; Moussa, S.E.; Neff, G.W.; Rinella, M.E.; et al. A Phase 3, Randomized, Controlled Trial of Resmetirom in NASH with Liver Fibrosis. N. Engl. J. Med. 2024, 390, 497–509. [Google Scholar] [CrossRef] [Scilit]
- Harrison, S.A.; Taub, R.; Neff, G.W.; Lucas, K.J.; Labriola, D.; Moussa, S.E.; Alkhouri, N.; Bashir, M.R. Resmetirom for nonalcoholic fatty liver disease: A randomized, double-blind, placebo-controlled phase 3 trial. Nat. Med. 2023, 29, 2919–2928. [Google Scholar] [CrossRef] [Scilit]
- Karim, G.; Bansal, M.B. Resmetirom: An Orally Administered, Smallmolecule, Liver-directed, β-selective THR Agonist for the Treatment of Non-alcoholic Fatty Liver Disease and Non-alcoholic Steatohepatitis. touchREV Endocrinol. 2023, 19, 60–70. [Google Scholar] [CrossRef] [Scilit]
- Cusi, K. Selective Agonists of Thyroid Hormone Receptor Beta for the Treatment of NASH. N. Engl. J. Med. 2024, 390, 559–561. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharma, A.K.; Wolfrum, C. DGAT inhibition at the post-absorptive phase reduces plasma FA by increasing FA oxidation. EMBO Mol. Med. 2023, 15, e18209. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chitraju, C.; Walther, T.C.; Farese, R.V., Jr. The triglyceride synthesis enzymes DGAT1 and DGAT2 have distinct and overlapping functions in adipocytes. J. Lipid Res. 2019, 60, 1112–1120. [Google Scholar] [CrossRef] [Scilit]
- Ables, G.P.; Yang, K.J.; Vogel, S.; Hernandez-Ono, A.; Yu, S.; Yuen, J.J.; Birtles, S.; Buckett, L.K.; Turnbull, A.V.; Goldberg, I.J.; et al. Intestinal DGAT1 deficiency reduces postprandial triglyceride and retinyl ester excursions by inhibiting chylomicron secretion and delaying gastric emptying. J. Lipid Res. 2012, 53, 2364–2379. [Google Scholar] [CrossRef] [Scilit]
- Chitraju, C.; Mejhert, N.; Haas, J.T.; Diaz-Ramirez, L.G.; Grueter, C.A.; Imbriglio, J.E.; Pinto, S.; Koliwad, S.K.; Walther, T.C.; Farese, R.V., Jr. Triglyceride Synthesis by DGAT1 Protects Adipocytes from Lipid-Induced ER Stress during Lipolysis. Cell Metab. 2017, 26, 407–418.e403. [Google Scholar] [CrossRef] [Scilit]
- Yen, C.L.; Stone, S.J.; Koliwad, S.; Harris, C.; Farese, R.V., Jr. Thematic review series: Glycerolipids. DGAT enzymes and triacylglycerol biosynthesis. J. Lipid Res. 2008, 49, 2283–2301. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yen, C.L.; Monetti, M.; Burri, B.J.; Farese, R.V., Jr. The triacylglycerol synthesis enzyme DGAT1 also catalyzes the synthesis of diacylglycerols, waxes, and retinyl esters. J. Lipid Res. 2005, 46, 1502–1511. [Google Scholar] [CrossRef] [Scilit]
- Rong, S.; Xia, M.; Vale, G.; Wang, S.; Kim, C.W.; Li, S.; McDonald, J.G.; Radhakrishnan, A.; Horton, J.D. DGAT2 inhibition blocks SREBP-1 cleavage and improves hepatic steatosis by increasing phosphatidylethanolamine in the ER. Cell Metab. 2024, 36, 617–629.e617. [Google Scholar] [CrossRef] [Scilit]
- Gluchowski, N.L.; Gabriel, K.R.; Chitraju, C.; Bronson, R.T.; Mejhert, N.; Boland, S.; Wang, K.; Lai, Z.W.; Farese, R.V., Jr.; Walther, T.C. Hepatocyte Deletion of Triglyceride-Synthesis Enzyme Acyl CoA: Diacylglycerol Acyltransferase 2 Reduces Steatosis Without Increasing Inflammation or Fibrosis in Mice. Hepatology 2019, 70, 1972–1985. [Google Scholar] [CrossRef] [Scilit]
- Amin, N.B.; Saxena, A.R.; Somayaji, V.; Dullea, R. Inhibition of Diacylglycerol Acyltransferase 2 Versus Diacylglycerol Acyltransferase 1: Potential Therapeutic Implications of Pharmacology. Clin. Ther. 2023, 45, 55–70. [Google Scholar] [CrossRef] [Scilit]
