Pharmacological Modulation of Excitotoxicity through the Combined Use of NMDA Receptor Inhibition and Group III mGlu Activation Reduces TMT-Induced Neurodegeneration in the Rat Hippocampus
Abstract
1. Introduction
2. Results
2.1. Nissl Staining
2.2. Passive Avoidance Test
2.3. qRT-PCR Analysis
2.4. Immunohistochemistry
3. Discussion
Limitations
4. Materials and Methods
4.1. Materials
4.2. Animals and Treatments
4.3. Passive Avoidance Test
4.4. Specimen Harvesting
4.5. Histological Examination
4.5.1. Nissl Staining
4.5.2. Immunohistochemistry
4.6. qRT-PCR Analysis
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Belov Kirdajova, D.; Kriska, J.; Tureckova, J.; Anderova, M. Ischemia-Triggered Glutamate Excitotoxicity From the Perspective of Glial Cells. Front. Cell. Neurosci. 2020, 14, 51. [Google Scholar] [CrossRef] [PubMed]
- Armada-Moreira, A.; Gomes, J.I.; Pina, C.C.; Savchak, O.K.; Gonçalves-Ribeiro, J.; Rei, N.; Pinto, S.; Morais, T.P.; Martins, R.S.; Ribeiro, F.F.; et al. Going the Extra (Synaptic) Mile: Excitotoxicity as the Road Toward Neurodegenerative Diseases. Front. Cell. Neurosci. 2020, 14, 90. [Google Scholar] [CrossRef] [PubMed]
- Tymianski, M. Cytosolic Calcium Concentrations and Cell Death in Vitro. Adv. Neurol. 1996, 71, 85–105. [Google Scholar] [PubMed]
- Choi, D.W. Calcium-Mediated Neurotoxicity: Relationship to Specific Channel Types and Role in Ischemic Damage. Trends Neurosci. 1988, 11, 465–469. [Google Scholar] [CrossRef]
- Robinson, D.M.; Keating, G.M. Memantine: A Review of Its Use in Alzheimer’s Disease. Drugs 2006, 66, 1515–1534. [Google Scholar] [CrossRef]
- Farlow, M.R.; Graham, S.M.; Alva, G. Memantine for the Treatment of Alzheimer’s Disease. Drug-Saf. 2008, 31, 577–585. [Google Scholar] [CrossRef]
- Ribeiro, F.M.; Vieira, L.B.; Pires, R.G.W.; Olmo, R.P.; Ferguson, S.S.G. Metabotropic Glutamate Receptors and Neurodegenerative Diseases. Pharmacol. Res. 2017, 115, 179–191. [Google Scholar] [CrossRef]
- Caraci, F.; Nicoletti, F.; Copani, A. Metabotropic Glutamate Receptors: The Potential for Therapeutic Applications in Alzheimer’s Disease. Curr. Opin. Pharmacol. 2018, 38, 1–7. [Google Scholar] [CrossRef]
- Bruno, V.; Caraci, F.; Copani, A.; Matrisciano, F.; Nicoletti, F.; Battaglia, G. The Impact of Metabotropic Glutamate Receptors into Active Neurodegenerative Processes: A “Dark Side” in the Development of New Symptomatic Treatments for Neurologic and Psychiatric Disorders. Neuropharmacology 2017, 115, 180–192. [Google Scholar] [CrossRef]
- Arkhipov, V.; Kapralova, M.; Pershina, E.; Gordon, R. Delayed Treatments with Pharmacological Modulators of Pre- and Postsynaptic MGlu Receptors Rescue the Hippocampus from Kainate-Induced Neurodegeneration. Neurosci. Lett. 2014, 570, 5–9. [Google Scholar] [CrossRef]
- Pershina, E.V.; Kapralova, M.V.; Arkhipov, V.I. Effect of Pharmacological Modulation of Activity of Metabotropic Glutamate Receptors on Their Gene Expression after Excitotoxic Damage in Hippocampal Neurons. Bull. Exp. Biol. Med. 2017, 162, 784–787. [Google Scholar] [CrossRef] [PubMed]
- Pershina, E.V.; Mikheeva, I.B.; Kamaltdinova, E.R.; Arkhipov, V.I. Expression of MGlu Receptor Genes in the Hippocampus After Intoxication with Trimethyltin. J. Mol. Neurosci. 2019, 67, 258–264. [Google Scholar] [CrossRef] [PubMed]
- Geloso, M.C.; Corvino, V.; Michetti, F. Trimethyltin-Induced Hippocampal Degeneration as a Tool to Investigate Neurodegenerative Processes. Neurochem. Int. 2011, 58, 729–738. [Google Scholar] [CrossRef]
