Understanding Secondary Sarcopenia Development in Young Adults Using Pig Model with Chronic Pancreatitis
Abstract
1. Introduction
2. Results
2.1. Muscle Fibers
2.2. Sarcopenic Indicators
2.3. Expression of Genes of Antioxidant Proteins and Signal Proteins of Programmed Cell Death
3. Discussion
4. Materials and Methods
4.1. Animals and Treatment Groups
4.2. Serum Parameters
4.3. Muscle Sample Collection
4.4. Muscle Histochemical and Immunohistochemical Analyses
4.5. RNA Isolation and mRNA Quantification
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Fielding, R.A.; Vellas, B.; Evans, W.J.; Bhasin, S.; Morley, J.E.; Newman, A.B.; Abellan van Kan, G.; Andrieu, S.; Bauer, J.; Breuille, D.; et al. Sarcopenia: An Undiagnosed Condition in Older Adults. Current Consensus Definition: Prevalence, Etiology, and Consequences. International Working Group on Sarcopenia. J. Am. Med. Dir. Assoc. 2011, 12, 249–256. [Google Scholar] [CrossRef]
- Morley, J.E.; Abbatecola, A.M.; Argiles, J.M.; Baracos, V.; Bauer, J.; Bhasin, S.; Cederholm, T.; Stewart Coats, A.J.; Cummings, S.R.; Evans, W.J.; et al. Sarcopenia with Limited Mobility: An International Consensus. J. Am. Med. Dir. Assoc. 2011, 12, 403–409. [Google Scholar] [CrossRef] [PubMed]
- Tagliafico, A.S.; Bignotti, B.; Torri, L.; Rossi, F. Sarcopenia: How to Measure, When and Why. Radiol. Med. 2022, 127, 228–237. [Google Scholar] [CrossRef]
- Guttikonda, D.; Smith, A.L. Sarcopenia Assessment Techniques. Clin. Liver Dis. 2021, 18, 189–192. [Google Scholar] [CrossRef] [PubMed]
- Goodpaster, B.H.; Kelley, D.E.; Thaete, F.L.; He, J.; Ross, R. Skeletal Muscle Attenuation Determined by Computed Tomography Is Associated with Skeletal Muscle Lipid Content. J. Appl. Physiol. 2000, 89, 104–110. [Google Scholar] [CrossRef]
- De Rui, M.; Veronese, N.; Bolzetta, F.; Berton, L.; Carraro, S.; Bano, G.; Trevisan, C.; Pizzato, S.; Coin, A.; Perissinotto, E.; et al. Validation of Bioelectrical Impedance Analysis for Estimating Limb Lean Mass in Free-Living Caucasian Elderly People. Clin. Nutr. 2017, 36, 577–584. [Google Scholar] [CrossRef] [PubMed]
- Ackermans, L.L.G.C.; Rabou, J.; Basrai, M.; Schweinlin, A.; Bischoff, S.C.; Cussenot, O.; Cancel-Tassin, G.; Renken, R.J.; Gómez, E.; Sánchez-González, P.; et al. Screening, Diagnosis and Monitoring of Sarcopenia: When to Use Which Tool? Clin. Nutr. ESPEN 2022, 48, 36–44. [Google Scholar] [CrossRef]
- Bonaldo, P.; Sandri, M. Cellular and Molecular Mechanisms of Muscle Atrophy. Dis. Model. Mech. 2013, 6, 25–39. [Google Scholar] [CrossRef]
- Wohlgemuth, S.E.; Seo, A.Y.; Marzetti, E.; Lees, H.A.; Leeuwenburgh, C. Skeletal Muscle Autophagy and Apoptosis during Aging: Effects of Calorie Restriction and Life-Long Exercise. Exp. Gerontol. 2010, 45, 138–148. [Google Scholar] [CrossRef]
- Chen, X.; Ji, Y.; Liu, R.; Zhu, X.; Wang, K.; Yang, X.; Liu, B.; Gao, Z.; Huang, Y.; Shen, Y.; et al. Mitochondrial Dysfunction: Roles in Skeletal Muscle Atrophy. J. Transl. Med. 2023, 21, 503. [Google Scholar] [CrossRef]
- Wilkinson, D.J.; Piasecki, M.; Atherton, P.J. The Age-Related Loss of Skeletal Muscle Mass and Function: Measurement and Physiology of Muscle Fibre Atrophy and Muscle Fibre Loss in Humans. Ageing Res. Rev. 2018, 47, 123–132. [Google Scholar] [CrossRef]
- Han, A.; Bokshan, S.; Marcaccio, S.; DePasse, J.; Daniels, A. Diagnostic Criteria and Clinical Outcomes in Sarcopenia Research: A Literature Review. J. Clin. Med. 2018, 7, 70. [Google Scholar] [CrossRef] [PubMed]
- Cruz-Jentoft, A.J.; Bahat, G.; Bauer, J.; Boirie, Y.; Bruyère, O.; Cederholm, T.; Cooper, C.; Landi, F.; Rolland, Y.; Sayer, A.A.; et al. Sarcopenia: Revised European Consensus on Definition and Diagnosis. Age Ageing 2019, 48, 16–31. [Google Scholar] [CrossRef] [PubMed]
- Bahat, G.; Tufan, A.; Tufan, F.; Kilic, C.; Akpinar, T.S.; Kose, M.; Erten, N.; Karan, M.A.; Cruz-Jentoft, A.J. Cut-off Points to Identify Sarcopenia According to European Working Group on Sarcopenia in Older People (EWGSOP) Definition. Clin. Nutr. 2016, 35, 1557–1563. [Google Scholar] [CrossRef]
- Veronese, N.; Demurtas, J.; Soysal, P.; Smith, L.; Torbahn, G.; Schoene, D.; Schwingshackl, L.; Sieber, C.; Bauer, J.; Cesari, M.; et al. Sarcopenia and Health-Related Outcomes: An Umbrella Review of Observational Studies. Eur. Geriatr. Med. 2019, 10, 853–862. [Google Scholar] [CrossRef] [PubMed]
