Proteomic and Metabolic Analysis of Pinus halepensis Mill. Embryonal Masses Induced under Heat Stress
Abstract
1. Introduction
2. Results
2.1. Relative Quantification of Proteins
2.2. Relative Expression of Stress-Related Transcripts
2.3. Quantification Analysis of Sugars and Sugars Alcohols
2.4. Quantification Analysis of Amino Acids
3. Discussion
4. Materials and Methods
4.1. SE Temperature Experiment and Plant Material Collection
4.2. Metabolites, RNA and Protein Extraction
4.2.1. Metabolites Extraction
4.2.2. RNA and Proteins Extraction
4.3. Protein Preparation and LC-MS Analysis
4.3.1. Data-Dependent Acquisition (DIA) and Data-Independent Acquisition (DIA) Experiments
4.3.2. Protein LC-MS Analysis
4.4. Relative Expression of Stress-Related Transcripts
4.5. Quantification of Sugars and Sugars Alcohols
4.6. Quantification of Amino Acids
4.7. Data Analysis
4.7.1. Ion-Library Construction (DDA Information)
4.7.2. Relative Quantification of Proteins (SWATH-MS)
4.7.3. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Trontin, J.; Klimaszewska, K.; Morel, A.; Hargreaves, C.; Lelu-Walter, M.-A. Molecular aspects of conifer zygotic and somatic embryo development: A review of genome-wide approaches and recent insights. In In Vitro Embryogenesis in Higher Plants. Methods in Molecular Biology; Germana, M.A., Lambardi, M., Eds.; Humana Press: New York, NY, USA, 2016; Volume 1359, pp. 167–207. [Google Scholar]
- Sánchez-Salguero, R.; Navarro-Cerrillo, R.M.; Camarero, J.J.; Fernández-Cancio, Á. Selective drought-induced decline of pine species in southeastern Spain. Clim. Chang. 2021, 113, 767–785. [Google Scholar] [CrossRef] [Scilit]
- Klein, T.; Cohen, S.; Yakir, D. Hydraulic adjustments underlying drought resistance of Pinus halepensis. Tree Physiol. 2012, 31, 637–648. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mauri, A.; Leo, M.D.; Rigo, D.D.; Caudullo, G. Pinus halepensis and Pinus brutia in Europe: Distribution, habitat, usage and threats. In European Atlas of Forest Tree Species; San-Miguel-Ayanz, J., de Rigo, D., Caudullo, G., Houston Durrant, T., Mauri, A., Eds.; European Comission: Brussels, Belgium, 2016; pp. 122–123. [Google Scholar]
- Elvira, N.J.; Lloret, F.; Jaime, L.; Margalef-Marrase, J.; Pérez Navarro, M.Á.; Batllori, E. Species climatic niche explains post-fire regeneration of Aleppo pine (Pinus halepensis Mill.) under compounded effects of fire and drought in east Spain. Sci. Total. Environ. 2021, 798, 149308. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hemantaranjan, A.; Nishant Bhanu, A.; Singh, M.; Yadav, D.; Patel, P.; Singh, R.; Katiyar, D. Heat stress responses and thermotolerance. Adv. Plants Agric. Res. 2014, 1, 62–70. [Google Scholar] [CrossRef] [Scilit]
- García-Mendiguren, O.; Montalbán, I.A.; Goicoa, T.; Ugarte, M.D.; Moncaleán, P. Environmental conditions at the initial stages of Pinus radiata somatic embryogenesis affect the production of somatic embryos. Trees Struct. Funct. 2016, 30, 949–958. [Google Scholar] [CrossRef] [Scilit]
- Jia, J.; Zhou, J.; Shi, W.; Cao, X.; Luo, J.; Polle, A.; Luo, Z. Bin Comparative transcriptomic analysis reveals the roles of overlapping heat-/drought-responsive genes in poplars exposed to high temperature and drought. Sci. Rep. 2017, 7, 43215. [Google Scholar] [CrossRef] [Scilit]
- Moncaleán, P.; García-Mendiguren, O.; Novák, O.; Strnad, M.; Goicoa, T.; Ugarte, M.D.; Montalbán, I.A. Temperature and water availability during maturation affect the cytokinins and auxins profile of radiata pine somatic embryos. Front. Plant Sci. 2018, 9, 1898. [Google Scholar] [CrossRef] [Scilit]