- Kim, J.; Yang, M.; Son, Y.; Jang, H.; Kim, D.; Kim, J.-C.; Kim, S.-H.; Kang, M.-J.; Im, H.-I.; Shin, T.; et al. Glial Activation with Concurrent Up-Regulation of Inflammatory Mediators in Trimethyltin-Induced Neurotoxicity in Mice. Acta Histochem. 2014, 116, 1490–1500. [Google Scholar] [CrossRef]
- Trabucco, A.; Di Pietro, P.; Nori, S.L.; Fulceri, F.; Fumagalli, L.; Paparelli, A.; Fornai, F. Methylated Tin Toxicity a Reappraisal Using Rodents Models. Arch. Ital. Biol. 2009, 147, 141–153. [Google Scholar] [PubMed]
- Holmseth, S.; Scott, H.A.; Real, K.; Lehre, K.P.; Leergaard, T.B.; Bjaalie, J.G.; Danbolt, N.C. The Concentrations and Distributions of Three C-Terminal Variants of the GLT1 (EAAT2; Slc1a2) Glutamate Transporter Protein in Rat Brain Tissue Suggest Differential Regulation. Neuroscience 2009, 162, 1055–1071. [Google Scholar] [CrossRef]
- Lee, S.; Yang, M.; Kim, J.; Kang, S.; Kim, J.; Kim, J.-C.; Jung, C.; Shin, T.; Kim, S.-H.; Moon, C. Trimethyltin-Induced Hippocampal Neurodegeneration: A Mechanism-Based Review. Brain Res. Bull. 2016, 125, 187–199. [Google Scholar] [CrossRef]
- Vinogradova, O.S. Hippocampus as Comparator: Role of the Two Input and Two Output Systems of the Hippocampus in Selection and Registration of Information. Hippocampus 2001, 11, 578–598. [Google Scholar] [CrossRef]
- Eichenbaum, H. Time Cells in the Hippocampus: A New Dimension for Mapping Memories. Nat. Rev. Neurosci. 2014, 15, 732–744. [Google Scholar] [CrossRef]
- Buzsáki, G. Neuroscience. Our Skewed Sense of Space. Science 2015, 347, 612–613. [Google Scholar] [CrossRef]
- Mikheeva, I.B.; Pershina, E.V.; Chernomorets, I.Y.; Zhuikova, N.S.; Pavlik, L.L.; Arkhipov, V.I. Autophagy in Neurons of the Prefrontal Cortex and Hippocampus of Rats after Trimethyltin Chloride Intoxication. Bull. Exp. Biol. Med. 2022, 173, 660–664. [Google Scholar] [CrossRef] [PubMed]
- Brodie, M.E.; Opacka-Juffry, J.; Peterson, D.W.; Brown, A.W. Neurochemical Changes in Hippocampal and Caudate Dialysates Associated with Early Trimethyltin Neurotoxicity in Rats. Neurotoxicology 1990, 11, 35–46. [Google Scholar] [PubMed]
- Earley, B.; Burke, M.; Leonard, B.E. Behavioural, Biochemical and Histological Effects of Trimethyltin (TMT) Induced Brain Damage in the Rat. Neurochem. Int. 1992, 21, 351–366. [Google Scholar] [CrossRef] [PubMed]
- Corvino, V.; Marchese, E.; Michetti, F.; Geloso, M.C. Neuroprotective Strategies in Hippocampal Neurodegeneration Induced by the Neurotoxicant Trimethyltin. Neurochem. Res. 2013, 38, 240–253. [Google Scholar] [CrossRef]
- Dragić, M.; Mitrović, N.; Adžić, M.; Nedeljković, N.; Grković, I. Microglial- and Astrocyte-Specific Expression of Purinergic Signaling Components and Inflammatory Mediators in the Rat Hippocampus During Trimethyltin-Induced Neurodegeneration. ASN Neuro 2021, 13, 17590914211044882. [Google Scholar] [CrossRef]
- Nakashiba, T.; Young, J.Z.; McHugh, T.J.; Buhl, D.L.; Tonegawa, S. Transgenic Inhibition of Synaptic Transmission Reveals Role of CA3 Output in Hippocampal Learning. Science 2008, 319, 1260–1264. [Google Scholar] [CrossRef]
- Parsons, C.G.; Stöffler, A.; Danysz, W. Memantine: A NMDA Receptor Antagonist That Improves Memory by Restoration of Homeostasis in the Glutamatergic System—Too Little Activation Is Bad, Too Much Is Even Worse. Neuropharmacology 2007, 53, 699–723. [Google Scholar] [CrossRef]