- Villanueva, C.J.; Monetti, M.; Shih, M.; Zhou, P.; Watkins, S.M.; Bhanot, S.; Farese, R.V., Jr. Specific role for acyl CoA:Diacylglycerol acyltransferase 1 (Dgat1) in hepatic steatosis due to exogenous fatty acids. Hepatology 2009, 50, 434–442. [Google Scholar] [CrossRef] [Scilit]
- Yu, X.X.; Murray, S.F.; Pandey, S.K.; Booten, S.L.; Bao, D.; Song, X.Z.; Kelly, S.; Chen, S.; McKay, R.; Monia, B.P.; et al. Antisense oligonucleotide reduction of DGAT2 expression improves hepatic steatosis and hyperlipidemia in obese mice. Hepatology 2005, 42, 362–371. [Google Scholar] [CrossRef] [Scilit]
- Yamaguchi, K.; Yang, L.; McCall, S.; Huang, J.; Yu, X.X.; Pandey, S.K.; Bhanot, S.; Monia, B.P.; Li, Y.X.; Diehl, A.M. Inhibiting triglyceride synthesis improves hepatic steatosis but exacerbates liver damage and fibrosis in obese mice with nonalcoholic steatohepatitis. Hepatology 2007, 45, 1366–1374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Denison, H.; Nilsson, C.; Löfgren, L.; Himmelmann, A.; Mårtensson, G.; Knutsson, M.; Al-Shurbaji, A.; Tornqvist, H.; Eriksson, J.W. Diacylglycerol acyltransferase 1 inhibition with AZD7687 alters lipid handling and hormone secretion in the gut with intolerable side effects: A randomized clinical trial. Diabetes Obes. Metab. 2014, 16, 334–343. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meyers, C.D.; Amer, A.; Majumdar, T.; Chen, J. Pharmacokinetics, pharmacodynamics, safety, and tolerability of pradigastat, a novel diacylglycerol acyltransferase 1 inhibitor in overweight or obese, but otherwise healthy human subjects. J. Clin. Pharmacol. 2015, 55, 1031–1041. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saxena, A.; Chidsey, K.; Somayaji, V.; Ogden, A.; Duvvuri, S. Diacylglycerol acyltransferase 2 (DGAT2) inhibitor PF-06865571 reduces liver fat by MRI-PDFF after 2 weeks in adults with NAFLD. In Hepatology; Wiley: Hoboken, NJ, USA, 2019; p. 1260A. [Google Scholar]
- Ciardullo, S.; Muraca, E.; Vergani, M.; Invernizzi, P.; Perseghin, G. Advancements in pharmacological treatment of NAFLD/MASLD: A focus on metabolic and liver-targeted interventions. Gastroenterol. Rep. 2024, 12, goae029. [Google Scholar] [CrossRef] [Scilit]
- Calle, R.A.; Amin, N.B.; Carvajal-Gonzalez, S.; Ross, T.T.; Bergman, A.; Aggarwal, S.; Crowley, C.; Rinaldi, A.; Mancuso, J.; Aggarwal, N.; et al. ACC inhibitor alone or co-administered with a DGAT2 inhibitor in patients with non-alcoholic fatty liver disease: Two parallel, placebo-controlled, randomized phase 2a trials. Nat. Med. 2021, 27, 1836–1848. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yenilmez, B.; Wetoska, N.; Kelly, M.; Echeverria, D.; Min, K.; Lifshitz, L.; Alterman, J.F.; Hassler, M.R.; Hildebrand, S.; DiMarzio, C.; et al. An RNAi therapeutic targeting hepatic DGAT2 in a genetically obese mouse model of nonalcoholic steatohepatitis. Mol. Ther. 2022, 30, 1329–1342. [Google Scholar] [CrossRef] [Scilit]
- Lavine, J.E.; Schwimmer, J.B.; Van Natta, M.L.; Molleston, J.P.; Murray, K.F.; Rosenthal, P.; Abrams, S.H.; Scheimann, A.O.; Sanyal, A.J.; Chalasani, N.; et al. Effect of vitamin E or metformin for treatment of nonalcoholic fatty liver disease in children and adolescents: The TONIC randomized controlled trial. JAMA 2011, 305, 1659–1668. [Google Scholar] [CrossRef] [Scilit]