- Johnsen, Ø.; Fossdal, C.G.; Nagy, N.; MØlmann, J.; Dæhlen, O.G.; SkrØppa, T. Climatic adaptation in Picea abies progenies is affected by the temperature during zygotic embryogenesis and seed maturation. Plant Cell Environ. 2005, 28, 1090–1102. [Google Scholar] [CrossRef] [Scilit]
- Castander-Olarieta, A.; Pereira, C.; Sales, E.; Meijón, M.; Arrillaga, I.; Cañal, M.J.; Goicoa, T.; Ugarte, M.D.; Moncaleán, P.; Montalbán, I.A. Induction of radiata pine somatic embryogenesis at high temperatures provokes a long-term decrease in DNA methylation/hydroxymethylation and differential expression of stress-related genes. Plants 2020, 9, 1762. [Google Scholar] [CrossRef] [Scilit]
- Pérez-Oliver, M.A.; Haro, J.G.; Pavlović, I.; Novák, O.; Segura, J.; Sales, E.; Arrillaga, I. Priming maritime pine megagametophytes during somatic embryogenesis improved plant adaptation to heat stress. Plants 2021, 10, 446. [Google Scholar] [CrossRef] [Scilit]
- Hargreaves, C.; Reeves, C.; Gough, K.; Montalbán, I.A.; Low, C.; van Ballekom, S.; Dungey, H.S.; Moncaleán, P. Nurse tissue for embryo rescue: Testing new conifer somatic embryogenesis methods in a F1 hybrid pine. Trees Struct. Funct. 2017, 31, 273–283. [Google Scholar] [CrossRef] [Scilit]
- Montalbán, I.A.; Castander-Olarieta, A.; Hargreaves, C.L.; Gough, K.; Reeves, C.B.; van Ballekom, S.; Goicoa, T.; Ugarte, M.D.; Moncaleán, P. Hybrid pine (Pinus attenuata × Pinus radiata) somatic embryogenesis: What do you prefer, mother or nurse? Forests 2021, 12, 45. [Google Scholar] [CrossRef] [Scilit]
- von Arnold, S.; Sabala, I.; Bozhkov, P.; Dyachok, J.; Filonova, L. Developmental pathways of somatic embryogenesis. Plant Cell. Tissue Organ Cult. 2002, 69, 233–249. [Google Scholar] [CrossRef] [Scilit]
- von Arnold, S.; Clapham, D.; Abrahamsson, M. Embryology in conifers. In Advances in Botanical Research; Cánovas, F.M., Ed.; Elsevier: Amsterdam, The Netherlands, 2019; Volume 89, pp. 157–184. [Google Scholar]
- Park, Y.-S. Implementation of conifer somatic embryogenesis in clonal forestry: Technical requirements and deployment considerations. Ann. For. Sci. 2002, 59, 651–656. [Google Scholar] [CrossRef] [Scilit]
- Montalbán, I.A.; De Diego, N.; Moncaleán, P. Enhancing initiation and proliferation in radiata pine (Pinus radiata D. Don) somatic embryogenesis through seed family screening, zygotic embryo staging and media adjustments. Acta Physiol. Plant. 2011, 34, 451–460. [Google Scholar] [CrossRef] [Scilit]
- Eliášová, K.; Vondráková, Z.; Malbeck, J.; Trávníčková, A.; Pešek, B.; Vágner, M.; Cvikrová, M. Histological and biochemical response of Norway spruce somatic embryos to UV-B irradiation. Trees Struct. Funct. 2017, 31, 1279–1293. [Google Scholar] [CrossRef] [Scilit]
- do Nascimento, A.M.M.; Polesi, L.G.; Back, F.P.; Steiner, N.; Guerra, M.P.; Castander-Olarieta, A.; Moncaleán, P.; Montalbán, I.A. The chemical environment at maturation stage in Pinus spp. somatic embryogenesis: Implications in the polyamine profile of somatic embryos and morphological characteristics of the developed plantlets. Front. Plant Sci. 2021, 12, 771464. [Google Scholar] [CrossRef] [Scilit]
- Bruce, T.J.A.; Matthes, M.C.; Napier, J.A.; Pickett, J.A. Stressful “memories” of plants: Evidence and possible mechanisms. Plant Sci. 2007, 173, 603–608. [Google Scholar] [CrossRef] [Scilit]
- Crisp, P.A.; Ganguly, D.; Eichten, S.R.; Borevitz, J.O.; Pogson, B.J. Reconsidering plant memory: Intersections between stress recovery, RNA turnover, and epigenetics. Sci. Adv. 2016, 2, e1501340. [Google Scholar] [CrossRef] [Scilit]
- Auler, P.A.; do Amaral, M.N.; Braga, E.J.B.; Maserti, B. Drought stress memory in rice guard cells: Proteome changes and genomic stability of DNA. Plant Physiol. Biochem. 2021, 169, 49–62. [Google Scholar] [CrossRef] [Scilit]
