Function Analysis of Cholesterol 7-Desaturase in Ovarian Maturation and Molting in Macrobrachium nipponense: Providing Evidence for Reproductive Molting Progress
Abstract
1. Introduction
2. Results
2.1. Full-Length Sequence Analysis of Mn-CH7D
2.2. Similarity Comparison and Phylogenetic Analysis
2.3. Tissue-Specific Gene Expression of Mn-CH7D
2.4. Localization of Mn-CH7D at Different Stages of Ovarian Development
2.5. Functional Analysis of Mn-CH7D
2.5.1. Interference Efficiency
2.5.2. Effect of Mn-CH7D Knockdown on Ovarian Development of M. nipponense
2.5.3. Effect of Mn-CH7D Knockdown on Gonadal Development Index of M. nipponense
2.5.4. Effect of Mn-CH7D Knockdown on Molting Frequency of M. nipponense
2.5.5. Effect of Mn-CH7D Knockdown on Ecdysis Hormone Content of M. nipponense
2.6. Tissue Section
3. Discussion
4. Materials and Methods
4.1. Experimental Prawns and Breeding Conditions
4.2. Sample Collection
4.3. Gene Cloning and Sequence Analysis of Cholesterol 7-Desaturase
4.4. In Situ Hybridization
4.5. RNAi Experiment
4.5.1. Interference Efficiency Detection
4.5.2. Ovarian Development and GONAD Somatic Index
4.5.3. Molting Frequency and Ecdysis Hormone Content
4.6. Tissue Section
4.7. Data Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhu, J.; Fu, H.; Qiao, H.; Jin, S.; Zhang, W.; Jiang, S.; Gong, Y.; Xiong, Y. Expression and functional analysis of cathepsin L1 in ovarian development of the oriental river prawn, Macrobrachium nipponense. Aquac. Rep. 2021, 20, 100724. [Google Scholar] [CrossRef] [Scilit]
- Jin, S.; Zhang, W.; Xiong, Y.; Fu, H. Recent progress of male sexual differentiation and development in the oriental river prawn (Macrobrachium nipponense): A review. Rev. Aquac. 2022, 15, 305–317. [Google Scholar] [CrossRef] [Scilit]
- Li, F.; Qiao, H.; Fu, H.; Sun, S.; Zhang, W.; Jiang, S.; Gong, Y.; Xiong, Y. Identification and characterization of opsin gene and its role in ovarian maturation in the oriental river prawn Macrobrachium nipponense. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2018, 218, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Z.; Fu, H.; Jin, S.; Qiao, H.; Zhang, W.; Jiang, S.; Xiong, Y.; Gong, Y.; Hu, Y.; Gu, X.; et al. Function analysis and molecular characterization of cyclin A in ovary development of oriental river prawn, Macrobrachium nipponense. Gene 2021, 788, 145583. [Google Scholar] [CrossRef] [Scilit]
- Qiao, H.; Fu, H.; Xiong, Y.; Jiang, S.; Zhang, W.; Sun, S.; Jin, S.; Gong, Y.; Wang, Y.; Shan, D.; et al. Molecular insights into reproduction regulation of female Oriental River prawns Macrobrachium nipponense through comparative transcriptomic analysis. Sci. Rep. 2017, 7, 12161. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Yang, H.; Gao, X.; Zhang, H.; Chen, N.; Miao, Z.; Liu, X.; Zhang, X. The pathogenicity characterization of non-O1 Vibrio cholerae and its activation on immune system in freshwater shrimp Macrobrachium nipponense. Fish Shellfish Immunol. 2019, 87, 507–514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jin, S.; Hu, Y.; Fu, H.; Sun, S.; Jiang, S.; Xiong, Y.; Qiao, H.; Zhang, W.; Gong, Y.; Wu, Y. Analysis of testis metabolome and transcriptome from the oriental river prawn (Macrobrachium nipponense) in response to different temperatures and illumination times. Comp. Biochem. Physiol. Part D Genom. Proteom. 