Mesenchymal Stem Cell Behavior under Microgravity: From Stress Response to a Premature Senescence
Abstract
:1. Introduction
2. Results
2.1. Microgravity Affects Stemness Gene Expression
2.2. Simulated Microgravity Affects a Molecular Pattern of Stress Response
2.3. Simulated Microgravity Activates a Molecular Program of Cell Senescence
2.4. Simulated mMicrogravity Modulates the Expression of Bax and Bcl2 Apoptotis Related Genes
2.5. Effects of Simulated Microgravity on the Cytoskeleton
2.6. Expression of Cytochrome C under Microgravity
2.7. Morphological Analysis of WJ-MSCs Exposed to Microgravity
2.8. Evaluation of Protein Expression
3. Discussion
4. Materials and Methods
4.1. WJ-MSC Isolation and Culture
4.2. Microgravity Simulation
4.3. RNA Extraction and Quantitative Polymerase Chain Reaction
4.4. Immunofluorescence Analysis
4.5. Western Blot Analysis
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Maioli, M.; Basoli, V.; Santaniello, S.; Cruciani, S.; Delitala, A.P.; Pinna, R.; Milia, E.; Grillari-Voglauer, R.; Fontani, V.; Rinaldi, S.; et al. Osteogenesis from Dental Pulp Derived Stem Cells: A Novel Conditioned Medium Including Melatonin within a Mixture of Hyaluronic, Butyric, and Retinoic Acids. Stem Cells Int. 2016, 2016, 2056416. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.-W.; Staples, M.; Shinozuka, K.; Pantcheva, P.; Kang, S.-D.; Borlongan, C.V. Wharton’s Jelly-Derived Mesenchymal Stem Cells: Phenotypic Characterization and Optimizing Their Therapeutic Potential for Clinical Applications. Int. J. Mol. Sci. 2013, 14, 11692. [Google Scholar] [CrossRef]
- Plaks, V.; Kong, N.; Werb, Z. The Cancer Stem Cell Niche: How Essential Is the Niche in Regulating Stemness of Tumor Cells? Cell Stem Cell 2015, 16, 225–238. [Google Scholar] [CrossRef] [PubMed]
- Rinaldi, S.; Maioli, M.; Santaniello, S.; Pigliaru, G.; Ventura, C.; Montela, A.; Sanna, R.; Bandiera, P.; Bagella, L.; Delitala, A.; et al. Amniotic fluid stem cells morph into a cardiovascular lineage: Analysis of a chemically induced cardiac and vascular commitment. Drug Des. Dev. Ther. 2013, 7, 1063–1073. [Google Scholar] [CrossRef] [PubMed]
- Takechi, K.; Kuwabara, Y.; Mizuno, M. Ultrastructural and immunohistochemical studies of Wharton’s jelly umbilical cord cells. Placenta 1993, 14, 235–245. [Google Scholar] [CrossRef]
- Abbaszadeh, H.; Ghorbani, F.; Derakhshani, M.; Movassaghpour, A.A.; Yousefi, M.; Talebi, M.; Shamsasenjan, K. Regenerative potential of Wharton’s jelly-derived mesenchymal stem cells: A new horizon of stem cell therapy. J. Cell. Physiol. 2020, 235, 9230–9240. [Google Scholar] [CrossRef]
- Stolzing, A.; Jones, E.; McGonagle, D.; Scutt, A. Age-related changes in human bone marrow-derived mesenchymal stem cells: Consequences for cell therapies. Mech. Ageing Dev. 2008, 129, 163–173. [Google Scholar] [CrossRef]
- Enzmann, H.; Daniel, V. Die Diagnose des “excited-skin-syndrome” aus dem Blut. Laryngo-Rhino-Otologie 1991, 70, 184–186. [Google Scholar] [CrossRef]
- Khan, H.; Mafi, P.; Mafi, R.; Khan, W. The Effects of Ageing on Differentiation and Characterisation of Human Mesenchymal Stem Cells. Curr. Stem Cell Res. Ther. 2018, 13, 378–383. [Google Scholar] [CrossRef]