- Montalbán, I.A.; Setién-Olarra, A.; Hargreaves, C.L.; Moncaleán, P. Somatic embryogenesis in Pinus halepensis Mill.: An important ecological species from the Mediterranean forest. Trees 2013, 27, 1339–1351. [Google Scholar] [CrossRef] [Scilit]
- Pereira, C.; Montalbán, I.A.; Goicoa, T.; Ugarte, M.D.; Correia, S.; Canhoto, J.M.; Moncaleán, P. The effect of changing temperature and agar concentration at proliferation stage in the final success of Aleppo pine somatic embryogenesis. For. Syst. 2017, 26, 3–6. [Google Scholar] [CrossRef] [Scilit]
- Pereira, C.; Montalbán, I.A.; García-Mendiguren, O.; Goicoa, T.; Ugarte, M.D.; Correia, S.; Canhoto, J.M.; Moncaleán, P. Pinus halepensis somatic embryogenesis is affected by the physical and chemical conditions at the initial stages of the process. J. For. Res. 2016, 21, 143–150. [Google Scholar] [CrossRef] [Scilit]
- Pereira, C.; Castander-Olarieta, A.; Montalbán, I.A.; Pěnčík, A.; Petřík, I.; Pavlović, I.; Oliveira, E.D.M.; de Freitas Fraga, H.P.; Guerra, M.P.; Novák, O.; et al. Embryonal masses induced at high temperatures in Aleppo pine: Cytokinin profile and cytological characterization. Forests 2020, 11, 807. [Google Scholar] [CrossRef] [Scilit]
- Pereira, C.; Castander-Olarieta, A.; Sales, E.; Montalbán, I.A.; Canhoto, J.; Moncaleán, P. Heat stress in Pinus halepensis somatic embryogenesis induction: Effect in DNA methylation and differential expression of stress-related genes. Plants 2021, 10, 2333. [Google Scholar] [CrossRef] [Scilit]
- Zang, Q.L.; Zhang, Y.; Han, S.Y.; Li, W.F.; Qi, L.W. Transcriptional and post-transcriptional regulation of the miR171-LaSCL6 module during somatic embryogenesis in Larix kaempferi. Trees Struct. Funct. 2021, 35, 145–154. [Google Scholar] [CrossRef] [Scilit]
- Mazzucotelli, E.; Mastrangelo, A.M.; Crosatti, C.; Guerra, D.; Stanca, A.M.; Cattivelli, L. Abiotic stress response in plants: When post-transcriptional and post-translational regulations control transcription. Plant Sci. 2008, 174, 420–431. [Google Scholar] [CrossRef] [Scilit]
- Castander-Olarieta, A.; Pereira, C.; Montalbán, I.; Mendes, V.M.; Correia, S.; Suárez-Álvarez, S.; Manadas, B.; Canhoto, J.; Moncaleán, P. Proteome-wide analysis of heat-Stress in Pinus radiata somatic embryos reveals a combined response of sugar metabolism and translational regulation mechanisms. Front. Plant Sci. 2021, 12, 631239. [Google Scholar] [CrossRef] [Scilit]
- Juarez-Escobar, J.; Bojórquez-Velázquez, E.; Elizalde-Contreras, J.M.; Guerrero-Analco, J.A.; Loyola-Vargas, V.M.; Mata-Rosas, M.; Ruiz-May, E. Current proteomic and metabolomic knowledge of zygotic and somatic embryogenesis in plants. Int. J. Mol. Sci. 2021, 22, 11807. [Google Scholar] [CrossRef] [Scilit]
- Kotak, S.; Larkindale, J.; Lee, U.; von Koskull-Döring, P.; Vierling, E.; Scharf, K. Complexity of the heat stress response in plants. Curr. Opin. Plant Biol. 2007, 10, 310–316. [Google Scholar] [CrossRef] [Scilit]
- Yadav, R.; Saini, R.; Adhikary, A.; Kumar, S. Unravelling cross priming induced heat stress, combinatorial heat and drought stress response in contrasting chickpea varieties. Plant Physiol. Biochem. 2022, 180, 91–105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arbona, V.; Manzi, M.; de Ollas, C.; Gómez-Cadenas, A. Metabolomics as a tool to investigate abiotic stress tolerance in plants. Int. J. Mol. Sci. 2013, 14, 4885–4911. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nakabayashi, R.; Saito, K. Integrated metabolomics for abiotic stress responses in plants. Curr. Opin. Plant Biol. 2015, 24, 10–16. [Google Scholar] [CrossRef] [Scilit]
