H3K4me1 Modification Functions in Caste Differentiation in Honey Bees
Abstract
:1. Introduction
2. Results
2.1. H3K4me1 Modifications in the Honey Bee Are Enriched in Transcribed Regions
2.2. Caste-Specific H3K4me1 Modification Patterns Correlate with Differential Gene Expression
2.3. Caste Features of Worker Bees May Be Induced by H3K4me1
3. Discussion
4. Materials and Methods
4.1. Insects
4.2. ChIP-seq Assay and Analysis
4.3. RNA-seq Analysis
4.4. Verification of Gene Expression Differences by qRT-PCR
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Weaver, N. Physiology of caste determination. Annu. Rev. 1966, 11, 79–102. [Google Scholar] [CrossRef] [PubMed]
- Michener, C.D.; Michener, C.D. The social Behavior of the Bees: A Comparative Study; Harvard University Press: Cambridge, MA, USA, 1974. [Google Scholar]
- Elango, N.; Hunt, B.G.; Goodisman, M.A.; Yi, S.V. DNA methylation is widespread and associated with differential gene expression in castes of the honeybee, Apis mellifera. Proc. Natl. Acad. Sci. USA 2009, 106, 11206–11211. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ford, D. Honeybees and cell lines as models of DNA methylation and aging in response to diet. Exp. Gerontol. 2013, 48, 614–619. [Google Scholar] [CrossRef] [PubMed]
- Yagound, B.; Remnant, E.J.; Buchmann, G.; Oldroyd, B.P. Intergenerational transfer of DNA methylation marks in the honey bee. Proc. Natl. Acad. Sci. USA 2020, 117, 32519–32527. [Google Scholar] [CrossRef] [PubMed]
- Yagound, B.; Smith, N.M.; Buchmann, G.; Oldroyd, B.P.; Remnant, E.J. Unique DNA methylation profiles are associated with cis-variation in honey bees. Genome Biol. Evol. 2019, 11, 2517–2530. [Google Scholar] [CrossRef]
- Shi, Y.Y.; Yan, W.Y.; Huang, Z.Y.; Wang, Z.L.; Wu, X.B.; Zeng, Z.J. Genomewide analysis indicates that queen larvae have lower methylation levels in the honey bee (Apis mellifera). Nat. 2013, 100, 193–197. [Google Scholar] [CrossRef]
- Wheeler, D.; Buck, N.; Evans, J. Expression of insulin/insulin-like signalling and TOR pathway genes in honey bee caste determination. Insect Mol. Biol. 2014, 23, 113–121. [Google Scholar] [CrossRef]
- Patel, A.; Fondrk, M.K.; Kaftanoglu, O.; Emore, C.; Hunt, G.; Frederick, K.; Amdam, G.V. The making of a queen: TOR pathway is a key player in diphenic caste development. PLoS ONE 2007, 2, e509. [Google Scholar] [CrossRef] [Green Version]
- He, X.J.; Wei, H.; Jiang, W.J.; Liu, Y.B.; Wu, X.B.; Zeng, Z. Honeybee (Apis mellifera) maternal effect causes alternation of DNA methylation regulating queen development. Sociobiology 2021, 68, e5935. [Google Scholar] [CrossRef]
- Wojciechowski, M.; Lowe, R.; Maleszka, J.; Conn, D.; Maleszka, R.; Hurd, P.J. Phenotypically distinct female castes in honey bees are defined by alternative chromatin states during larval development. Genome Res. 2018, 28, 1532–1542. [Google Scholar] [CrossRef] [Green Version]
- Kucharski, R.; Maleszka, J.; Foret, S.; Maleszka, R. Nutritional control of reproductive status in honeybees via DNA methylation. Science 2008, 319, 1827–1830. [Google Scholar] [CrossRef] [Green Version]
- Foret, S.; Kucharski, R.; Pellegrini, M.; Feng, S.; Jacobsen, S.E.; Robinson, G.E.; Maleszka, R. DNA methylation dynamics, metabolic fluxes, gene splicing, and alternative phenotypes in honey bees. Proc. Natl. Acad. Sci. USA 2012, 109, 4968–4973. [Google Scholar] [CrossRef] [Green Version]