2020, 34, 100662. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qiao, H.; Xiong, Y.; Zhang, W.; Fu, H.; Jiang, S.; Sun, S.; Bai, H.; Jin, S.; Gong, Y. Characterization, expression, and function analysis of gonad-inhibiting hormone in Oriental River prawn, Macrobrachium nipponense and its induced expression by temperature. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2015, 185, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Qiao, H.; Xiong, Y.; Jiang, S.; Zhang, W.; Xu, L.; Jin, S.; Gong, Y.; Wu, Y.; Fu, H. Three neuroparsin genes from oriental river prawn, Macrobrachium nipponense, involved in ovary maturation. 3 Biotech 2020, 10, 537. [Google Scholar] [CrossRef] [Scilit]
- Qi, H.; Cao, H.; Zhao, Y.; Cao, Y.; Jin, Q.; Wang, Y.; Zhang, K.; Deng, D. Cloning and functional analysis of the molting gene CYP302A1 of Daphnia sinensis. Front. Zool. 2023, 20, 2. [Google Scholar] [CrossRef] [Scilit]
- Qiao, H.; Jiang, F.; Xiong, Y.; Jiang, S.; Fu, H.; Li, F.; Zhang, W.; Sun, S.; Jin, S.; Gong, Y.; et al. Characterization, expression patterns of molt-inhibiting hormone gene of Macrobrachium nipponense and its roles in molting and growth. PLoS ONE 2018, 13, e0198861. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Delgado, M.; Camacho, A.P. Influence of temperature on gonadal development of Ruditapes philippinarum (Adams and Reeve, 1850) with special reference to ingested food and energy balance. Aquaculture 2007, 264, 398–407. [Google Scholar] [CrossRef] [Scilit]
- Suzuki, T.; Sakurai, S.; Iwami, M. Juvenile hormone delays the initiation of rectal sac distention by disrupting ecdysteroid action in the silkworm, Bombyx mori. Pestic. Biochem. Physiol. 2010, 97, 199–203. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Y.; Wu, J.; Leng, X.; Du, H.; Wu, J.; He, S.; Luo, J.; Liang, X.; Liu, H.; Wei, Q. Metabolomics and gene expressions revealed the metabolic changes of lipid and amino acids and the related energetic mechanism in response to ovary development of Chinese sturgeon (Acipenser sinensis). PLoS ONE 2020, 15, e0235043. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bond, N.D.; Nelliot, A.; Bernardo, M.K.; Ayerh, M.A.; Gorski, K.A.; Hoshizaki, D.K.; Woodard, C.T. ssFTZ-F1 and Matrix metalloproteinase 2 are required for fat-body remodeling in Drosophila. Dev. Biol. 2011, 360, 286–296. [Google Scholar] [CrossRef] [Scilit]
- Dou, X.; Chen, K.; Brown, M.R.; Strand, M.R. Multiple endocrine factors regulate nutrient mobilization and storage in Aedes aegypti during a gonadotrophic cycle. Insect Sci. 2022, 30, 425–442. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tiu, S.H.-K.; Chan, S.-M.; Tobe, S.S. The effects of farnesoic acid and 20-hydroxyecdysone on vitellogenin gene expression in the lobster, Homarus americanus, and possible roles in the reproductive process. Gen. Comp. Endocrinol. 2010, 166, 337–345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chaix, J.C.; De Reggi, M. Ecdysteroid Levels during Ovarian Development and Embryogenesis in the Spider Crab Acanthonyx lunulatus. Gen. Comp. Endocrinol. 1982, 47, 7–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chan, S.