- Morel, A.; Teyssier, C.; Trontin, J.F.; Eliášová, K.; Pešek, B.; Beaufour, M.; Morabito, D.; Boizot, N.; Le Metté, C.; Belal-Bessai, L.; et al. Early molecular events involved in Pinus pinaster Ait. somatic embryo development under reduced water availability: Transcriptomic and proteomic analyses. Physiol. Plant. 2014, 152, 184–201. [Google Scholar] [CrossRef] [Scilit]
- Escandón, M.; Valledor, L.; Pascual, J.; Pinto, G.; Cañal, M.J.; Meijón, M. System-wide analysis of short-term response to high temperature in Pinus radiata. J. Exp. Bot. 2017, 68, 3629–3641. [Google Scholar] [CrossRef] [Scilit]
- Castander-Olarieta, A.; Pereira, C.; Mendes, V.M.; Correia, S.; Manadas, B.; Canhoto, J.; Montalbán, I.A.; Moncaleán, P. Thermopriming-associated proteome and sugar content responses in Pinus radiata embryogenic tissue. Plant Sci. 2022, 321, 111327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pinheiro, C.; Guerra-Guimarães, L.; David, T.S.; Vieira, A. Proteomics: State of the art to study Mediterranean woody species under stress. Environ. Exp. Bot. 2014, 103, 117–127. [Google Scholar] [CrossRef] [Scilit]
- Escandón, M.; Valledor, L.; Pascual, J.; Pinto, G.; Cañal, M.J.; Meijón, M.; Borges, A.A.; Jiménez-Arias, D.; Expósito-Rodríguez, M.; Sandalio, L.M.; et al. Epigenetic regulation and gene markers as signals of early somatic embryogenesis. Front. Plant Sci. 2017, 10, 1–26. [Google Scholar]
- Castander-Olarieta, A.; Montalbán, I.A.; De Medeiros Oliveira, E.; Dell’aversana, E.; D’amelia, L.; Carillo, P.; Steiner, N.; Fraga, H.P.D.F.; Guerra, M.P.; Goicoa, T.; et al. Effect of thermal stress on tissue ultrastructure and metabolite profiles during initiation of radiata pine somatic embryogenesis. Front. Plant Sci. 2019, 9, 2004. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghazghazi, H.; Riahi, L.; Yangui, I.; Messaoud, C.; Rzigui, T.; Nasr, Z. Effect of drought stress on physio-biochemical traits and secondary metabolites production in the woody species Pinus halepensis Mill. at a juvenile development stage. J. Sustain. For. 2022, 41, 878–894. [Google Scholar] [CrossRef] [Scilit]
- Qu, A.; Ding, Y.; Jiang, Q.; Zhu, C. Molecular mechanisms of the plant heat stress response. Biochem. Biophys. Res. Commun. 2013, 432, 203–207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perrella, G.; Bäurle, I.; van Zanten, M. Epigenetic regulation of thermomorphogenesis and heat stress tolerance. New Phytol. 2022, 234, 1144–1160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hasanuzzaman, M.; Nahar, K.; Alam, M.M.; Roychowdhury, R.; Fujita, M. Physiological, biochemical, and molecular mechanisms of heat stress tolerance in plants. Int. J. Mol. Sci. 2013, 14, 9643–9684. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haider, S.; Raza, A.; Iqbal, J.; Shaukat, M.; Mahmood, T. Analyzing the regulatory role of heat shock transcription factors in plant heat stress tolerance: A brief appraisal. Mol. Biol. Rep. 2022, 49, 5771–5785. [Google Scholar] [CrossRef] [Scilit]
- Kuo, W.Y.; Huang, C.H.; Liu, A.C.; Cheng, C.P.; Li, S.H.; Chang, W.C.; Weiss, C.; Azem, A.; Jinn, T.L. Chaperonin 20 mediates iron superoxide dismutase (FeSOD) activity independent of its co-chaperonin role in Arabidopsis chloroplasts. New Phytol. 2012, 197, 99–110. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.-F.; Jiang, T.; Wu, Z.; Du, S.-Y.; Yu, Y.-T.; Jiang, S.-C.; Lu, K.; Feng, X.-J.; Wang, X.-F.; Zhang, D.-P. Cochaperonin CPN20 negatively regulates abscisic acid signaling in Arabidopsis. Plant Mol. Biol. 2013, 83, 205–218. [Google Scholar] [CrossRef] [Scilit]
- Marondedze, C.; Thomas, L.; Gehring, C.; Lilley, K.S. Changes in the Arabidopsis RNA-binding proteome reveal novel stress response mechanisms. BMC Plant Biol. 2019, 19, 139. [Google Scholar] [CrossRef] [Scilit]