- Murray, K. The occurrence of iε-N-methyl lysine in histones. Biochemistry 1964, 3, 10–15. [Google Scholar] [CrossRef] [PubMed]
- Byvoet, P.; Shepherd, G.; Hardin, J.; Noland, B. The distribution and turnover of labeled methyl groups in histone fractions of cultured mammalian cells. Arch. Biochem. Biophys. 1972, 148, 558–567. [Google Scholar] [CrossRef]
- Kouzarides, T. Chromatin modifications and their function. Cell 2007, 128, 693–705. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eissenberg, J.C.; Shilatifard, A. Histone H3 lysine 4 (H3K4) methylation in development and differentiation. Dev. Biol. 2010, 339, 240–249. [Google Scholar] [CrossRef] [Green Version]
- Greenberg, R.A. Histone tails: Directing the chromatin response to DNA damage. FEBS Lett. 2011, 585, 2883–2890. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nottke, A.; Colaiácovo, M.P.; Shi, Y. Developmental roles of the histone lysine demethylases. Development 2009, 136, 879–889. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pedersen, M.T.; Helin, K. Histone demethylases in development and disease. Trends Cell Biol. 2010, 20, 662–671. [Google Scholar] [CrossRef]
- Sarg, B.; Koutzamani, E.; Helliger, W.; Rundquist, I.; Lindner, H.H. Postsynthetic trimethylation of histone H4 at lysine 20 in mammalian tissues is associated with aging. J. Biol. Chem. 2002, 277, 39195–39201. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maures, T.J.; Greer, E.L.; Hauswirth, A.G.; Brunet, A. The H3K27 demethylase UTX-1 regulates C. elegans lifespan in a germline-independent, insulin-dependent manner. Aging Cell 2011, 10, 980–990. [Google Scholar] [CrossRef] [Green Version]
- Siebold, A.P.; Banerjee, R.; Tie, F.; Kiss, D.L.; Moskowitz, J.; Harte, P.J. Polycomb Repressive Complex 2 and Trithorax modulate Drosophila longevity and stress resistance. Proc. Natl. Acad. Sci. USA 2010, 107, 169–174. [Google Scholar] [CrossRef] [Green Version]
- Guttman, M.; Amit, I.; Garber, M.; French, C.; Lin, M.F.; Feldser, D.; Huarte, M.; Zuk, O.; Carey, B.W.; Cassady, J.P. Chromatin signature reveals over a thousand highly conserved large non-coding RNAs in mammals. Nature 2009, 458, 223–227. [Google Scholar] [CrossRef] [PubMed]
- Greer, E.L.; Maures, T.J.; Ucar, D.; Hauswirth, A.G.; Mancini, E.; Lim, J.P.; Benayoun, B.A.; Shi, Y.; Brunet, A. Transgenerational epigenetic inheritance of longevity in Caenorhabditis elegans. Nature 2011, 479, 365–371. [Google Scholar] [CrossRef] [Green Version]
- Barchuk, A.R.; Cristino, A.S.; Kucharski, R.; Costa, L.F.; Simões, Z.L.; Maleszka, R. Molecular determinants of caste differentiation in the highly eusocial honeybee Apis mellifera. BMC Dev. Biol. 2007, 7, 70. [Google Scholar] [CrossRef] [Green Version]
- Waddington, C.D. The Strategy of the Genes. A Discussion of Some Aspects of Theoretical Biology; Allen and Unwin: London, UK, 1957. [Google Scholar]
- Local, A.; Huang, H.; Albuquerque, C.P.; Singh, N.; Lee, A.Y.; Wang, W.; Wang, C.; Hsia, J.E.; Shiau, A.K.; Ge, K. Identification of H3K4me1-associated proteins at mammalian enhancers. Nat. Genet. 2018, 50, 73–82. [Google Scholar] [CrossRef] [PubMed]