- Müller, M.; Raabe, O.; Addicks, K.; Wenisch, S.; Arnhold, S. Effects of non-steroidal anti-inflammatory drugs on proliferation, differentiation and migration in equine mesenchymal stem cells. Cell Biol. Int. 2011, 35, 235–248. [Google Scholar] [CrossRef]
- Sabapathy, V.; Sundaram, B.; VM, S.; Mankuzhy, P.; Kumar, S. Human Wharton’s Jelly Mesenchymal Stem Cells plasticity augments scar-free skin wound healing with hair growth. PLoS ONE 2014, 9, e93726. [Google Scholar] [CrossRef] [PubMed]
- Weiss, M.L.; Anderson, C.; Medicetty, S.; Seshareddy, K.B.; Weiss, R.J.; Vander Werff, I.; Troyer, D.; McIntosh, K.R. Immune Properties of Human Umbilical Cord Wharton’s Jelly-Derived Cells. Stem Cells 2008, 26, 2865–2874. [Google Scholar] [CrossRef] [PubMed]
- Lu, Z.; Ye, D.; Qian, L.; Zhu, L.; Wang, C.; Guan, D.; Zhang, X.; Xu, Y. Human umbilical cord mesenchymal stem cell therapy on neuromyelitis optica. Curr. Neurovasc. Res. 2012, 9, 250–255. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Li, J.; Zhang, Y.; Zhang, M.; Chen, J.; Li, X.; Hu, X.; Jiang, S.; Shi, S.; Sun, L. Umbilical cord mesenchymal stem cell transplantation in active and refractory systemic lupus erythematosus: A multicenter clinical study. Arthritis Res. Ther. 2014, 16, R79. [Google Scholar] [CrossRef]
- Balzano, F.; Cruciani, S.; Basoli, V.; Santaniello, S.; Facchin, F.; Ventura, C.; Maioli, M. MiR200 and miR302: Two Big Families Influencing Stem Cell Behavior. Molecules 2018, 23, 282. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, K.; Yamanaka, S. Induction of Pluripotent Stem Cells from Mouse Embryonic and Adult Fibroblast Cultures by Defined Factors. Cell 2006, 126, 663–676. [Google Scholar] [CrossRef]
- Rinaldi, S.; Fontani, V.; Castagna, A.; Lotti, M.; Ventura, C.; Maioli, M.; Santaniello, S.; Pigliaru, G.; Carta, A.; Gualini, S. Regenerative treatment using a radioelectric asymmetric conveyor as a novel tool in antiaging medicine: An in vitro beta-galactosidase study. Clin. Interv. Aging 2012, 7, 191–194. [Google Scholar] [CrossRef] [PubMed]
- Rinaldi, S.; Maioli, M.; Pigliaru, G.; Castagna, A.; Santaniello, S.; Basoli, V.; Fontani, V.; Ventura, C. Stem cell senescence. Effects of REAC technology on telomerase-independent and telomerase-dependent pathways. Sci. Rep. 2014, 4, 6373. [Google Scholar] [CrossRef]
- Maioli, M.; Rinaldi, S.; Pigliaru, G.; Santaniello, S.; Basoli, V.; Castagna, A.; Fontani, V.; Ventura, C. REAC technology and hyaluron synthase 2, an interesting network to slow down stem cell senescence. Sci. Rep. 2016, 6, 28682. [Google Scholar] [CrossRef]
- Stein, T.P.; Leskiw, M.J. Oxidant damage during and after spaceflight. Am. J. Physiol. Metab. 2000, 278, E375–E382. [Google Scholar] [CrossRef]
- Pizzino, G.; Irrera, N.; Cucinotta, M.; Pallio, G.; Mannino, F.; Arcoraci, V.; Squadrito, F.; Altavilla, D.; Bitto, A. Oxidative Stress: Harms and Benefits for Human Health. Oxid. Med. Cell. Longev. 2017, 2017, 8416763. [Google Scholar] [CrossRef] [PubMed]
- Tsamesidis, I.; Egwu, C.O.; Pério, P.; Augereau, J.-M.; Benoit-Vical, F.; Reybier, K. An LC–MS Assay to Measure Superoxide Radicals and Hydrogen Peroxide in the Blood System. Metabolites 2020, 10, 175. [Google Scholar] [CrossRef]
- Raynes, R.; Brunquell, J.; Westerheide, S.D. Stress Inducibility of SIRT1 and Its Role in Cytoprotection and Cancer. Genes Cancer 2013, 4, 172–182. [Google Scholar] [CrossRef] [PubMed]