-M. Possible roles of 20-hydroxyecdysone in the control of ovary maturation in the white shrimp Penaeus vannamei (Crustacea: Decapoda). Comp. Biochem. Physiol. Part C Pharmacol. Toxicol. Endocrinol. 1995, 112, 51–59. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Fan, B.; Yasen, A.; Zhu, J.; Wang, M.; Shen, X. YTHDF3 Is Involved in the Diapause Process of Bivoltine Bombyx mori Strains by Regulating the Expression of Cyp307a1 and Cyp18a1 Genes in the Ecdysone Synthesis Pathway. Biomolecules 2022, 12, 1127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kamiyama, T.; Niwa, R. Transcriptional regulators of ecdysteroid biosynthetic enzymes and their roles in insect development. Front. Physiol. 2022, 13, 85. [Google Scholar] [CrossRef] [Scilit]
- Rewitz, K.F.; Gilbert, L.I. Daphnia Halloween genes that encode cytochrome P450s mediating the synthesis of the arthropod molting hormone: Evolutionary implications. BMC Evol. Biol. 2008, 8, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dai, T.-H.; Sserwadda, A.; Song, K.; Zang, Y.-N.; Shen, H.-S. Cloning and expression of ecdysone receptor and retinoid X receptor from Procambarus clarkii: Induction by eyestalk ablation. Int. J. Mol. Sci. 2016, 17, 1739. [Google Scholar] [CrossRef] [Scilit]
- Shen, H.; Ma, Y.; Hu, Y.; Zhou, X. Cloning of the ecdysone receptor gene from the Chinese Mitten Crab, Eriocheir sinensis, and sexually dimorphic expression of two splice variants. J. World Aquac. Soc. 2015, 46, 421–433. [Google Scholar] [CrossRef] [Scilit]
- Tian, H.; Yang, C.; Yu, Y.; Yang, W.; Lu, N.; Wang, H.; Liu, F.; Wang, A.; Xu, X. Dietary cholesterol level affects growth, molting performance and ecdysteroid signal transduction in Procambarus clarkii. Aquaculture 2020, 523, 735198. [Google Scholar] [CrossRef] [Scilit]
- Yang, F.; Wang, Y.; Lu, W.; Zong, W.; Zhu, Q.; Cheng, J. The Comparative Survey of Coordinated Regulation of Steroidogenic Pathway in Japanese Flounder (Paralichthys olivaceus) and Chinese Tongue Sole (Cynoglossus semilaevis). Int. J. Mol. Sci. 2022, 23, 5520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leyria, J.; Benrabaa, S.; Nouzova, M.; Noriega, F.G.; Tose, L.V.; Fernandez-Lima, F.; Orchard, I.; Lange, A.B. Crosstalk between Nutrition, Insulin, Juvenile Hormone, and Ecdysteroid Signaling in the Classical Insect Model, Rhodnius prolixus. Int. J. Mol. Sci. 2022, 24, 7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, T.; Jin, M.; Xie, S.; Guo, C.; Luo, J.; Zhang, X.; Shen, Y.; Sun, P.; Jiao, L.; Zhou, Q. Transcriptome and targeted metabolomics revealed that cholesterol nutrition promotes ovarian development by regulating steroid hormone metabolism in swimming crab. Aquac. Rep. 2022, 27, 101396. [Google Scholar] [CrossRef] [Scilit]
- Zeng, J.; Kamiyama, T.; Niwa, R.; King-Jones, K. The Drosophila CCR4-NOT complex is required for cholesterol homeostasis and steroid hormone synthesis. Dev. Biol. 2018, 443, 10–18. [Google Scholar] [CrossRef] [Scilit]
- Bak, D.W.; Elliott, S.J. Alternative FeS cluster ligands: Tuning redox potentials and chemistry. Curr. Opin. Chem. Biol. 2014, 19, 50–58. [Google Scholar] [CrossRef] [Scilit]
- Wollam, J.; Magomedova, L.; Magner, D.B.; Shen, Y.; Rottiers, V.; Motola, D.L.; Mangelsdorf, D.J.; Cummins, C.L.; Antebi, A. The Rieske oxygenase DAF-36 functions as a cholesterol 7-desaturase in steroidogenic pathways governing longevity. Aging Cell 2011, 10, 879–884. [Google Scholar] [CrossRef] [Scilit]