- Bryant, R.V.; Ooi, S.; Schultz, C.G.; Goess, C.; Grafton, R.; Hughes, J.; Lim, A.; Bartholomeusz, F.D.; Andrews, J.M. Low Muscle Mass and Sarcopenia: Common and Predictive of Osteopenia in Inflammatory Bowel Disease. Aliment. Pharmacol. Ther. 2015, 41, 895–906. [Google Scholar] [CrossRef] [PubMed]
- Levolger, S.; van Vugt, J.L.A.; de Bruin, R.W.F.; IJzermans, J.N.M. Systematic Review of Sarcopenia in Patients Operated on for Gastrointestinal and Hepatopancreatobiliary Malignancies. Br. J. Surg. 2015, 102, 1448–1458. [Google Scholar] [CrossRef] [PubMed]
- Heard, R.; Black, D.; Ramsay, G.; Scott, N.; Hildebrand, D. The Prevalence of Sarcopaenia in a Vascular Surgical Patient Cohort and Its Impact on Outcome. Surgeon 2018, 16, 325–332. [Google Scholar] [CrossRef]
- Kim, Y.K.; Yi, S.R.; Lee, Y.H.; Kwon, J.; Jang, S.I.; Park, S.H. Effect of Sarcopenia on Postoperative Mortality in Osteoporotic Hip Fracture Patients. J. Bone Metab. 2018, 25, 227. [Google Scholar] [CrossRef]
- Englesbe, M.J.; Patel, S.P.; He, K.; Lynch, R.J.; Schaubel, D.E.; Harbaugh, C.; Holcombe, S.A.; Wang, S.C.; Segev, D.L.; Sonnenday, C.J. Sarcopenia and Mortality after Liver Transplantation. J. Am. Coll. Surg. 2010, 211, 271–278. [Google Scholar] [CrossRef]
- Hajibandeh, S.; Hajibandeh, S.; Jarvis, R.; Bhogal, T.; Dalmia, S. Meta-Analysis of the Effect of Sarcopenia in Predicting Postoperative Mortality in Emergency and Elective Abdominal Surgery. Surgeon 2019, 17, 370–380. [Google Scholar] [CrossRef] [PubMed]
- Allanson, E.R.; Peng, Y.; Choi, A.; Hayes, S.; Janda, M.; Obermair, A. A Systematic Review and Meta-Analysis of Sarcopenia as a Prognostic Factor in Gynecological Malignancy. Int. J. Gynecol. Cancer 2020, 30, 1791–1797. [Google Scholar] [CrossRef] [PubMed]
- Cao, Q.; Xiong, Y.; Zhong, Z.; Ye, Q. Computed Tomography-Assessed Sarcopenia Indexes Predict Major Complications Following Surgery for Hepatopancreatobiliary Malignancy: A Meta-Analysis. Ann. Nutr. Metab. 2019, 74, 24–34. [Google Scholar] [CrossRef] [PubMed]
- Onesti, J.K.; Wright, G.P.; Kenning, S.E.; Tierney, M.T.; Davis, A.T.; Doherty, M.G.; Chung, M.H. Sarcopenia and Survival in Patients Undergoing Pancreatic Resection. Pancreatology 2016, 16, 284–289. [Google Scholar] [CrossRef] [PubMed]
- Bundred, J.; Thakkar, R.G.; Pandanaboyana, S. Systematic Review of Sarcopenia in Chronic Pancreatitis: Prevalence, Impact on Surgical Outcomes, and Survival. Expert Rev. Gastroenterol. Hepatol. 2022, 16, 665–672. [Google Scholar] [CrossRef] [PubMed]
- Brance, M.L.; Di Gregorio, S.; Pons-Estel, B.A.; Quagliato, N.J.; Jorfen, M.; Berbotto, G.; Cortese, N.; Raggio, J.C.; Palatnik, M.; Chavero, I.; et al. Prevalence of Sarcopenia and Whole-Body Composition in Rheumatoid Arthritis. JCR J. Clin. Rheumatol. 2021, 27, S153–S160. [Google Scholar] [CrossRef] [PubMed]
- Supriya, R.; Singh, K.P.; Gao, Y.; Gu, Y.; Baker, J.S. Effect of Exercise on Secondary Sarcopenia: A Comprehensive Literature Review. Biology 2021, 11, 51. [Google Scholar] [CrossRef] [PubMed]
- de Almeida, T.S.; Cortez, A.F.; da Cruz, M.R.; de Almeida, V.P. Predictors of Sarcopenia in Young Hospitalized Patients Living with HIV. Braz. J. Infect. Dis. 2021, 25, 101574. [Google Scholar] [CrossRef]
- da Silva, T.L.; dos Santos Chiappetta Salgado Nogueira, V.; Mulder, A.P. Sarcopenia and Poor Muscle Quality Associated with Severe Obesity in Young Adults and Middle-Aged Adults. Clin. Nutr. ESPEN 2021, 45, 299–305. [Google Scholar] [CrossRef]
- Seo, H.S.; Lee, H.; Kim, S.; Lee, S.K.; Lee, K.Y.; Kim, N.H.; Shin, C. Paravertebral Muscles as Indexes of Sarcopenia and Sarcopenic Obesity: Comparison with Imaging and Muscle Function Indexes and Impact on Cardiovascular and Metabolic Disorders. Am. J. Roentgenol. 2021, 216, 1596–1606. [Google Scholar] [CrossRef]
- Pan, J.; Zou, Y.-W.; Zhu, Y.-Y.; Lin, J.-Z.; Wu, T.; Yang, Z.-H.; Zhang, X.-P.; Zhang, Q.; Zheng, H.-W.; He, X.-L.; et al. Muscle Mass Loss Is Associated with Physical Dysfunction in Patients with Early Rheumatoid Arthritis. Front. Nutr. 2022, 9, 1007184. [Google Scholar] [CrossRef] [PubMed]
- Koo, B.K.; Roh, E.; Yang, Y.S.; Moon, M.K. Difference between Old and Young Adults in Contribution of Β-cell Function and Sarcopenia in Developing Diabetes Mellitus. J. Diabetes Investig. 2016, 7, 233–240. [Google Scholar] [CrossRef] [PubMed]