- Yatagai, F.; Honma, M.; Dohmae, N.; Ishioka, N. Biological effects of space environmental factors: A possible interaction between space radiation and microgravity. Life Sci. Space Res. 2018, 20, 113–123. [Google Scholar] [CrossRef] [PubMed]
- Tominaga, H.; Kodama, S.; Matsuda, N.; Suzuki, K.; Watanabe, M. Involvement of Reactive Oxygen Species (ROS) in the Induction of Genetic Instability by Radiation. J. Radiat. Res. 2004, 45, 181–188. [Google Scholar] [CrossRef] [PubMed]
- Boonstra, J. Growth factor-induced signal transduction in adherent mammalian cells is sensitive to gravity. FASEB J. 1999, 13, S35–S42. [Google Scholar] [CrossRef] [PubMed]
- Garrido, C.; Galluzzi, L.; Brunet, M.; Puig, P.E.; Didelot, C.; Kroemer, G. Mechanisms of cytochrome c release from mitochondria. Cell Death Differ. 2006, 13, 1423–1433. [Google Scholar] [CrossRef]
- Unsworth, B.R.; Lelkes, P.I. Growing tissues in microgravity. Nat. Med. 1998, 4, 901–907. [Google Scholar] [CrossRef]
- Dinarelli, S.; Longo, G.; Dietler, G.; Francioso, A.; Mosca, L.; Pannitteri, G.; Boumis, G.; Bellelli, A.; Girasole, M. Erythrocyte’s aging in microgravity highlights how environmental stimuli shape metabolism and morphology. Sci. Rep. 2018, 8, 5277. [Google Scholar] [CrossRef]
- van Loon, J.J. Some history and use of the random positioning machine, RPM, in gravity related research. Adv. Space Res. 2007, 39, 1161–1165. [Google Scholar] [CrossRef]
- Wuest, S.L.; Richard, S.; Kopp, S.; Grimm, D.; Egli, M. Simulated Microgravity: Critical Review on the Use of Random Positioning Machines for Mammalian Cell Culture. BioMed Res. Int. 2015, 2015, 971474. [Google Scholar] [CrossRef] [PubMed]
- Herranz, R.; Anken, R.; Boonstra, J.; Braun, M.; Christianen, P.C.M.; De Geest, M.; Hauslage, J.; Hilbig, R.; Hill, R.J.A.; Lebert, M.; et al. Ground-Based Facilities for Simulation of Microgravity: Organism-Specific Recommendations for Their Use, and Recommended Terminology. Astrobiology 2013, 13, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Kunisada, T.; Kawai, A.; Inoue, H.; Namba, M. Effects of simulated microgravity on human osteoblast-like cells in culture. Acta Med. Okayama 1997, 51, 135–140. [Google Scholar] [PubMed]
- Gmünder, F.K.; Kiess, M.; Sonnefeld, G.; Lee, J.; Cogoli, A. A ground-based model to study the effects of weightlessness on lymphocytes. Biol. Cell 1990, 70, 33–38. [Google Scholar] [CrossRef]
- Dulugiac, M.; Moldovan, L.; Zarnescu, O. Comparative studies of mesenchymal stem cells derived from different cord tissue compartments—The influence of cryopreservation and growth media. Placenta 2015, 36, 1192–1203. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-C.; Lee, J.-Y.; Park, M.-J. Oct4 suppresses IR-induced premature senescence in breast cancer cells through STAT3- and NF-κB-mediated IL-24 production. Int. J. Oncol. 2018, 53, 47–58. [Google Scholar] [CrossRef]
- Kesely, K.; Noomuna, P.; Vieth, M.; Hipskind, P.; Haldar, K.; Pantaleo, A.; Turrini, F.; Low, P.S. Identification of tyrosine kinase inhibitors that halt Plasmodium falciparum parasitemia. PLoS ONE 2020, 15, e0242372. [Google Scholar] [CrossRef]