- Weber, C.; Nover, L.; Fauth, M. Plant stress granules and mRNA processing bodies are distinct from heat stress granules. Plant J. 2008, 56, 517–530. [Google Scholar] [CrossRef] [Scilit]
- Wu, J.; Wang, J.; Hui, W.; Zhao, F.; Wang, P.; Su, C.; Gong, W. Physiology of plant responses to water stress and related genes: A review. Forests 2022, 13, 324. [Google Scholar] [CrossRef] [Scilit]
- Van Damme, E.J.M.; Barre, A.; Rougé, P.; Peumans, W.J. Cytoplasmic/nuclear plant lectins: A new story. Trends Plant Sci. 2004, 9, 484–489. [Google Scholar] [CrossRef] [Scilit]
- Coninck, T.D.; Van Damme, E.J.M. Review: The multiple roles of plant lectins. Plant Sci. 2021, 313, 111096. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wheeler, M.C.G.; Arias, C.L.; Tronconi, M.A.; Maurino, V.G.; Andreo, C.S.; Drincovich, M.F. Arabidopsis thaliana NADP-malic enzyme isoforms: High degree of identity but clearly distinct properties. Plant Mol. Biol. 2008, 67, 231–242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wheeler, M.C.G.; Arias, C.L.; Maurino, V.G.; Andreo, C.S.; Drincovich, M.F. Identification of domains involved in the allosteric regulation of cytosolic Arabidopsis thaliana NADP-malic enzymes. FEBS J. 2009, 276, 5665–5677. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Q.; Wang, B.; Ding, H.; Zhang, J.; Li, S. Review: The role of NADP-malic enzyme in plants under stress. Plant Sci. 2019, 281, 206–212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Voll, L.M.; Zell, M.B.; Engelsdorf, T.; Saur, A.; Wheeler, M.G.; Maria, F.; Weber, A.P.M.; Maurino, V.G. Loss of cytosolic NADP-malic enzyme 2 in Arabidopsis thaliana is associated with enhanced susceptibility to Colletotrichum higginsianum. New Phytol. 2012, 195, 189–202. [Google Scholar] [CrossRef] [Scilit]
- Wolyn, D.J.; Jelenkovic, G. Nucleotide sequence of an alcohol dehydrogenase gene in octoploid strawberry (Fragaria × Ananassa Duch.). Plant Mol. Biol. 1990, 14, 855–857. [Google Scholar] [CrossRef] [Scilit]
- Chevalier, F.; Rossignol, M. Proteomic analysis of Arabidopsis thaliana ecotypes with contrasted root architecture in response to phosphate deficiency. J. Plant Physiol. 2011, 168, 1885–1890. [Google Scholar] [CrossRef] [Scilit]
- Tesniere, C.; Torregrosa, L.; Pradal, M.; Souquet, J.-M.; Gilles, C.; dos Santos, K.; Chatelet, P.; Gunata, Z. Effects of genetic manipulation of alcohol dehydrogenase levels on the response to stress and the synthesis of secondary metabolites in grapevine leaves. J. Exp. Bot. 2006, 57, 91–99. [Google Scholar] [CrossRef] [Scilit]
- Thomas, S.G.; Huang, S.; Li, S.; Staiger, C.J.; Franklin-Tong, V.E. Actin depolymerization is sufficient to induce programmed cell death in self-incompatible pollen. J. Cell Biol. 2006, 174, 221–229. [Google Scholar] [CrossRef] [Scilit]
- Schwarzerová, K.; Vondráková, Z.; Fischer, L.; Boříková, P.; Bellinvia, E.; Eliášová, K.; Havelková, L.; Fišerová, J.; Vágner, M.; Opatrný, Z. The role of actin isoforms in somatic embryogenesis in Norway spruce. BMC Plant Biol. 2010, 10, 89. [Google Scholar] [CrossRef] [Scilit]
- Neilson, K.A.; Gammulla, C.G.; Mirzaei, M.; Imin, N.; Haynes, P.A. Proteomic analysis of temperature stress in plants. Proteomics 2010, 10, 828–845. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schlaen, R.G.; Mancini, E.; Sanchez, S.E.; Perez-Santángelo, S.; Rugnone, M.L.; Simpson, C.G.; Brown, J.W.S.; Zhang, X.; Chernomoretz, A.; Yanovsky, M.J. The spliceosome assembly factor GEMIN2 attenuates the effects of temperature on alternative splicing and circadian rhythms. Proc. Natl. Acad. Sci. USA 2015, 112, 9382–9387. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, W.; Xu, J.; Fu, W.; Wang, X.; Lei, C.; Chen, Y. Evidence of stress imprinting with population-level differences in two moss species. Ecol. Evol. 2019, 9, 6329–6341. [Google Scholar] [CrossRef] [Scilit]