- Zaitsev, A.V.; Kim, K.K.; Vasilev, D.S.; Lukomskaya, N.Y.; Lavrentyeva, V.V.; Tumanova, N.L.; Zhuravin, I.A.; Magazanik, L.G. N-Methyl-D-Aspartate Receptor Channel Blockers Prevent Pentylenetetrazole-Induced Convulsions and Morphological Changes in Rat Brain Neurons. J. Neurosci. Res. 2015, 93, 454–465. [Google Scholar] [CrossRef]
- Tronci, E.; Fidalgo, C.; Zianni, E.; Collu, M.; Stancampiano, R.; Morelli, M.; Gardoni, F.; Carta, M. Effect of Memantine on L-DOPA-Induced Dyskinesia in the 6-OHDA-Lesioned Rat Model of Parkinson’s Disease. Neuroscience 2014, 265, 245–252. [Google Scholar] [CrossRef]
- Klyubin, I.; Wang, Q.; Reed, M.N.; Irving, E.A.; Upton, N.; Hofmeister, J.; Cleary, J.P.; Anwyl, R.; Rowan, M.J. Protection against Aβ-Mediated Rapid Disruption of Synaptic Plasticity and Memory by Memantine. Neurobiol. Aging 2011, 32, 614–623. [Google Scholar] [CrossRef]
- Rosi, S.; Vazdarjanova, A.; Ramirez-Amaya, V.; Worley, P.F.; Barnes, C.A.; Wenk, G.L. Memantine Protects against LPS-Induced Neuroinflammation, Restores Behaviorally-Induced Gene Expression and Spatial Learning in the Rat. Neuroscience 2006, 142, 1303–1315. [Google Scholar] [CrossRef] [PubMed]
- Wei, X.; Gao, H.; Zou, J.; Liu, X.; Chen, D.; Liao, J.; Xu, Y.; Ma, L.; Tang, B.; Zhang, Z.; et al. Contra-Directional Coupling of Nur77 and Nurr1 in Neurodegeneration: A Novel Mechanism for Memantine-Induced Anti-Inflammation and Anti-Mitochondrial Impairment. Mol. Neurobiol. 2016, 53, 5876–5892. [Google Scholar] [CrossRef] [PubMed]
- Domin, H. Group III Metabotropic Glutamate Receptors as Promising Targets for Neuroprotective Therapy: Particular Emphasis on the Role of MGlu4 and MGlu7 Receptors. Pharmacol. Biochem. Behav. 2022, 219, 173452. [Google Scholar] [CrossRef]
- Broadstock, M.; Austin, P.J.; Betts, M.J.; Duty, S. Antiparkinsonian Potential of Targeting Group III Metabotropic Glutamate Receptor Subtypes in the Rodent Substantia Nigra Pars Reticulata. Br. J. Pharmacol. 2012, 165, 1034–1045. [Google Scholar] [CrossRef]
- Caraci, F.; Battaglia, G.; Sortino, M.A.; Spampinato, S.; Molinaro, G.; Copani, A.; Nicoletti, F.; Bruno, V. Metabotropic Glutamate Receptors in Neurodegeneration/Neuroprotection: Still a Hot Topic? Neurochem. Int. 2012, 61, 559–565. [Google Scholar] [CrossRef]
- Besong, G.; Battaglia, G.; D’Onofrio, M.; Di Marco, R.; Ngomba, R.T.; Storto, M.; Castiglione, M.; Mangano, K.; Busceti, C.L.; Nicoletti, F.R.; et al. Activation of Group III Metabotropic Glutamate Receptors Inhibits the Production of RANTES in Glial Cell Cultures. J. Neurosci. 2002, 22, 5403–5411. [Google Scholar] [CrossRef] [PubMed]
- Gogliotti, R.G.; Senter, R.K.; Fisher, N.M.; Adams, J.; Zamorano, R.; Walker, A.G.; Blobaum, A.L.; Engers, D.W.; Hopkins, C.R.; Daniels, J.S.; et al. MGlu7 Potentiation Rescues Cognitive, Social, and Respiratory Phenotypes in a Mouse Model of Rett Syndrome. Sci. Transl. Med. 2017, 9, eaai7459. [Google Scholar] [CrossRef]
- Jalan-Sakrikar, N.; Field, J.R.; Klar, R.; Mattmann, M.E.; Gregory, K.J.; Zamorano, R.; Engers, D.W.; Bollinger, S.R.; Weaver, C.D.; Days, E.L.; et al. Identification of Positive Allosteric Modulators VU0155094 (ML397) and VU0422288 (ML396) Reveals New Insights into the Biology of Metabotropic Glutamate Receptor 7. ACS Chem. Neurosci. 2014, 5, 1221–1237. [Google Scholar] [CrossRef]
- Koczyk, D.; Oderfeld-Nowak, B. Long-Term Microglial and Astroglial Activation in the Hippocampus of Trimethyltin-Intoxicated Rat: Stimulation of NGF and TrkA Immunoreactivities in Astroglia but Not in Microglia. Int. J. Dev. Neurosci. 2000, 18, 591–606. [Google Scholar] [CrossRef] [PubMed]