- Baker, D.J.; Perez-Terzic, C.; Jin, F.; Pitel, K.S.; Niederländer, N.J.; Jeganathan, K.; Yamada, S.; Reyes, S.; Rowe, L.; Hiddinga, H.J.; et al. Opposing roles for p16Ink4a and p19Arf in senescence and ageing caused by BubR1 insufficiency. Nature 2008, 10, 825–836. [Google Scholar] [CrossRef]
- Kamijo, T.; Zindy, F.; Roussel, M.F.; Quelle, D.E.; Downing, J.R.; Ashmun, R.A.; Grosveld, G.; Sherr, C.J. Tumor Suppression at the Mouse INK4a Locus Mediated by the Alternative Reading Frame Product p19 ARF. Cell 1997, 91, 649–659. [Google Scholar] [CrossRef]
- Conboy, I.M.; Rando, T.A. The Regulation of Notch Signaling Controls Satellite Cell Activation and Cell Fate Determination in Postnatal Myogenesis. Dev. Cell 2002, 3, 397–409. [Google Scholar] [CrossRef]
- Conboy, I.M.; Conboy, M.J.; Smythe, G.M.; Rando, T.A. Notch-Mediated Restoration of Regenerative Potential to Aged Muscle. Science 2003, 302, 1575–1577. [Google Scholar] [CrossRef]
- Beauséjour, C.M.; Krtolica, A.; Galimi, F.; Narita, M.; Lowe, S.W.; Yaswen, P.; Campisi, J. Reversal of human cellular senescence: Roles of the p53 and p16 pathways. EMBO J. 2003, 22, 4212–4222. [Google Scholar] [CrossRef]
- Milanovic, M.; Fan, D.N.Y.; Belenki, D.; Däbritz, J.H.M.; Zhao, Z.; Yu, Y.; Dörr, J.R.; Dimitrova, L.; Lenze, D.; Monteiro Barbosa, I.A.; et al. Senescence-associated reprogramming promotes cancer stemness. Nature 2018, 553, 96–100. [Google Scholar] [CrossRef] [PubMed]
- Cheung, T.H.; Quach, N.L.; Charville, G.W.; Liu, L.; Park, L.; Edalati, A.; Yoo, B.; Hoang, P.; Rando, T.A. Maintenance of muscle stem-cell quiescence by microRNA-489. Nature 2012, 482, 524–528. [Google Scholar] [CrossRef]
- Vousden, K.H.; Lane, D.P. p53 in health and disease. Nat. Rev. Mol. Cell Biol. 2007, 8, 275–283. [Google Scholar] [CrossRef]
- Santaniello, S.; Cruciani, S.; Basoli, V.; Balzano, F.; Bellu, E.; Garroni, G.; Ginesu, G.C.; Cossu, M.L.; Facchin, F.; Delitala, A.P.; et al. Melatonin and Vitamin D Orchestrate Adipose Derived Stem Cell Fate by Modulating Epigenetic Regulatory Genes. Int. J. Med. Sci. 2018, 15, 1631–1639. [Google Scholar] [CrossRef]
- Nunnari, J.; Suomalainen, A. Mitochondria: In Sickness and in Health. Cell 2012, 148, 1145–1159. [Google Scholar] [CrossRef] [PubMed]
- Calderwood, S.K.; Murshid, A.; Prince, T. The Shock of Aging: Molecular Chaperones and the Heat Shock Response in Longevity and Aging—A Mini-Review. Gerontology 2009, 55, 550–558. [Google Scholar] [CrossRef] [PubMed]
- Hartl, F.U. Molecular chaperones in cellular protein folding. Nature 1996, 381, 571–580. [Google Scholar] [CrossRef]
- Craig, E.A.; Weissman, J.S.; Horwich, A.L. Heat shock proteins and molecular chaperones: Mediators of protein conformation and turnover in the cell. Cell 1994, 78, 365–372. [Google Scholar] [CrossRef]
- Mosser, D.D.; Martin, L.H. Induced thermotolerance to apoptosis in a human T lymphocyte cell line. J. Cell. Physiol. 1992, 151, 561–570. [Google Scholar] [CrossRef] [PubMed]
- Mailhos, C.; Howard, M.; Latchman, D. Heat shock protects neuronal cells from programmed cell death by apoptosis. Neuroscience 1993, 55, 621–627. [Google Scholar] [CrossRef]
- Jaattela, M.; Wissing, D.; Bauer, P.; Li, G. Major heat shock protein hsp70 protects tumor cells from tumor necrosis factor cytotoxicity. EMBO J. 1992, 11, 3507–3512. [Google Scholar] [CrossRef] [PubMed]