- Simola, D.F.; Ye, C.; Mutti, N.S.; Dolezal, K.; Bonasio, R.; Liebig, J.; Reinberg, D.; Berger, S.L. A chromatin link to caste identity in the carpenter ant Camponotus floridanus. Genome Res. 2013, 23, 486–496. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van Dijk, K.; Ding, Y.; Malkaram, S.; Riethoven, J.-J.M.; Liu, R.; Yang, J.; Laczko, P.; Chen, H.; Xia, Y.; Ladunga, I. Dynamic changes in genome-wide histone H3 lysine 4 methylation patterns in response to dehydration stress in Arabidopsis thaliana. BMC Plant Biol. 2010, 10, 238. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.; He, X.J.; Barron, A.; Li, Z.; Jin, M.J.; Wang, Z.; Huang, Q.; Zhang, L.Z.; Wu, X.; Yan, W.Y. The diverging epigenomic landscapes of honeybee queens and workers revealed by multiomic sequencing. Insect Biochem. Mol. Biol. 2023, 155, 103929. [Google Scholar] [CrossRef]
- Bomtorin, A.D.; Mackert, A.; Rosa, G.C.C.; Moda, L.M.; Martins, J.R.; Bitondi, M.M.G.; Hartfelder, K.; Simões, Z.L.P. Juvenile hormone biosynthesis gene expression in the corpora allata of honey bee (Apis mellifera L.) female castes. PLoS ONE 2014, 9, e86923. [Google Scholar] [CrossRef] [Green Version]
- Zhang, W.; Wang, L.; Zhao, Y.; Wang, Y.; Chen, C.; Hu, Y.; Zhu, Y.; Sun, H.; Cheng, Y.; Sun, Q. Single-cell transcriptomic analysis of honeybee brains identifies vitellogenin as caste differentiation-related factor. Iscience 2022, 25, 104643. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Huang, Z.Y.; Liu, F.; Li, Z.; Yan, L.; Zhang, S.; Chen, S.; Zhong, B.; Su, S. Molecular cloning and characterization of juvenile hormone acid methyltransferase in the honey bee, Apis mellifera, and its differential expression during caste differentiation. PLoS ONE 2013, 8, e68544. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martins, J.R.; Nunes, F.M.; Cristino, A.S.; Simões, Z.L.; Bitondi, M.M. The four hexamerin genes in the honey bee: Structure, molecular evolution and function deduced from expression patterns in queens, workers and drones. BMC Mol. Biol. 2010, 11, 23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lago, D.C.; Humann, F.C.; Barchuk, A.R.; Abraham, K.J.; Hartfelder, K. Differential gene expression underlying ovarian phenotype determination in honey bee, Apis mellifera L., caste development. Insect Biochem. Mol. Biol. 2016, 79, 1–12. [Google Scholar] [CrossRef]
- Wang, M.; Xiao, Y.; Li, Y.; Wang, X.; Qi, S.; Wang, Y.; Zhao, L.; Wang, K.; Peng, W.; Luo, G.-Z. RNA m6A modification functions in larval development and caste differentiation in honeybee (Apis mellifera). Cell Rep. 2021, 34, 108580. [Google Scholar] [CrossRef]
- Mutti, N.S.; Dolezal, A.G.; Wolschin, F.; Mutti, J.S.; Gill, K.S.; Amdam, G.V. IRS and TOR nutrient-signaling pathways act via juvenile hormone to influence honey bee caste fate. J. Exp. Biol. 2011, 214, 3977–3984. [Google Scholar] [CrossRef] [Green Version]
- Ingham, P.; Whittle, R. Trithorax: A new homoeotic mutation of Drosophila melanogaster causing transformations of abdominal and thoracic imaginal segments. Mol. Gen. Genet. 1980, 179, 607–614. [Google Scholar] [CrossRef]
- Byrd, K.N.; Shearn, A. ASH1, a Drosophila trithorax group protein, is required for methylation of lysine 4 residues on histone H3. Proc. Natl. Acad. Sci. USA 2003, 100, 11535–11540. [Google Scholar] [CrossRef] [Green Version]
- Ancelin, K.; Syx, L.; Borensztein, M.; Ranisavljevic, N.; Vassilev, I.; Briseno-Roa, L.; Liu, T.; Metzger, E.; Servant, N.; Barillot, E. Maternal LSD1/KDM1A is an essential regulator of chromatin and transcription landscapes during zygotic genome activation. Elife 2016, 5, e08851. [Google Scholar] [CrossRef]