- Correia, S.; Vinhas, R.; Manadas, B.; Lourenço, A.S.; Veríssimo, P.; Canhoto, J.M. Comparative proteomic analysis of auxin-induced embryogenic and nonembryogenic tissues of the solanaceous tree Cyphomandra betacea (tamarillo). J. Proteome Res. 2012, 11, 1666–1675. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ludvigsen, M.; Honoré, B. Transcriptomics and proteomics: Integration? In Encyclopedia of Life Sciences; Wiley: New York, NY, USA, 2018; pp. 1–7. [Google Scholar]
- Lamelas, L.; Valledor, L.; Escandón, M.; Pinto, G.; Cañal, M.J.; Meijón, M. Integrative analysis of the nuclear proteome in Pinus radiata reveals thermopriming coupled to epigenetic regulation. J. Exp. Bot. 2020, 71, 2040–2057. [Google Scholar] [CrossRef] [Scilit]
- Taïbi, K.; del Campo, A.D.; Vilagrosa, A.; Bellés, J.M.; López-Gresa, M.P.; Pla, D.; Calvete, J.J.; López-Nicolás, J.M.; Mulet, J.M. Drought tolerance in Pinus halepensis seed sources as identified by distinctive physiological and molecular markers. Front. Plant Sci. 2017, 8, 1202. [Google Scholar] [CrossRef] [Scilit]
- Quan, R.; Shang, M.; Zhang, H.; Zhao, Y.; Zhang, J. Engineering of enhanced glycine betaine synthesis improves drought tolerance in maize. Plant Biotechnol. J. 2004, 2, 477–486. [Google Scholar] [CrossRef] [Scilit]
- Matysiak, K.; Kierzek, R.; Siatkowski, I.; Kowalska, J.; Krawczyk, R.; Miziniak, W. Effect of exogenous application of amino acids L-Arginine and glycine on maize under temperature stress. Agronomy 2020, 10, 769. [Google Scholar] [CrossRef] [Scilit]
- Gupta, P.K.; Durzan, D.J. Plantlet regeneration via somatic embryogenesis from subcultured callus of mature embryos of Picea abies (Norway spruce). Vitr. Cell. Dev. Biol. 1986, 22, 685–688. [Google Scholar] [CrossRef] [Scilit]
- Walter, C.; Find, J.I.; Grace, L.J. Somatic embryogenesis and genetic transformation in Pinus radiata. In Protocol for Somatic Embryogenesis in Woody Plants; Jain, S.M., Gupta, P.K., Eds.; Springer: Dordrecht, The Netherlands, 2005; Volume 77, pp. 11–24. [Google Scholar]
- Valledor, L.; Escandón, M.; Meijón, M.; Nukarinen, E.; Cañal, M.J.; Weckwerth, W. A universal protocol for the combined isolation of metabolites, DNA, long RNAs, small RNAs, and proteins from plants and microorganisms. Plant J. 2014, 79, 173–180. [Google Scholar] [CrossRef] [Scilit]
- Anjo, S.I.; Santa, C.; Manadas, B. Short GeLC-SWATH: A fast and reliable quantitative approach for proteomic screenings. Proteomics 2015, 15, 757–762. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pang, Z.; Chong, J.; Li, S.; Xia, J. Metaboanalystr 3.0: Toward an optimized workflow for global metabolomics. Metabolites 2020, 10, 186. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Fold Change | Kruskal–Wallis | PLS-DA | |||||
|---|---|---|---|---|---|---|---|
| Protein | Uniprot Accession | Species | Cond2/Cond1 | Cond3/Cond1 | Cond4/Cond1 | p-Value | VIP |
| NADP-dependent malic enzyme 3 | Q9XGZ0 | Arabidopsis thaliana | 2.25 | 0.96 | 0.44 | 0.006 | 1.26 |
| 20 kDa chaperonin, chloroplastic | O65282 | Arabidopsis thaliana | 0.08 | 0.16 | 0.13 | 0.018 | 2.08 |
| Alcohol dehydrogenase | P17648 | Fragaria ananassa | 0.79 | 0.34 | 0.21 | 0.041 | 2.00 |
| Polyadenylate-binding protein RBP47 | Q9LEB3 | Nicotiana plumbaginifolia | 0.47 | 0.49 | 0.67 | 0.015 | 1.45 |
| Aconitate hydratase, cytoplasmic | P49608 | Cucurbita maxima | 0.39 | 0.26 | 0.51 | 0.006 | 2.30 |