- Simon, M.M.; Reikerstorfer, A.; Schwarz, A.; Krone, C.; A Luger, T.; Jaattela, M.; Schwarz, T. Heat shock protein 70 overexpression affects the response to ultraviolet light in murine fibroblasts. Evidence for increased cell viability and suppression of cytokine release. J. Clin. Investig. 1995, 95, 926–933. [Google Scholar] [CrossRef]
- Samali, A.; Cotter, T.G. Heat Shock Proteins Increase Resistance to Apoptosis. Exp. Cell Res. 1996, 223, 163–170. [Google Scholar] [CrossRef]
- Mosser, D.D.; Caron, A.W.; Bourget, L.; Denis-Larose, C.; Massie, B. Role of the Human Heat Shock Protein hsp70 in Protection against Stress-Induced Apoptosis. Mol. Cell. Biol. 1997, 17, 5317–5327. [Google Scholar] [CrossRef] [PubMed]
- Ahn, J.H.; Ko, Y.G.; Park, W.Y.; Kang, Y.S.; Chung, H.Y.; Seo, J.S. Suppression of ceramide-mediated apoptosis by HSP70. Mol. Cells 1999, 9, 200–206. [Google Scholar] [PubMed]
- Jäättelä, M.; Wissing, D.; Kokholm, K.; Kallunki, T.; Egeblad, M. Hsp70 exerts its anti-apoptotic function downstream of caspase-3-like proteases. EMBO J. 1998, 17, 6124–6134. [Google Scholar] [CrossRef]
- Njemini, R.; Bautmans, I.; Onyema, O.O.; Van Puyvelde, K.; Demanet, C.; Mets, T. Circulating Heat Shock Protein 70 in Health, Aging and Disease. BMC Immunol. 2011, 12, 24. [Google Scholar] [CrossRef]
- Kalpage, H.A.; Bazylianska, V.; Recanati, M.A.; Fite, A.; Liu, J.; Wan, J.; Mantena, N.; Malek, M.H.; Podgorski, I.; Heath, E.I.; et al. Tissue-specific regulation of cytochrome c by post-translational modifications: Respiration, the mitochondrial membrane potential, ROS, and apoptosis. FASEB J. 2019, 33, 1540–1553. [Google Scholar] [CrossRef]
- Bishop, N.A.; Guarente, L. Genetic links between diet and lifespan: Shared mechanisms from yeast to humans. Nat. Rev. Genet. 2007, 8, 835–844. [Google Scholar] [CrossRef] [PubMed]
- Calabrese, V.; Cornelius, C.; Dinkova-Kostova, A.T.; Calabrese, E.J.; Mattson, M.P.; Catani, M.V.; Gasperi, V.; Bisogno, T.; Maccarrone, M.; Depp, C.; et al. Cellular Stress Responses, The Hormesis Paradigm, and Vitagenes: Novel Targets for Therapeutic Intervention in Neurodegenerative Disorders. Antioxid. Redox Signal. 2010, 13, 1763–1811. [Google Scholar] [CrossRef] [PubMed]
- Satoh, A.; Brace, C.S.; Rensing, N.; Cliften, P.; Wozniak, D.F.; Herzog, E.D.; Yamada, K.A.; Imai, S.-I. Sirt1 Extends Life Span and Delays Aging in Mice through the Regulation of Nk2 Homeobox 1 in the DMH and LH. Cell Metab. 2013, 18, 416–430. [Google Scholar] [CrossRef] [PubMed]
- Kumar, R.; Mohan, N.; Upadhyay, A.D.; Singh, A.P.; Sahu, V.; Dwivedi, S.; Dey, A.B.; Dey, S. Identification of serum sirtuins as novel noninvasive protein markers for frailty. Aging Cell 2014, 13, 975–980. [Google Scholar] [CrossRef] [PubMed]
- Yan, P.; Li, Z.; Xiong, J.; Geng, Z.; Wei, W.; Zhang, Y.; Wu, G.; Zhuang, T.; Tian, X.; Liu, Z.; et al. LARP7 ameliorates cellular senescence and aging by allosterically enhancing SIRT1 deacetylase activity. Cell Rep. 2021, 37, 110038. [Google Scholar] [CrossRef] [PubMed]
- Lundberg, A.S.; Hahn, W.C.; Gupta, P.; A Weinberg, R. Genes involved in senescence and immortalization. Curr. Opin. Cell Biol. 2000, 12, 705–709. [Google Scholar] [CrossRef]