- Leal, A.S.; Liby, K.T. Murine Models of Pancreatitis Leading to the Development of Pancreatic Cancer. Curr. Protoc. Pharmacol. 2018, 83, e48. [Google Scholar] [CrossRef] [PubMed]
- Shintakuya, R.; Uemura, K.; Murakami, Y.; Kondo, N.; Nakagawa, N.; Urabe, K.; Okano, K.; Awai, K.; Higaki, T.; Sueda, T. Sarcopenia Is Closely Associated with Pancreatic Exocrine Insufficiency in Patients with Pancreatic Disease. Pancreatology 2017, 17, 70–75. [Google Scholar] [CrossRef] [PubMed]
- Tomaszewska, E.; Świątkiewicz, M.; Muszyński, S.; Donaldson, J.; Ropka-Molik, K.; Arciszewski, M.B.; Murawski, M.; Schwarz, T.; Dobrowolski, P.; Szymańczyk, S.; et al. Repetitive Cerulein-Induced Chronic Pancreatitis in Growing Pigs—A Pilot Study. Int. J. Mol. Sci. 2023, 24, 7715. [Google Scholar] [CrossRef] [PubMed]
- Tomaszewska, E.; Hułas-Stasiak, M.; Dobrowolski, P.; Świątkiewicz, M.; Muszyński, S.; Tomczyk-Warunek, A.; Blicharski, T.; Donaldson, J.; Arciszewski, M.B.; Świetlicki, M.; et al. Does Chronic Pancreatitis in Growing Pigs Lead to Articular Cartilage Degradation and Alterations in Subchondral Bone? Int. J. Mol. Sci. 2024, 25, 1989. [Google Scholar] [CrossRef]
- Fasullo, M.; Omer, E.; Kaspar, M. Sarcopenia in Chronic Pancreatitis–Prevalence, Diagnosis, Mechanisms and Potential Therapies. Curr. Gastroenterol. Rep. 2022, 24, 53–63. [Google Scholar] [CrossRef] [PubMed]
- Kuan, L.L.; Dennison, A.R.; Garcea, G. Prevalence and Impact of Sarcopenia in Chronic Pancreatitis: A Review of the Literature. World J. Surg. 2021, 45, 590–597. [Google Scholar] [CrossRef] [PubMed]
- Machicado, J.D.; Yadav, D. Epidemiology of Recurrent Acute and Chronic Pancreatitis: Similarities and Differences. Dig. Dis. Sci. 2017, 62, 1683–1691. [Google Scholar] [CrossRef]
- Majumder, S.; Chari, S.T. Chronic Pancreatitis. Lancet 2016, 387, 1957–1966. [Google Scholar] [CrossRef]
- Sellers, Z.M.; MacIsaac, D.; Yu, H.; Dehghan, M.; Zhang, K.-Y.; Bensen, R.; Wong, J.J.; Kin, C.; Park, K.T. Nationwide Trends in Acute and Chronic Pancreatitis Among Privately Insured Children and Non-Elderly Adults in the United States, 2007–2014. Gastroenterology 2018, 155, 469–478. [Google Scholar] [CrossRef]
- Machicado, J.D.; Dudekula, A.; Tang, G.; Xu, H.; Wu, B.U.; Forsmark, C.E.; Yadav, D. Period Prevalence of Chronic Pancreatitis Diagnosis from 2001–2013 in the Commercially Insured Population of the United States. Pancreatology 2019, 19, 813–818. [Google Scholar] [CrossRef] [PubMed]
- Jung, H.N.; Jung, C.H.; Hwang, Y.-C. Sarcopenia in Youth. Metabolism 2023, 144, 155557. [Google Scholar] [CrossRef]
- Guensch, D.P.; Yu, J.; Nadeshalingam, G.; Fischer, K.; Shearer, J.; Friedrich, M.G. Evidence for Acute Myocardial and Skeletal Muscle Injury after Serial Transthoracic Shocks in Healthy Swine. PLoS ONE 2016, 11, e0162245. [Google Scholar] [CrossRef]
- McAllister, R.M.; Reiter, B.L.; Amann, J.F.; Laughlin, M.H. Skeletal Muscle Biochemical Adaptations to Exercise Training in Miniature Swine. J. Appl. Physiol. 1997, 82, 1862–1868. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Roura, E.; Koopmans, S.-J.; Lallès, J.-P.; Le Huerou-Luron, I.; de Jager, N.; Schuurman, T.; Val-Laillet, D. Critical Review Evaluating the Pig as a Model for Human Nutritional Physiology. Nutr. Res. Rev. 2016, 29, 60–90. [Google Scholar] [CrossRef] [PubMed]
- Swindle, M.; Smith, A.C. Comparative Anatomy and Physiology of the Pig. Scand. J. Lab. Anim. Sci. 1998, 25, 11–21. [Google Scholar]
- Hegarty, P.V.J.; Allen, C.E. Effect of Pre-Natal Runting on the Post-Natal Development of Skeletal Muscles in Swine and Rats2. J. Anim. Sci. 1978, 46, 1634–1640. [Google Scholar] [CrossRef]
- Lunney, J.K.; Van Goor, A.; Walker, K.E.; Hailstock, T.; Franklin, J.; Dai, C. Importance of the Pig as a Human Biomedical Model. Sci. Transl. Med. 2021, 13, eabd5758. [Google Scholar] [CrossRef]
- Zhao, L.; Huang, Y.; Du, M. Farm Animals for Studying Muscle Development and Metabolism: Dual Purposes for Animal Production and Human Health. Anim. Front. 2019, 9, 21–27. [Google Scholar] [CrossRef]
- Li, R.; Li, B.; Jiang, A.; Cao, Y.; Hou, L.; Zhang, Z.; Zhang, X.; Liu, H.; Kim, K.-H.; Wu, W. Exploring the lncRNAs Related to Skeletal Muscle Fiber Types and Meat Quality Traits in Pigs. Genes 2020, 11, 883. [Google Scholar] [CrossRef] [PubMed]