- Au, N.P.B.; Ma, C.H.E. Recent Advances in the Study of Bipolar/Rod-Shaped Microglia and Their Roles in Neurodegeneration. Front. Aging Neurosci. 2017, 9, 128. [Google Scholar] [CrossRef]
- Witkin, J.M.; Pandey, K.P.; Smith, J.L. Clinical Investigations of Compounds Targeting Metabotropic Glutamate Receptors. Pharmacol. Biochem. Behav. 2022, 219, 173446. [Google Scholar] [CrossRef]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An Open-Source Platform for Biological-Image Analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef]
- Pachitariu, M.; Stringer, C. Cellpose 2.0: How to Train Your Own Model. Nat. Methods 2022, 19, 1634–1641. [Google Scholar] [CrossRef]
- Otsu, N. A Threshold Selection Method from Gray-Level Histograms. IEEE Trans. Syst. Man Cybern. 1979, 9, 62–66. [Google Scholar] [CrossRef]
- Chomczynski, P.; Sacchi, N. The Single-Step Method of RNA Isolation by Acid Guanidinium Thiocyanate–Phenol–Chloroform Extraction: Twenty-Something Years On. Nat. Protoc. 2006, 1, 581–585. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing Real-Time PCR Data by the Comparative CT Method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
Gene (Protein) | Oligonucleotide 5′–3′ (Forward + Reverse) | Amplicon Size (bp) |
---|---|---|
Actb (beta-actin) | ATGGTGGGTATGGGTCAGAACTTTTCACGGTTGGCCTTAG | 225 |
Grin2b (receptor subunit GluN2B of the NMDA) | AATGGCGGATAAGGATGAGTC CTTAGAGTCGCCATCGTCCA | 247 |
EAAT2 (glutamate transporter-1) | GAGGAGGCCAATACAACCAA TTCATCCCGTCCTTGAACTC | 305 |
Aif1 (allograft inflammatory factor 1) | TCATCGTCATCTCCCCACCTA AACTCCATGTACTTCGTCTTGAA | 117 |
Gfap (glial fibrillary acidic protein) | CGAAGAAAACCGCATCACCA CCGCATCTCCACCGTCTTTA | 239 |
IL1b (interleukin-1 beta) | GAAGAAGAGCCCGTCCTCTGTG ATGGGTCAGACAGCACGAGGC | 127 |
TGFb1 (transforming growth factor beta 1) | AGAGCCCTGGATACCAACTA GACCTTGCTGTACTGTGTGT | 186 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pershina, E.V.; Chernomorets, I.Y.; Fedorov, D.A.; Arkhipov, V.I. Pharmacological Modulation of Excitotoxicity through the Combined Use of NMDA Receptor Inhibition and Group III mGlu Activation Reduces TMT-Induced Neurodegeneration in the Rat Hippocampus. Int. J. Mol. Sci. 2023, 24, 8249. https://doi.org/10.3390/ijms24098249
Pershina EV, Chernomorets IY, Fedorov DA, Arkhipov VI. Pharmacological Modulation of Excitotoxicity through the Combined Use of NMDA Receptor Inhibition and Group III mGlu Activation Reduces TMT-Induced Neurodegeneration in the Rat Hippocampus. International Journal of Molecular Sciences. 2023; 24(9):8249. https://doi.org/10.3390/ijms24098249
Chicago/Turabian StylePershina, Ekaterina V., Irina Yu. Chernomorets, Dmitry A. Fedorov, and Vladimir I. Arkhipov. 2023. "Pharmacological Modulation of Excitotoxicity through the Combined Use of NMDA Receptor Inhibition and Group III mGlu Activation Reduces TMT-Induced Neurodegeneration in the Rat Hippocampus" International Journal of Molecular Sciences 24, no. 9: 8249. https://doi.org/10.3390/ijms24098249
APA StylePershina, E. V., Chernomorets, I. Y., Fedorov, D. A., & Arkhipov, V. I. (2023). Pharmacological Modulation of Excitotoxicity through the Combined Use of NMDA Receptor Inhibition and Group III mGlu Activation Reduces TMT-Induced Neurodegeneration in the Rat Hippocampus. International Journal of Molecular Sciences, 24(9), 8249. https://doi.org/10.3390/ijms24098249