| Probable fructokinase-7 | Q9FLH8 | Arabidopsis thaliana | 0.30 | 0.20 | 0.23 | 0.024 | 2.74 |
| Agglutinin | P06750 | Ricinus communis | 0.23 | 0.22 | 0.18 | 0.011 | 2.80 |
| 25.3 kDa vesicle transport protein | Q94AU2 | Arabidopsis thaliana | 0.44 | 0.20 | 0.20 | 0.036 | 2.59 |
| Protein kinase G11A | Q0DCT8 | Oryza sativa subsp. japonica | 0.38 | 0.17 | 0.15 | 0.014 | 3.05 |
| Molybdenum cofactor sulfurase | Q8LGM7 | Solanum lycopersicum | 0.16 | 0.11 | 0.13 | 0.016 | 2.65 |
| Chaperonin CPN60, mitochondrial | P35480 | Brassica napus | 2.84 | 2.13 | 2.01 | 0.025 | 1.08 |
| Pyruvate dehydrogenase E1 component subunit beta-1, mitochondrial | Q6Z1G7 | Oryza sativa subsp. japonica | 1.21 | 1.18 | 1.28 | 0.034 | 2.47 |
| Chalcone synthase | P30079 | Pinus sylvestris | 2.02 | 1.60 | 3.19 | 0.031 | 1.95 |
| Glutamyl-tRNA(Gln) amidotransferase subunit B, chloroplastic/mitochondrial | Q2R2Z0 | Oryza sativa subsp. japonica | 1.18 | 1.64 | 1.79 | 0.036 | 2.14 |
| Dynamin-related protein 12A | Q39821 | Glycine max | 2.55 | 3.92 | 3.58 | 0.023 | 2.02 |
| Citrate synthase, mitochondrial | O80433 | Daucus carota | 1.12 | 1.55 | 2.39 | 0.0040 | 3.08 |
| 6-phosphogluconate dehydrogenase, decarboxylating 1 | Q9LI00 | Oryza sativa subsp. japonica | 1.00 | 1.17 | 1.28 | 0.026 | 2.71 |
| Carbamoyl-phosphate synthase large chain, chloroplastic | B9EXM2 | Oryza sativa subsp. japonica | 1.02 | 1.18 | 1.29 | 0.042 | 2.57 |
| Pyruvate dehydrogenase E1 component subunit beta-4, chloroplastic | Q10G39 | Oryza sativa subsp. japonica | 0.80 | 1.48 | 1.63 | 0.025 | 2.13 |
| 3-isopropylmalate dehydrogenase, chloroplastic | P29696 | Solanum tuberosum | 0.82 | 1.32 | 1.46 | 0.038 | 2.35 |
| Trifunctional UDP-glucose 4.6-dehydratase/UDP-4-keto-6-deoxy-D-glucose 3.5-epimerase/UDP-4-keto-L-rhamnose-reductase RHM1 | Q9SYM5 | Arabidopsis thaliana | 0.68 | 1.49 | 1.60 | 0.009 | 2.39 |
| NADPH--cytochrome P450 reductase 1 | Q9SB48 | Arabidopsis thaliana | 1.07 | 1.58 | 1.34 | 0.019 | 1.79 |
| Actin-depolymerizing factor 10 | Q9LQ81 | Arabidopsis thaliana | 1.24 | 1.53 | 1.56 | 0.017 | 3.03 |
| Histone H2A.2.2 | P02277 | Triticum aestivum | 2.34 | 4.10 | 4.50 | 0.023 | 2.53 |
| 40S ribosomal protein S15a-1 | P42798 | Arabidopsis thaliana | 0.59 | 1.26 | 1.26 | 0.018 | 1.62 |
| 60S ribosomal protein L18-3 | Q940B0 | Arabidopsis thaliana | 0.96 | 1.35 | 1.25 | 0.028 | 2.08 |
| Histone H4 variant TH091 | P62786 | Triticum aestivum | 0.78 | 1.50 | 1.50 | 0.023 | 2.15 |
| Sugars (µmol g−1 FW) | Cond1 23 °C | Cond2 40 °C (4 h) | Cond3 50 °C (30 min) | Cond4 60 °C (5 min) |
|---|---|---|---|---|
| Sucrose | 5.39 ± 0.75 a | 3.35 ± 0.94 ab | 2.26 ± 0.53 b | 2.77 ± 0.55 ab |
| Glucose | 40.90 ± 1.86 a | 40.81 ± 4.29 a | 32.24 ± 5.68 a | 35.28 ± 2.71 a |
| Fructose | 24.48 ± 1.11 a | 29.53 ± 2.60 a | 21.21 ± 4.52 a | 21.57 ± 1.69 a |
| Mannitol | 0.18 ± 0.06 a | 0.32 ± 0.10 a | 0.34 ± 0.06 a | 0.41 ± 0.14 a |
| Sorbitol | 0.14 ± 0.04 a | 0.16 ± 0.06 a | 0.13 ± 0.04 a | 0.13 ± 0.03 a |
| Amino Acids (µmol g−1 FW) | Cond1 23 °C | Cond2 40 °C (4 h) | Cond3 50 °C (30 min) | Cond4 60 °C (5 min) |
|---|---|---|---|---|
| Aspartic acid | 0.135 ± 0.004 a | 0.126 ± 0.019 a | 0.109 ± 0.026 a | 0.137 ± 0.019 a |
| Glutamic acid | 0.428 ± 0.011 a | 0.465 ± 0.061 a | 0.375 ± 0.073 a | 0.445 ± 0.043 a |
| Asparagine | 0.725 ± 0.111 a | 0.994 ± 0.038 a | 0.760 ± 0.116 a | 0.849 ± 0.094 a |
| Serine | 0.315 ± 0.023 a | 0.288 ± 0.029 a | 0.253 ± 0.035 a | 0.289 ± 0.027 a |
| Glutamine | 0.449 ± 0.032 b | 0.734 ± 0.102 a | 0.430 ± 0.009 b | 0.564 ± 0.076 ab |
| Histidine | 0.057 ± 0.006 a | 0.069 ± 0.015 a | 0.059 ± 0.009 a | 0.053 ± 0.005 a |