- Zierath, J.R.; Hawley, J.A. Skeletal Muscle Fiber Type: Influence on Contractile and Metabolic Properties. PLoS Biol. 2004, 2, e348. [Google Scholar] [CrossRef]
- Fitts, R.H.; Widrick, J.J. Muscle Mechanics: Adaptations with Exercise-Training. Exerc. Sport Sci. Rev. 1996, 24, 427–473. [Google Scholar] [CrossRef] [PubMed]
- Scott, W.; Stevens, J.; Binder–Macleod, S.A. Human Skeletal Muscle Fiber Type Classifications. Phys. Ther. 2001, 81, 1810–1816. [Google Scholar] [CrossRef] [PubMed]
- Bottinelli, R.; Reggiani, C. Human Skeletal Muscle Fibres: Molecular and Functional Diversity. Prog. Biophys. Mol. Biol. 2000, 73, 195–262. [Google Scholar] [CrossRef] [PubMed]
- Elminowska-Wenda, G. Structure Traits of Longissimus Lumborum Muscle in Wild Boar/Domestic Pig Hybrids. Folia Biol. 2006, 54, 133–137. [Google Scholar] [CrossRef] [PubMed]
- Jiang, A.; Yin, D.; Zhang, L.; Li, B.; Li, R.; Zhang, X.; Zhang, Z.; Liu, H.; Kim, K.; Wu, W. Parsing the microRNA Genetics Basis Regulating Skeletal Muscle Fiber Types and Meat Quality Traits in Pigs. Anim. Genet. 2021, 52, 292–303. [Google Scholar] [CrossRef]
- Bogucka, J.; Kapelański, W. Microstructure of Longissimus Lumborum Muscle in Pigs of Several Breeds and Its Relation to Meat Quality Traits. Folia Biol. 2005, 53, 85–90. [Google Scholar] [CrossRef]
- Abboud, J.; Kuo, C.; Descarreaux, M.; Blouin, J. Regional Activation in the Human Longissimus Thoracis Pars Lumborum Muscle. J. Physiol. 2020, 598, 347–359. [Google Scholar] [CrossRef]
- Krischek, C.; Popp, J.; Sharifi, A.R. Biochemical Alterations in the Musculus Triceps Brachii and Musculus Longissimus Thoracis during Early Postmortem Period in Pigs. Meat Sci. 2019, 152, 121–126. [Google Scholar] [CrossRef]
- Landin, D.; Thompson, M.; Jackson, M. Functions of the Triceps Brachii in Humans: A Review. J. Clin. Med. Res. 2018, 10, 290–293. [Google Scholar] [CrossRef]
- Kholinne, E.; Zulkarnain, R.F.; Sun, Y.C.; Lim, S.; Chun, J.-M.; Jeon, I.-H. The Different Role of Each Head of the Triceps Brachii Muscle in Elbow Extension. Acta Orthop. Traumatol. Turc. 2018, 52, 201–205. [Google Scholar] [CrossRef]
- König, H.E.; Liebich, H.-G. Veterinary Anatomy of Domestic Mammals: Textbook and Colour Atlas, 6th ed.; Schattauer: Stuttgart, Germany, 2014; ISBN 978-3-7945-2833-2. [Google Scholar]
- Guido, A.N.; Campos, G.E.R.; Neto, H.S.; Marques, M.J.; Minatel, E. Fiber Type Composition of the Sternomastoid and Diaphragm Muscles of Dystrophin-Deficient Mdx Mice. Anat. Rec. Adv. Integr. Anat. Evol. Biol. 2010, 293, 1722–1728. [Google Scholar] [CrossRef]
- Sánchez, J.; Medrano, G.; Debesse, B.; Riquet, M.; Derenne, J.P. Muscle Fibre Types in Costal and Crural Diaphragm in Normal Men and in Patients with Moderate Chronic Respiratory Disease. Bull. Eur. Physiopathol. Respir. 1985, 21, 351–356. [Google Scholar] [PubMed]
- Sartore, S.; Gorza, L.; Pierobon Bormioli, S.; Dalla Libera, L.; Schiaffino, S. Myosin Types and Fiber Types in Cardiac Muscle. I. Ventricular Myocardium. J. Cell Biol. 1981, 88, 226–233. [Google Scholar] [CrossRef]
- Rehfeldt, C.; Henning, M.; Fiedler, I. Consequences of Pig Domestication for Skeletal Muscle Growth and Cellularity. Livest. Sci. 2008, 116, 30–41. [Google Scholar] [CrossRef]
- Husom, A.; Ferrington, D.; Thompson, L. Age-Related Differences in the Adaptive Potential of Type I Skeletal Muscle Fibers. Exp. Gerontol. 2005, 40, 227–235. [Google Scholar] [CrossRef]
- Tarantino, U.; Scimeca, M.; Piccirilli, E.; Tancredi, V.; Baldi, J.; Gasbarra, E.; Bonanno, E. Sarcopenia: A Histological and Immunohistochemical Study on Age-Related Muscle Impairment. Aging Clin. Exp. Res. 2015, 27, 51–60. [Google Scholar] [CrossRef] [PubMed]
- Scimeca, M.; Piccirilli, E.; Mastrangeli, F.; Rao, C.; Feola, M.; Orlandi, A.; Gasbarra, E.; Bonanno, E.; Tarantino, U. Bone Morphogenetic Proteins and Myostatin Pathways: Key Mediator of Human Sarcopenia. J. Transl. Med. 2017, 15, 34. [Google Scholar] [CrossRef]
- Frontera, W.R.; Hughes, V.A.; Fielding, R.A.; Fiatarone, M.A.; Evans, W.J.; Roubenoff, R. Aging of Skeletal Muscle: A 12-Yr Longitudinal Study. J. Appl. Physiol. 2000, 88, 1321–1326. [Google Scholar] [CrossRef]
- Narici, M.V.; Maffulli, N. Sarcopenia: Characteristics, Mechanisms and Functional Significance. Br. Med. Bull. 2010, 95, 139–159. [Google Scholar] [CrossRef]