- Xirouchaki, C.E.; Jia, Y.; McGrath, M.J.; Greatorex, S.; Tran, M.; Merry, T.L.; Hong, D.; Eramo, M.J.; Broome, S.C.; Woodhead, J.S.T.; et al. Skeletal muscle NOX4 is required for adaptive responses that prevent insulin resistance. Sci. Adv. 2021, 7, eabl4988. [Google Scholar] [CrossRef]
- Nassef, M.Z.; Kopp, S.; Wehland, M.; Melnik, D.; Sahana, J.; Krüger, M.; Corydon, T.J.; Oltmann, H.; Schmitz, B.; Schütte, A.; et al. Real Microgravity Influences the Cytoskeleton and Focal Adhesions in Human Breast Cancer Cells. Int. J. Mol. Sci. 2019, 20, 3156. [Google Scholar] [CrossRef]
- Balzano, F.; Garroni, G.; Cruciani, S.; Bellu, E.; Giudici, S.D.; Oggiano, A.; Capobianco, G.; Dessole, S.; Ventura, C.; Maioli, M. Behavioral Changes in Stem-Cell Potency by HepG2-Exhausted Medium. Cells 2020, 9, 1890. [Google Scholar] [CrossRef]
- Basoli, V.; Santaniello, S.; Cruciani, S.; Ginesu, G.C.; Cossu, M.L.; Delitala, A.P.; Serra, P.A.; Ventura, C.; Maioli, M. Melatonin and Vitamin D Interfere with the Adipogenic Fate of Adipose-Derived Stem Cells. Int. J. Mol. Sci. 2017, 18, 981. [Google Scholar] [CrossRef]
Primer Name | Forward | Reverse |
---|---|---|
Oct-4 | GAGGAGTCCCAGGCAATCAA | CATCGGCCTGTGTATATCCC |
SOX2 | CCGTTCATGTAGGTCTCGGAGCTG | CAACGGCAGCTACAGCTAGATGC |
NANOG | CATGAGTGTGGATCCAGCT | CCTGAATAAGCAGATCCAT |
P19 | GCCTTCGGCTGACTGGCTGG | TCGTCCTCCAGAGTCGCCCG |
P21 (WAF1/CIP) | CAAAGGCCCGCTCTACATCTT | AGGAACCTCCATTCACCCGA |
P53 | CAAGCAATGGATGATTTGATGCT | TGGGTCTTCAGTGAACCATTGT |
BAX | TGCTTCAGGGTTTCATCCAG | GGCGGCAATCATCCTCTG |
Bcl-2 | AGGATTGTGGCCTTCTTTGA | ACAGTTCCACAAAGGCATCC |
HSP70 | CACAGCGACGTAGCAGCTCT | ATGTCGGTGGTGGGCATAGA |
SIRT1 | CATTTCCATGGCGCTGAGG | TGCTGGTGGAACAATTCCTGT |
GAPDH | GAGTCAACGGATTTGGTCGT | GACAAGCTTCCCGTTCTCAG |
P16 | CTCGTGCTGATGCTACTGAGGA | GGTCGGCGCAGTTGGGCTCC |
HSP60 | GGGCATCTGTAACTCTGTCTT | TAAAAGGAAAAGGTGACAAGG |
NOX4 | GATGACTGGAAACCATACAAG | TAAAAGTTTCCACCGAGGACG |
β-Actin | CACCATTGGCAATGAGCGGTTC | AGGTCTTTGCGGATGTCCACGT |
β-Tubulin | CTGGACCGCATCTCTGTGTACT | GCCAAAAGGACCTGAGCGAACA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pala, R.; Cruciani, S.; Manca, A.; Garroni, G.; EL Faqir, M.A.; Lentini, V.; Capobianco, G.; Pantaleo, A.; Maioli, M. Mesenchymal Stem Cell Behavior under Microgravity: From Stress Response to a Premature Senescence. Int. J. Mol. Sci. 2023, 24, 7753. https://doi.org/10.3390/ijms24097753
Pala R, Cruciani S, Manca A, Garroni G, EL Faqir MA, Lentini V, Capobianco G, Pantaleo A, Maioli M. Mesenchymal Stem Cell Behavior under Microgravity: From Stress Response to a Premature Senescence. International Journal of Molecular Sciences. 2023; 24(9):7753. https://doi.org/10.3390/ijms24097753
Chicago/Turabian StylePala, Renzo, Sara Cruciani, Alessia Manca, Giuseppe Garroni, Mohammed Amine EL Faqir, Veronica Lentini, Giampiero Capobianco, Antonella Pantaleo, and Margherita Maioli. 2023. "Mesenchymal Stem Cell Behavior under Microgravity: From Stress Response to a Premature Senescence" International Journal of Molecular Sciences 24, no. 9: 7753. https://doi.org/10.3390/ijms24097753
APA StylePala, R., Cruciani, S., Manca, A., Garroni, G., EL Faqir, M. A., Lentini, V., Capobianco, G., Pantaleo, A., & Maioli, M. (2023). Mesenchymal Stem Cell Behavior under Microgravity: From Stress Response to a Premature Senescence. International Journal of Molecular Sciences, 24(9), 7753. https://doi.org/10.3390/ijms24097753