- Mercer, J.R.; Yu, E.; Figg, N.; Cheng, K.K.; Prime, T.A.; Griffin, J.L.; Masoodi, M.; Vidal-Puig, A.; Murphy, M.P.; Bennett, M.R. The mitochondria-targeted antioxidant MitoQ decreases features of the metabolic syndrome in ATM+/−/ApoE−/− mice. Free Radic. Biol. Med. 2012, 52, 841–849. [Google Scholar] [CrossRef] [Scilit]
- Hu, K.; Xiao, L.; Li, L.; Shen, Y.; Yang, Y.; Huang, J.; Wang, Y.; Zhang, L.; Wen, S.; Tang, L. The mitochondria-targeting antioxidant MitoQ alleviated lipopolysaccharide/D-galactosamine-induced acute liver injury in mice. Immunol. Lett. 2021, 240, 24–30. [Google Scholar] [CrossRef] [Scilit]






| Gene | Primer forward 5′ → 3′ | Primer Reverse 3′ → 5′ |
|---|---|---|
| ATF4 | AAACCTCATGGGTTCTCCAG | GGCATGGTTTCCAGGTCACT |
| Col1A1 | CCATCAAAGTCTTCTGCAACATG | CGCCATACTCGAACTGGAATC |
| DGAT1 | GCTTCAGCAACTACCGTGGCAT | CCTTCAGGAACAGAGAAACCACC |
| DGAT2 | TCCAGCTGGTGAAGACACAC | GCTGACAGGGCAGATACCTC |
| MMP4 | CCTTGGACTGTCAGGAATGAGG | TTCTCCGTGTCCATCCACTGGT |
| MMP9 | GCCACTACTGTGCCTTTGAGTC | CCCTCAGAGAATCGCCAGTACT |
| MnSOD2 | CAAATTGCTGCTTGTCCAAA | TCTTGCTGGGATCATTAGGG |
| SREBP1 | TGCATTTTCTGACACGCTTC | CCAAGCTGTACAGGCTCTCC |
| SREBP2 | CTCCATTGACTCTGAGCCAGGA | GAATCCGTGAGCGGTCTACCAT |
| TIMP1 | TTTTGTGGCTCCCTGGAACA | AAACAGGGAAACACTGTGCAT |
| TIMP2 | ACCCTCTGTGACTTCATCGTGC | GGAGATGTAGCACGGGATCATG |
| XBP1 | GAAGCCAAGGGGAATGAAGT | GCCCAACAGGATATCAGACTC |
| β-actina | GCTACAGCTTCACCACCACA | AAGGAAGGCTGGAAAAGAGC |
| Primary Antibody | Cat. Number * | Secondary Antibody | Cat. Number |
|---|---|---|---|
| DGAT1 (1:500) | Sigma-Aldrich SAB4301075 | Anti-IgG Rabbit (1:5000) | Cell signaling #7076 |
| DGAT2 (1:1000) | Sigma-ldrich SAB2106887 | Anti-IgG Rabbit (1:5000) | Cell signaling #7076 |
| α-SMA (1:150) | Cell Signaling #77397 | Anti-IgG Rabbit (1:500) | Cell signaling #7076 |
| Vinculin (1:1000) | Abcam ab73412 | Anti-IgG Rabbit (1:5000) | Cell signaling #7076 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Longo, M.; Paolini, E.; Di Benedetto, P.; Tomassini, E.; Meroni, M.; Dongiovanni, P. DGAT1 and DGAT2 Inhibitors for Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD) Management: Benefits for Their Single or Combined Application. Int. J. Mol. Sci. 2024, 25, 9074. https://doi.org/10.3390/ijms25169074
Longo M, Paolini E, Di Benedetto P, Tomassini E, Meroni M, Dongiovanni P. DGAT1 and DGAT2 Inhibitors for Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD) Management: Benefits for Their Single or Combined Application. International Journal of Molecular Sciences. 2024; 25(16):9074. https://doi.org/10.3390/ijms25169074
Chicago/Turabian StyleLongo, Miriam, Erika Paolini, Pietro Di Benedetto, Elena Tomassini, Marica Meroni, and Paola Dongiovanni. 2024. "DGAT1 and DGAT2 Inhibitors for Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD) Management: Benefits for Their Single or Combined Application" International Journal of Molecular Sciences 25, no. 16: 9074. https://doi.org/10.3390/ijms25169074
APA StyleLongo, M., Paolini, E., Di Benedetto, P., Tomassini, E., Meroni, M., & Dongiovanni, P. (2024). DGAT1 and DGAT2 Inhibitors for Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD) Management: Benefits for Their Single or Combined Application. International Journal of Molecular Sciences, 25(16), 9074. https://doi.org/10.3390/ijms25169074