- Sathapondecha, P.; Panyim, S.; Udomkit, A. An essential role of Rieske domain oxygenase Neverland in the molting cycle of black tiger shrimp, Penaeus monodon. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2017, 213, 11–19. [Google Scholar] [CrossRef] [Scilit]
- Sumiya, E.; Ogino, Y.; Toyota, K.; Miyakawa, H.; Miyagawa, S.; Iguchi, T. Neverland regulates embryonic moltings through the regulation of ecdysteroid synthesis in the water flea Daphnia magna, and may thus act as a target for chemical disruption of molting. J. Appl. Toxicol. 2016, 36, 1476–1485. [Google Scholar] [CrossRef] [Scilit]
- Yoshiyama, T.; Namiki, T.; Mita, K.; Kataoka, H.; Niwa, R. Neverland is an evolutionally conserved Rieske-domain protein that is essential for ecdysone synthesis and insect growth. Development 2006, 133, 2565–2574. [Google Scholar] [CrossRef] [Scilit]
- Uryu, O.; Ameku, T.; Niwa, R. Recent progress in understanding the role of ecdysteroids in adult insects: Germline development and circadian clock in the fruit fly Drosophila melanogaster. Zool. Lett. 2015, 1, 32. [Google Scholar] [CrossRef] [Scilit]
- Zhou, X.; Ye, Y.-Z.; Ogihara, M.H.; Takeshima, M.; Fujinaga, D.; Liu, C.-W.; Zhu, Z.; Kataoka, H.; Bao, Y.-Y. Functional analysis of ecdysteroid biosynthetic enzymes of the rice planthopper, Nilaparvata lugens. Insect Biochem. Mol. Biol. 2020, 123, 103428. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yuan, H.; Qiao, H.; Fu, Y.; Fu, H.; Zhang, W.; Jin, S.; Gong, Y.; Jiang, S.; Xiong, Y.; Hu, Y. RNA interference shows that Spook, the precursor gene of 20-hydroxyecdysone (20E), regulates the molting of Macrobrachium nippon. J. Steroid Biochem. Mol. Biol. 2021, 213, 105976. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.; Zhu, Q.; Chen, H.; Zhu, X.; Cui, Z.; Qiu, G. The morphological and histological observation of embryonic development in the oriental river prawn Macrobrachium nipponense. J. Shanghai Ocean Univ. 2012, 21, 33–40. [Google Scholar]
- Chang, E. Reproductive endocrinology of the shrimp Sicyonia ingentis: Steroid, peptide, and terpenoid hormones. NOAA Tech. Rep. NMFS 1992, 106, 1–6. [Google Scholar]
- Dong, S.Z.; Ye, G.Y.; Guo, J.Y.; Hu, C. Roles of ecdysteroid and juvenile hormone in vitellogenesis in an endoparasitic wasp, Pteromalus puparum (Hymenoptera: Pteromalidae). Gen. Comp. Endocrinol. 2009, 160, 102–108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kamruzzaman, A.S.M.; Mikani, A.; Mohamed, A.A.; Elgendy, A.M.; Takeda, M. Crosstalk among Indoleamines, Neuropeptides and JH/20E in Regulation of Reproduction in the American Cockroach, Periplaneta americana. Insects 2020, 11, 155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gunamalai, V.; Kirubagaran, R.; Subramoniam, T. Hormonal coordination of molting and female reproduction by ecdysteroids in the mole crab Emerita asiatica (Milne Edwards). Gen. Comp. Endocrinol. 2004, 138, 128–138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mykles, D.L.; Chang, E.S. Hormonal control of the crustacean molting gland: Insights from transcriptomics and proteomics. Gen. Comp. Endocrinol. 2020, 294, 113493. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hafeez, M.; Li, X.; Chen, L.; Ullah, F.; Huang, J.; Zhang, Z.; Zhang, J.; Siddiqui, J.A.; Zhou, S.-X.; Ren, X.-Y. Molecular characterization and functional analysis of cytochrome P450-mediated detoxification CYP302A1 gene involved in host plant adaptation in Spodoptera frugieprda. Front. Plant Sci. 2022, 13, 1079442. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rewitz, K.F.; Rybczynski, R.; Warren, J.T.; Gilbert, L.I. Identification, characterization and developmental expression of Halloween genes encoding P450 enzymes mediating ecdysone biosynthesis in the tobacco hornworm, Manduca sexta. Insect Biochem. Mol. Biol. 2006, 36, 188–199. [Google Scholar] [CrossRef] [Scilit]
- Fujinaga, D.; Gu, J.; Kawahara, H.; Ogihara, M.H.; Kojima, I.; Takeshima, M.; Kataoka, H. Twenty-hydroxyecdysone produced by dephosphorylation and ecdysteroidogenesis regulates early embryonic development in the silkmoth, Bombyx mori. Insect Biochem. Mol. Biol. 2020, 127, 103491. [Google Scholar] [CrossRef] [Scilit]
- Han, P.; Han, J.; Fan, J.; Zhang, M.; Ma, E.; Li, S.; Fan, R.; Zhang, J. 20-Hydroxyecdysone activates PGRP-SA mediated immune response in Locusta migratoria. Dev. Comp. Immunol. 2017, 72, 128–139. [Google Scholar] [CrossRef] [Scilit]
- Liu, S.; He, C.; Liang, J.; Su, Q.; Hua, D.; Wang, S.; Wu, Q.; Xie, W.; Zhang, Y. Molecular characterization and functional analysis of the Halloween genes and CYP18A1 in Bemisia tabaci MED. Pestic. Biochem. Physiol. 2020, 167, 104602. [Google Scholar] [CrossRef] [Scilit]
- Cheng, D.; Zhang, W.; Jiang, S.; Xiong, Y.; Jin, S.; Pan, F.; Zhu, J.; Gong, Y.; Wu, Y.; Qiao, H. Cathepsin D Plays a Vital Role in Macrobrachium nipponense of Ovary Maturation: Identification, Characterization, and Function Analysis. Genes 2022, 13, 1495. [Google Scholar] [CrossRef] [Scilit]
- Hu, Y.; Fu, Y.; Jin, S.; Fu, H.; Qiao, H.; Zhang, W.; Jiang, S.; Gong, Y.; Xiong, Y.; Wu, Y. Comparative transcriptome analysis of lethality in response to RNA interference of the oriental river prawn (Macrobrachium nipponense). Comp. Biochem. Physiol. Part D Genom. Proteom. 2021, 38, 100802. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, L.; Yang, M.; Fu, H.; Sun, S.; Qiao, H.; Zhang, W.; Gong, Y.; Jiang, S.; Xiong, Y.; Jin, S. Molecular cloning and expression of MnGST-1 and MnGST-2 from oriental river prawn, Macrobrachium nipponense, in response to hypoxia and reoxygenation. Int. J. Mol. Sci. 2018, 19, 3102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jin, S.; Fu, H.; Jiang, S.; Xiong, Y.; Qiao, H.; Zhang, W.; Gong, Y.; Wu, Y. RNA interference analysis reveals the positive regulatory role of ferritin in testis development in the oriental river prawn, Macrobrachium nipponense. Front. Physiol. 2022, 13, 204. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Jin, S.; Fu, H.; Qiao, H.; Sun, S.; Zhang, W.; Jiang, S.; Gong, Y.; Xiong, Y.; Wu, Y. Identification and characterization of the DMRT11E gene in the oriental river prawn Macrobrachium nipponense. Int. J. Mol. Sci. 2019, 20, 1734. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, S.; Xiong, Y.; Zhang, W.; Zhu, J.; Cheng, D.; Gong, Y.; Wu, Y.; Qiao, H.; Fu, H. A novel legumain-like proteases in Macrobrachium nipponense: Identification, characterization and function analysis in ovary maturation. Front. Endocrinol. 2022, 13, 460. [Google Scholar] [CrossRef] [Scilit]