| Glycine | 0.331 ± 0.027 a | 0.256 ± 0.023 ab | 0.230 ± 0.020 b | 0.292 ± 0.019 ab |
| Threonine | 0.102 ± 0.009 a | 0.110 ± 0.012 a | 0.086 ± 0.012 a | 0.098 ± 0.011 a |
| Arginine | 0.266 ± 0.036 a | 0.349 ± 0.078 a | 0.353 ± 0.062 a | 0.356 ± 0.105 a |
| Alanine | 0.891 ± 0.029 a | 0.851 ± 0.002 a | 0.824 ± 0.028 a | 0.867 ± 0.011 a |
| Tyrosine | 0.055 ± 0.004 a | 0.063 ± 0.009 a | 0.052 ± 0.005 a | 0.056 ± 0.005 a |
| Cysteine | 0.369 ± 0.028 a | 0.277 ± 0.028 ab | 0.254 ± 0.023 b | 0.322 ± 0.017 ab |
| Valine | 0.159 ± 0.012 a | 0.157 ± 0.019 a | 0.136 ± 0.018 a | 0.154 ± 0.020 a |
| Methionine | 0.020 ± 0.001 a | 0.021 ± 0.001 a | 0.019 ± 0.001 a | 0.020 ± 0.001 a |
| Tryptophan | 0.068 ± 0.004 a | 0.068 ± 0.009 a | 0.061 ± 0.006 a | 0.061 ± 0.009 a |
| Phenylalanine | 0.071 ± 0.004 a | 0.068 ± 0.007 a | 0.071 ± 0.008 a | 0.068 ± 0.007 a |
| Isoleucine | 0.082 ± 0.006 a | 0.090 ± 0.012 a | 0.079 ± 0.012 a | 0.080 ± 0.011a |
| Leucine | 0.063 ± 0.006 a | 0.072 ± 0.015 a | 0.067 ± 0.008 a | 0.061 ± 0.006 a |
| Lysine | 0.092 ± 0.006 a | 0.113 ± 0.025 a | 0.085 ± 0.013 a | 0.098 ± 0.010 a |
| Proline | 0.105 ± 0.018 a | 0.141 ± 0.036 a | 0.104 ± 0.032 a | 0.098 ± 0.032 a |
| Name | Forward (5′ → 3′) | Reverse (5′ → 3′) | Amplification Length | Tm (°C) |
|---|---|---|---|---|
| ACTIN (ACT) | CACTGCACTTGCTCCCAGTA | AACCTCCGATCCAAACACTG | 130 | 56 |
| α-TUBULIN | ATCTGGAGCCGATGTCA | TGATAAGCTGTTAGGATGGAA | 75 | 55 |
| PYRUVATE DEHYDROGENASE E1 COMPONENT SUBUNIT BETA-4 | TGCGCATGTACCAGGATTGA | AACTTCCGCAGAAACAGGGA | 151 | 57 |
| CHAPERONIN CPN60 (CPN60) | CAAACAGGTTGCTAACCGCC | TTGCATTCATTCCAGCAGCG | 128 | 57 |
| NADPH-CYTOCHROME P450 REDUCTASE 1 (ATR1) | GAGCCTACTGACAATGCTGCC | GGCGATTACCAAGAGCAAACAC | 109 | 58 |
| RHM1 * | TATCGCTAGTGCTGACTTGGT | CCGAAGGAATTGTCGACGTC | 99 | 56 |
| PYRUVATE DEHYDROGEN-ASE E1 COMPONENT SUBU-NIT BETA-4 | CATAAGGAGCGAGAACCCCG | CGCGAGTATGTGAGGATGGT | 150 | 57 |
| 6-PHOSPHOGLUCONATE DEHYDROGENASE, DECARBOXYLATING 1 (G6PGH1) | ATGGGAGTTTCGGGTGGAGA | AAGCAACACACGGTCCACTAT | 142 | 58 |
| 20 KDA CHAPERONIN (CPN20) | AACAGCTGGAGGGTTGTTGTT | CCTTCCTCGTCTAGGGAACC | 96 | 57 |
| PROBABLE FRUCTOKINASE-7 | CTGACCGGTGGTGATGATCC | TCTCCTGCACCGGTTGTATC | 179 | 57 |
| CITRATE SYNTHASE (PDHB) | TGGACATGGTGTTCTGCGTAA | ACCCCACTATGGGCATCAAC | 186 | 57 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pereira, C.; Castander-Olarieta, A.; Montalbán, I.A.; Mendes, V.M.; Correia, S.; Pedrosa, A.; Manadas, B.; Moncaleán, P.; Canhoto, J. Proteomic and Metabolic Analysis of Pinus halepensis Mill. Embryonal Masses Induced under Heat Stress. Int. J. Mol. Sci. 2023, 24, 7211. https://doi.org/10.3390/ijms24087211
Pereira C, Castander-Olarieta A, Montalbán IA, Mendes VM, Correia S, Pedrosa A, Manadas B, Moncaleán P, Canhoto J. Proteomic and Metabolic Analysis of Pinus halepensis Mill. Embryonal Masses Induced under Heat Stress. International Journal of Molecular Sciences. 2023; 24(8):7211. https://doi.org/10.3390/ijms24087211
Chicago/Turabian StylePereira, Cátia, Ander Castander-Olarieta, Itziar A. Montalbán, Vera M. Mendes, Sandra Correia, Ana Pedrosa, Bruno Manadas, Paloma Moncaleán, and Jorge Canhoto. 2023. "Proteomic and Metabolic Analysis of Pinus halepensis Mill. Embryonal Masses Induced under Heat Stress" International Journal of Molecular Sciences 24, no. 8: 7211. https://doi.org/10.3390/ijms24087211
APA StylePereira, C., Castander-Olarieta, A., Montalbán, I. A., Mendes, V. M., Correia, S., Pedrosa, A., Manadas, B., Moncaleán, P., & Canhoto, J. (2023). Proteomic and Metabolic Analysis of Pinus halepensis Mill. Embryonal Masses Induced under Heat Stress. International Journal of Molecular Sciences, 24(8), 7211. https://doi.org/10.3390/ijms24087211