- Olsen, D.B.; Sacchetti, M.; Dela, F.; Ploug, T.; Saltin, B. Glucose Clearance Is Higher in Arm than Leg Muscle in Type 2 Diabetes: Glucose Clearance in Arm and Leg Muscles. J. Physiol. 2005, 565, 555–562. [Google Scholar] [CrossRef] [PubMed]
- Callahan, D.M.; Bedrin, N.G.; Subramanian, M.; Berking, J.; Ades, P.A.; Toth, M.J.; Miller, M.S. Age-Related Structural Alterations in Human Skeletal Muscle Fibers and Mitochondria Are Sex Specific: Relationship to Single-Fiber Function. J. Appl. Physiol. 2014, 116, 1582–1592. [Google Scholar] [CrossRef]
- Keller, K. Sarcopenia. Wien. Med. Wochenschr. 2019, 169, 157–172. [Google Scholar] [CrossRef] [PubMed]
- Bakkar, N.; Guttridge, D.C. NF-κB Signaling: A Tale of Two Pathways in Skeletal Myogenesis. Physiol. Rev. 2010, 90, 495–511. [Google Scholar] [CrossRef]
- O’Connor, D.; Kok, T.; Purcell, C.; Duggan, S.; Conlon, K. Investigating the Prevalence of Sarcopenia in Chronic Pancreatitis in an Irish Cohort: A CT-Scan Based Pilot Study. Pancreatology 2014, 14, S74. [Google Scholar] [CrossRef]
- Wei, J.; Xu, H.; Davies, J.L.; Hemmings, G.P. Increase of Plasma IL-6 Concentration with Age in Healthy Subjects. Life Sci. 1992, 51, 1953–1956. [Google Scholar] [CrossRef]
- Jones, T.E.; Stephenson, K.W.; King, J.G.; Knight, K.R.; Marshall, T.L.; Scott, W.B. Sarcopenia–Mechanisms and Treatments. J. Geriatr. Phys. Ther. 2009, 32, 83–89. [Google Scholar] [CrossRef]
- Daynes, R.A.; Araneo, B.A.; Ershler, W.B.; Maloney, C.; Li, G.Z.; Ryu, S.Y. Altered Regulation of IL-6 Production with Normal Aging. Possible Linkage to the Age-Associated Decline in Dehydroepiandrosterone and Its Sulfated Derivative. J. Immunol. 1993, 150, 5219–5230. [Google Scholar] [CrossRef]
- Rasch, S.; Valantiene, I.; Mickevicius, A.; Beer, S.; Rosendahl, J.; Charnley, R.M.; Robinson, S.M. Chronic Pancreatitis: Do Serum Biomarkers Provide an Association with an Inflammageing Phenotype? Pancreatology 2016, 16, 708–714. [Google Scholar] [CrossRef]
- Liguori, I.; Russo, G.; Aran, L.; Bulli, G.; Curcio, F.; Della-Morte, D.; Gargiulo, G.; Testa, G.; Cacciatore, F.; Bonaduce, D.; et al. Sarcopenia: Assessment of Disease Burden and Strategies to Improve Outcomes. Clin. Interv. Aging 2018, 13, 913–927. [Google Scholar] [CrossRef]
- Tosato, M.; Marzetti, E.; Cesari, M.; Savera, G.; Miller, R.R.; Bernabei, R.; Landi, F.; Calvani, R. Measurement of Muscle Mass in Sarcopenia: From Imaging to Biochemical Markers. Aging Clin. Exp. Res. 2017, 29, 19–27. [Google Scholar] [CrossRef] [PubMed]
- Bhasin, S.; He, E.J.; Kawakubo, M.; Schroeder, E.T.; Yarasheski, K.; Opiteck, G.J.; Reicin, A.; Chen, F.; Lam, R.; Tsou, J.A.; et al. N-Terminal Propeptide of Type III Procollagen as a Biomarker of Anabolic Response to Recombinant Human GH and Testosterone. J. Clin. Endocrinol. Metab. 2009, 94, 4224–4233. [Google Scholar] [CrossRef]
- Meng, Y.; Wu, H.; Yang, Y.; Du, H.; Xia, Y.; Guo, X.; Liu, X.; Li, C.; Niu, K. Relationship of Anabolic and Catabolic Biomarkers with Muscle Strength and Physical Performance in Older Adults: A Population-Based Cross-Sectional Study. BMC Musculoskelet. Disord. 2015, 16, 202. [Google Scholar] [CrossRef] [PubMed]
- Priego, T.; Martín, A.I.; González-Hedström, D.; Granado, M.; López-Calderón, A. Role of Hormones in Sarcopenia. In Vitamins and Hormones; Elsevier: Amsterdam, The Netherlands, 2021; Volume 115, pp. 535–570. ISBN 978-0-323-85548-8. [Google Scholar]
- Huang, L.-T.; Wang, J.-H. The Therapeutic Intervention of Sex Steroid Hormones for Sarcopenia. Front. Med. 2021, 8, 739251. [Google Scholar] [CrossRef] [PubMed]
- Brignardello, E.; Runzo, C.; Aragno, M.; Catalano, M.G.; Cassader, M.; Perin, P.C.; Boccuzzi, G. Dehydroepiandrosterone Administration Counteracts Oxidative Imbalance and Advanced Glycation End Product Formation in Type 2 Diabetic Patients. Diabetes Care 2007, 30, 2922–2927. [Google Scholar] [CrossRef] [PubMed]
- Bodine, S.C.; Furlow, J.D. Glucocorticoids and Skeletal Muscle. In Glucocorticoid Signaling; Wang, J.-C., Harris, C., Eds.; Advances in Experimental Medicine and Biology; Springer: New York, NY, USA, 2015; Volume 872, pp. 145–176. ISBN 978-1-4939-2894-1. [Google Scholar]
- Katsuhara, S.; Yokomoto-Umakoshi, M.; Umakoshi, H.; Matsuda, Y.; Iwahashi, N.; Kaneko, H.; Ogata, M.; Fukumoto, T.; Terada, E.; Sakamoto, R.; et al. Impact of Cortisol on Reduction in Muscle Strength and Mass: A Mendelian Randomization Study. J. Clin. Endocrinol. Metab. 2022, 107, e1477–e1487. [Google Scholar] [CrossRef]