| Stages | Characteristic |
|---|---|
| O-I | undeveloped stage, transparent |
| O-II | developing stage, yellow |
| O-III | nearly-ripe stage, light green |
| O-IV | ripe stage, dark green |
| O-V | worn out stage, gray |
| CS | cleavage stage |
| BS | blastula stage |
| GS | gastrulation stage |
| NS | nauplius stage |
| ZS | zoea stage |
| L1 | the 1st-day larvae after hatching |
| L5 | the 5th-day larvae after hatching |
| L10 | the 10th-day larvae after hatching |
| L15 | the 15th-day larvae after hatching |
| PL1 | the 1st day after metamorphosis |
| PL5 | the 5th day after metamorphosis |
| PL10 | the 10th day after metamorphosis |
| PL15 | the 15th day after metamorphosis |
| PL20 | the 20th day after metamorphosis |
| PL25 | the 25th day after metamorphosis |
| Primer’s Name | Sequence (5′-3′) | Usage |
|---|---|---|
| CH7D F1 | CTAATTGCGCTAAAGTCCCGAAG | ORF |
| CH7D R1 | GGTCATGGTGAGGATCTTGAACT | ORF |
| CH7D F2 | TTGCAGACAATCAGGTTTTGGAC | ORF |
| CH7D R2 | CTCACAGAGCAGGACGAATTTTG | ORF |
| CH7D F3 | GTGCATCAGTTCTATTCGTCGTC | ORF |
| CH7D R3 | CTGAGCTTTGTACTGCTTGTTGT | ORF |
| CH7D 3′F1 | GCTGAGAGTAGAACTGCGCGTAC | 3′RACE |
| CH7D 3′F2 | TCTCGTTCCTGAAGGAGAACTGC | 3′RACE |
| CH7D F | TGGAACAACAAGCAGTACAAAG | qPCR |
| CH7D R | CTGGCTGTTCTGAGAGTAGAACT | qPCR |
| EIF F | CATGGATGTACCTGTGGTGAAAC | qPCR |
| EIF R | CTGTCAGCAGAAGGTCCTCATTA | qPCR |
| CH7D dsF | TAATACGACTCACTATAGGGCGCTAAAGTCC CGAAGACAG | dsRNA |
| CH7D dsR | TAATACGACTCACTATAGGGACGAATTTTGC GTAAGGTGC | dsRNA |
| GFP dsF | TAATACGACTCACTATAGGGACGAAGACCTT GCTTCTGAAG | dsRNA |
| GFP dsR | TAATACGACTCACTATAGGGAAAGGGCAGAT TGTGTGGAC | dsRNA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, J.; Jiang, S.; Zhang, W.; Xiong, Y.; Jin, S.; Cheng, D.; Zheng, Y.; Qiao, H.; Fu, H. Function Analysis of Cholesterol 7-Desaturase in Ovarian Maturation and Molting in Macrobrachium nipponense: Providing Evidence for Reproductive Molting Progress. Int. J. Mol. Sci. 2023, 24, 6940. https://doi.org/10.3390/ijms24086940
Wang J, Jiang S, Zhang W, Xiong Y, Jin S, Cheng D, Zheng Y, Qiao H, Fu H. Function Analysis of Cholesterol 7-Desaturase in Ovarian Maturation and Molting in Macrobrachium nipponense: Providing Evidence for Reproductive Molting Progress. International Journal of Molecular Sciences. 2023; 24(8):6940. https://doi.org/10.3390/ijms24086940
Chicago/Turabian StyleWang, Jisheng, Sufei Jiang, Wenyi Zhang, Yiwei Xiong, Shubo Jin, Dan Cheng, Yalu Zheng, Hui Qiao, and Hongtuo Fu. 2023. "Function Analysis of Cholesterol 7-Desaturase in Ovarian Maturation and Molting in Macrobrachium nipponense: Providing Evidence for Reproductive Molting Progress" International Journal of Molecular Sciences 24, no. 8: 6940. https://doi.org/10.3390/ijms24086940
APA StyleWang, J., Jiang, S., Zhang, W., Xiong, Y., Jin, S., Cheng, D., Zheng, Y., Qiao, H., & Fu, H. (2023). Function Analysis of Cholesterol 7-Desaturase in Ovarian Maturation and Molting in Macrobrachium nipponense: Providing Evidence for Reproductive Molting Progress. International Journal of Molecular Sciences, 24(8), 6940. https://doi.org/10.3390/ijms24086940