- Finken, M.J.J.; Andrews, R.C.; Andrew, R.; Walker, B.R. Cortisol Metabolism in Healthy Young Adults: Sexual Dimorphism in Activities of A-Ring Reductases, but Not 11β-Hydroxysteroid Dehydrogenases 1. J. Clin. Endocrinol. Metab. 1999, 84, 3316–3321. [Google Scholar] [CrossRef]
- Dalin, A.-M.; Magnusson, U.; Häggendal, J.; Nyberg, L. The Effect of Transport Stress on Plasma Levels of Catecholamines, Cortisol, Corticosteroid-Binding Globulin, Blood Cell Count, and Lymphocyte Proliferation in Pigs. Acta Vet. Scand. 1993, 34, 59–68. [Google Scholar] [CrossRef] [PubMed]
- Yanagita, I.; Fujihara, Y.; Kitajima, Y.; Tajima, M.; Honda, M.; Kawajiri, T.; Eda, T.; Yonemura, K.; Yamaguchi, N.; Asakawa, H.; et al. A High Serum Cortisol/DHEA-S Ratio Is a Risk Factor for Sarcopenia in Elderly Diabetic Patients. J. Endocr. Soc. 2019, 3, 801–813. [Google Scholar] [CrossRef]
- Alexopoulos, T.; Vasilieva, L.; Kontogianni, M.D.; Tenta, R.; Georgiou, A.; Stroumpouli, E.; Mani, I.; Alexopoulou, A. Myostatin in Combination with Creatine Phosphokinase or Albumin May Differentiate Patients with Cirrhosis and Sarcopenia. Am. J. Physiol.-Gastrointest. Liver Physiol. 2021, 321, G543–G551. [Google Scholar] [CrossRef]
- Boga, S.; Yildirim, A.E.; Ucbilek, E.; Koksal, A.R.; Sisman, S.T.; Durak, I.; Sen, I.; Dogu, B.; Serin, E.; Ucbilek, A.B.; et al. The Effect of Sarcopenia and Serum Myokines on Prognosis and Survival in Cirrhotic Patients: A Multicenter Cross-Sectional Study. Eur. J. Gastroenterol. Hepatol. 2022, 34, 1261–1268. [Google Scholar] [CrossRef]
- Du, Y.; Xu, C.; Shi, H.; Jiang, X.; Tang, W.; Wu, X.; Chen, M.; Li, H.; Zhang, X.; Cheng, Q. Serum Concentrations of Oxytocin, DHEA and Follistatin Are Associated with Osteoporosis or Sarcopenia in Community-Dwelling Postmenopausal Women. BMC Geriatr. 2021, 21, 542. [Google Scholar] [CrossRef] [PubMed]
- Elabd, C.; Cousin, W.; Upadhyayula, P.; Chen, R.Y.; Chooljian, M.S.; Li, J.; Kung, S.; Jiang, K.P.; Conboy, I.M. Oxytocin Is an Age-Specific Circulating Hormone that Is Necessary for Muscle Maintenance and Regeneration. Nat. Commun. 2014, 5, 4082. [Google Scholar] [CrossRef] [PubMed]
- Baig, M.H.; Ahmad, K.; Moon, J.S.; Park, S.-Y.; Ho Lim, J.; Chun, H.J.; Qadri, A.F.; Hwang, Y.C.; Jan, A.T.; Ahmad, S.S.; et al. Myostatin and Its Regulation: A Comprehensive Review of Myostatin Inhibiting Strategies. Front. Physiol. 2022, 13, 876078. [Google Scholar] [CrossRef] [PubMed]
- Van Eerdenburg, F.J.C.M.; Swaab, D.F.; Van Leeuwen, F.W. Distribution of Vasopressin and Oxytocin Cells and Fibres in the Hypothalamus of the Domestic Pig (Sus Scrofa). J. Comp. Neurol. 1992, 318, 138–146. [Google Scholar] [CrossRef]
- Erkanli, K.; Erkanli Senturk, G.; Aydin, U.; Arbak, S.; Ercan, F.; Tuncdemir, M.; Isiksacan, N.; Bakir, I. Oxytocin Protects Rat Skeletal Muscle Against Ischemia/Reperfusion Injury. Ann. Vasc. Surg. 2013, 27, 662–670. [Google Scholar] [CrossRef]
- Sharma, M.; Kambadur, R.; Matthews, K.G.; Somers, W.G.; Devlin, G.P.; Conaglen, J.V.; Fowke, P.J.; Bass, J.J. Myostatin, a Transforming Growth Factor-? Superfamily Member, Is Expressed in Heart Muscle and Is Upregulated in Cardiomyocytes after Infarct. J. Cell. Physiol. 1999, 180, 1–9. [Google Scholar] [CrossRef]
- Lee, S.-J.; McPherron, A.C. Regulation of Myostatin Activity and Muscle Growth. Proc. Natl. Acad. Sci. USA 2001, 98, 9306–9311. [Google Scholar] [CrossRef]
- Wagner, K.R.; Fleckenstein, J.L.; Amato, A.A.; Barohn, R.J.; Bushby, K.; Escolar, D.M.; Flanigan, K.M.; Pestronk, A.; Tawil, R.; Wolfe, G.I.; et al. A Phase I/IItrial of MYO-029 in Adult Subjects with Muscular Dystrophy. Ann. Neurol. 2008, 63, 561–571. [Google Scholar] [CrossRef]
- Léger, B.; Derave, W.; De Bock, K.; Hespel, P.; Russell, A.P. Human Sarcopenia Reveals an Increase in SOCS-3 and Myostatin and a Reduced Efficiency of Akt Phosphorylation. Rejuven. Res. 2008, 11, 163B–175B. [Google Scholar] [CrossRef] [PubMed]
- Sullivan-Gunn, M.J.; Lewandowski, P.A. Elevated Hydrogen Peroxide and Decreased Catalase and Glutathione Peroxidase Protection Are Associated with Aging Sarcopenia. BMC Geriatr. 2013, 13, 104. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Ranjit, R.; Richardson, A.; Van Remmen, H. Muscle Mitochondrial Catalase Expression Prevents Neuromuscular Junction Disruption, Atrophy, and Weakness in a Mouse Model of Accelerated Sarcopenia. J. Cachexia Sarcopenia Muscle 2021, 12, 1582–1596. [Google Scholar] [CrossRef] [PubMed]
- Bock, F.J.; Tait, S.W.G. Mitochondria as Multifaceted Regulators of Cell Death. Nat. Rev. Mol. Cell Biol. 2020, 21, 85–100. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Shi, C.; He, M.; Xiong, S.; Xia, X. Endoplasmic Reticulum Stress: Molecular Mechanism and Therapeutic Targets. Signal Transduct. Target. Ther. 2023, 8, 352. [Google Scholar] [CrossRef] [PubMed]
- Sousa-Victor, P.; García-Prat, L.; Muñoz-Cánoves, P. Control of Satellite Cell Function in Muscle Regeneration and Its Disruption in Ageing. Nat. Rev. Mol. Cell Biol. 2022, 23, 204–226. [Google Scholar] [CrossRef] [PubMed]
- Alway, S.E.; Siu, P.M. Nuclear Apoptosis and Sarcopenia. In Sarcopenia–Age-Related Muscle Wasting and Weakness; Lynch, G.S., Ed.; Springer: Dordrecht, The Netherlands, 2011; pp. 173–206. ISBN 978-90-481-9712-5. [Google Scholar]
- Dupont-Versteegden, E.E. Apoptosis in Muscle Atrophy: Relevance to Sarcopenia. Exp. Gerontol. 2005, 40, 473–481. [Google Scholar] [CrossRef] [PubMed]
- Mandal, R.; Barrón, J.C.; Kostova, I.; Becker, S.; Strebhardt, K. Caspase-8: The Double-Edged Sword. Biochim. Biophys. Acta BBA-Rev. Cancer 2020, 1873, 188357. [Google Scholar] [CrossRef] [PubMed]
- Wang, T. Searching for the Link between Inflammaging and Sarcopenia. Ageing Res. Rev. 2022, 77, 101611. [Google Scholar] [CrossRef]
- Zhou, J.; Qiu, J.; Song, Y.; Liang, T.; Liu, S.; Ren, C.; Song, X.; Cui, L.; Sun, Y. Pyroptosis and Degenerative Diseases of the Elderly. Cell Death Dis. 2023, 14, 94. [Google Scholar] [CrossRef]
- Wu, C.; Zhou, L.; Yuan, H.; Wu, S. Interconnections among Major Forms of Regulated Cell Death. Apoptosis 2020, 25, 616–624. [Google Scholar] [CrossRef]
- Jin, H.; Xie, W.; He, M.; Li, H.; Xiao, W.; Li, Y. Pyroptosis and Sarcopenia: Frontier Perspective of Disease Mechanism. Cells 2022, 11, 1078. [Google Scholar] [CrossRef] [PubMed]
- Morris, J.L.; Gillet, G.; Prudent, J.; Popgeorgiev, N. Bcl-2 Family of Proteins in the Control of Mitochondrial Calcium Signalling: An Old Chap with New Roles. Int. J. Mol. Sci. 2021, 22, 3730. [Google Scholar] [CrossRef] [PubMed]
- Hatok, J.; Racay, P. Bcl-2 Family Proteins: Master Regulators of Cell Survival. Biomol. Concepts 2016, 7, 259–270. [Google Scholar] [CrossRef] [PubMed]
- Korsmeyer, S.J.; Shutter, J.R.; Veis, D.J.; Merry, D.E.; Oltvai, Z.N. Bcl-2/Bax: A Rheostat That Regulates an Anti-Oxidant Pathway and Cell Death. Semin. Cancer Biol. 1993, 4, 327–332. [Google Scholar] [PubMed]
- Song, W.; Kwak, H.-B.; Lawler, J.M. Exercise Training Attenuates Age-Induced Changes in Apoptotic Signaling in Rat Skeletal Muscle. Antioxid. Redox Signal. 2006, 8, 517–528. [Google Scholar] [CrossRef]
- Desagher, S.; Martinou, J.-C. Mitochondria as the Central Control Point of Apoptosis. Trends Cell Biol. 2000, 10, 369–377. [Google Scholar] [CrossRef] [PubMed]
- Brady, H.J.M.; Gil-Gómez, G. Molecules in Focus Bax. The pro-Apoptotic Bcl-2 Family Member, Bax. Int. J. Biochem. Cell Biol. 1998, 30, 647–650. [Google Scholar] [CrossRef]
- Obafemi, T.F.; Yu, P.; Li, J.; Davis, J.M.; Liu, K.; Cheng, B.; Zhao, X.; Shen, Q.; Younes, M.; Ko, T.C.; et al. Comparable Responses in Male and Female Mice to Cerulein-Induced Chronic Pancreatic Injury and Recovery. JOP J. Pancreas 2018, 19, 236–243. [Google Scholar]
- National Research Council. Nutrient Requirements of Swine, 11th ed.; The National Academies Press: Washington, DC, USA, 2012; ISBN 978-0-309-48903-4. [Google Scholar]
- Grela, E.; Skomiał, J.; Raj, S.; Skiba, G.; Święch, E.; Fandrejewski, H.; Czech, A.; Frankiewicz, A.; Świątkiewicz, M. Zalecenia Żywieniowe i Wartość Pokarmowa Pasz dla Świń: Monografia; Wydanie III uzupełnione z oprogramowaniem; Instytut Fizjologii i Żywienia Zwierząt im. Jana Kielanowskiego Polskiej Akademii Nauk: Jabłonna, Poland, 2020; ISBN 978-83-951612-7-8. [Google Scholar]
- Wojtysiak, D.; Kaczor, U. Effect of g.2728G>A and g.3996T>C Polymorphisms at the Leptin Gene Locus on Microstructure and Physicochemical Properties of Longissimus Lumborum Muscle of Polish Landrace Pigs. Folia Biol. 2011, 59, 77–82. [Google Scholar] [CrossRef]
- Dubowitz, V.; Brooke, M.H. Muscle Biopsy: A Modern Approach; Major problems in neurology; W. B. Saunders: London, UK; Philadelphia, PA, USA, 1973; ISBN 0-7216-3220-3. [Google Scholar]
- Chomczynski, P.; Sacchi, N. Single-Step Method of RNA Isolation by Acid Guanidinium Thiocyanate–Phenol–Chloroform Extraction. Anal. Biochem. 1987, 162, 156–159. [Google Scholar] [CrossRef] [PubMed]
- Grzegorzewska, A.K.; Hrabia, A.; Kowalik, K.; Katarzyńska-Banasik, D.; Kozubek, A.; Sechman, A. In Vitro Effects of PNP and PNMC on Apoptosis and Proliferation in the Hen Ovarian Stroma and Prehierarchal Follicles. Acta Histochem. 2020, 122, 151463. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Zhu, X.; Liang, X.; Xu, H.; Liao, Y.; Lu, K.; Lu, S. Effects of Resveratrol on in Vitro Maturation of Porcine Oocytes and Subsequent Early Embryonic Development Following Somatic Cell Nuclear Transfer. Reprod. Domest. Anim. 2019, 54, 1195–1205. [Google Scholar] [CrossRef]
- Zorrilla, L.; D’Annibale, M.; Swing, S.; Gadsby, J. Expression of Genes Associated with Apoptosis in the Porcine Corpus Luteum during the Oestrous Cycle. Reprod. Domest. Anim. 2013, 48, 755–761. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A New Mathematical Model for Relative Quantification in Real-Time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Salakou, S.; Kardamakis, D.; Tsamandas, A.C.; Zolota, V.; Apostolakis, E.; Tzelepi, V.; Papathanasopoulos, P.; Bonikos, D.S.; Papapetropoulos, T.; Petsas, T.; et al. Increased Bax/Bcl-2 Ratio up-Regulates Caspase-3 and Increases Apoptosis in the Thymus of Patients with Myasthenia Gravis. Vivo Athens Greece 2007, 21, 123–132. [Google Scholar]
- Paul-Samojedny, M.; Kokocińska, D.; Samojedny, A.; Mazurek, U.; Partyka, R.; Lorenz, Z.; Wilczok, T. Expression of Cell Survival/Death Genes: Bcl-2 and Bax at the Rate of Colon Cancer Prognosis. Biochim. Biophys. Acta BBA-Mol. Basis Dis. 2005, 1741, 25–29. [Google Scholar] [CrossRef]



| Gene | Primer Sequences (5′ to 3′) | Product Size (bp) | GeneBank Accession Number | Reference |
|---|---|---|---|---|
| SOD1 | F: CGAGCTGAAGGGAGAGAAGA R: ACATTGCCCAGGTCTCCAA | 199 | NM_0 01190422.1 | [130] |
| CAT | F: ATGTGCAGGCTGGATCTCAC R: GCACAGGAGAATCTTGCATC | 155 | XM_021081498.1 | [130] |
| CASP3 | F: CAAGTTTCTTCAGAGGGGACTGC R: TCGCCAGGAATAGTAACCAGGTGC | 202 | NM_214131 | [131] |
| CASP8 | F: TCCCAGGATTTGCCTC R: AAGCCAGGTCATCACTGTC | 112 | NM_001031779 | [131] |
| BCL2 | F: AGGGCATTCAGTGACCTGAC R: CGATCCGACTCACCAATAC | 193 | NM_214285 | [130] |
| BAX | F: TGCCTCAGGATGCATCTACC R: AAGTAGAAAAGCGCGACCA | 199 | XM_003127290 | [130] |
| GAPDH | F: ATCCCGCCAACATCAAAT R: TCACGCCCATCACAAACA | 165 | XM_021091114.1 | [130] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tomaszewska, E.; Wojtysiak, D.; Grzegorzewska, A.; Świątkiewicz, M.; Donaldson, J.; Arciszewski, M.B.; Dresler, S.; Puzio, I.; Szymańczyk, S.; Dobrowolski, P.; et al. Understanding Secondary Sarcopenia Development in Young Adults Using Pig Model with Chronic Pancreatitis. Int. J. Mol. Sci. 2024, 25, 8735. https://doi.org/10.3390/ijms25168735
Tomaszewska E, Wojtysiak D, Grzegorzewska A, Świątkiewicz M, Donaldson J, Arciszewski MB, Dresler S, Puzio I, Szymańczyk S, Dobrowolski P, et al. Understanding Secondary Sarcopenia Development in Young Adults Using Pig Model with Chronic Pancreatitis. International Journal of Molecular Sciences. 2024; 25(16):8735. https://doi.org/10.3390/ijms25168735
Chicago/Turabian StyleTomaszewska, Ewa, Dorota Wojtysiak, Agnieszka Grzegorzewska, Małgorzata Świątkiewicz, Janine Donaldson, Marcin B. Arciszewski, Sławomir Dresler, Iwona Puzio, Sylwia Szymańczyk, Piotr Dobrowolski, and et al. 2024. "Understanding Secondary Sarcopenia Development in Young Adults Using Pig Model with Chronic Pancreatitis" International Journal of Molecular Sciences 25, no. 16: 8735. https://doi.org/10.3390/ijms25168735
APA StyleTomaszewska, E., Wojtysiak, D., Grzegorzewska, A., Świątkiewicz, M., Donaldson, J., Arciszewski, M. B., Dresler, S., Puzio, I., Szymańczyk, S., Dobrowolski, P., Bonior, J., Mielnik-Błaszczak, M., Kuc, D., & Muszyński, S. (2024). Understanding Secondary Sarcopenia Development in Young Adults Using Pig Model with Chronic Pancreatitis. International Journal of Molecular Sciences, 25(16), 8735. https://doi.org/10.3390/ijms25168735