- Andreu-Vieyra, C.V.; Chen, R.; Agno, J.E.; Glaser, S.; Anastassiadis, K.; Stewart, A.F.; Matzuk, M.M. MLL2 is required in oocytes for bulk histone 3 lysine 4 trimethylation and transcriptional silencing. PLoS Biol. 2010, 8, e1000453. [Google Scholar] [CrossRef]
- Dodge, J.E.; Kang, Y.-K.; Beppu, H.; Lei, H.; Li, E. Histone H3-K9 methyltransferase ESET is essential for early development. Mol. Cell. Biol. 2004, 24, 2478–2486. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jambhekar, A.; Dhall, A.; Shi, Y. Roles and regulation of histone methylation in animal development. Nat. Rev. Mol. Cell Biol. 2019, 20, 625–641. [Google Scholar] [CrossRef]
- Arney, K.L.; Bao, S.; Bannister, A.J.; Kouzarides, T.; Surani, M.A. Histone methylation defines epigenetic asymmetry in the mouse zygote. Int. J. Dev. Biol. 2002, 46, 317–320. [Google Scholar] [PubMed]
- Suzuki, M.M.; Bird, A. DNA methylation landscapes: Provocative insights from epigenomics. Nat. Rev. Genet. 2008, 9, 465–476. [Google Scholar] [CrossRef] [PubMed]
- Glastad, K.M.; Hunt, B.G.; Goodisman, M.A. Epigenetics in insects: Genome regulation and the generation of phenotypic diversity. Annu. Rev. Entomol. 2019, 64, e203. [Google Scholar] [CrossRef] [Green Version]
- Sharifi-Zarchi, A.; Gerovska, D.; Adachi, K.; Totonchi, M.; Pezeshk, H.; Taft, R.J.; Schöler, H.R.; Chitsaz, H.; Sadeghi, M.; Baharvand, H. DNA methylation regulates discrimination of enhancers from promoters through a H3K4me1-H3K4me3 seesaw mechanism. BMC Genom. 2017, 18, 964. [Google Scholar] [CrossRef]
- He, X.J.; Barron, A.B.; Yang, L.; Chen, H.; He, Y.Z.; Zhang, L.Z.; Huang, Q.; Wang, Z.L.; Wu, X.B.; Yan, W.Y. Extent and complexity of RNA processing in honey bee queen and worker caste development. Iscience 2022, 25, 104301. [Google Scholar] [CrossRef]
- Martins, J.R.; Nunes, F.M.F.; Simões, Z.L.P.; Bitondi, M.M.G. A honeybee storage protein gene, hex 70a, expressed in developing gonads and nutritionally regulated in adult fat body. J. Insect Physiol. 2008, 54, 867–877. [Google Scholar] [CrossRef] [PubMed]
- Martins, J.R.; Anhezini, L.; Dallacqua, R.P.; Simoes, Z.L.; Bitondi, M.M. A honey bee hexamerin, HEX 70a, is likely to play an intranuclear role in developing and mature ovarioles and testioles. PLoS ONE 2011, 6, e29006. [Google Scholar] [CrossRef] [Green Version]
- Herz, H.-M.; Mohan, M.; Garruss, A.S.; Liang, K.; Takahashi, Y.-h.; Mickey, K.; Voets, O.; Verrijzer, C.P.; Shilatifard, A. Enhancer-associated H3K4 monomethylation by Trithorax-related, the Drosophila homolog of mammalian Mll3/Mll4. Genes Dev. 2012, 26, 2604–2620. [Google Scholar] [CrossRef] [Green Version]
- Dalvai, M.; Bellucci, L.; Fleury, L.; Lavigne, A.; Moutahir, F.; Bystricky, K. H2A. Z-dependent crosstalk between enhancer and promoter regulates Cyclin D1 expression. Oncogene 2013, 32, 4243–4251. [Google Scholar] [CrossRef] [Green Version]
- Dalvai, M.; Fleury, L.; Bellucci, L.; Kocanova, S.; Bystricky, K. TIP48/Reptin and H2A. Z requirement for initiating chromatin remodeling in estrogen-activated transcription. PLoS Genet. 2013, 9, e1003387. [Google Scholar] [CrossRef] [PubMed]
- Mora, A.; Sandve, G.K.; Gabrielsen, O.S.; Eskeland, R. In the loop: Promoter–enhancer interactions and bioinformatics. Brief. Bioinform. 2016, 17, 980–995. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Costa, R.M.; Soto, X.; Chen, Y.; Zorn, A.M.; Amaya, E. spib is required for primitive myeloid development in Xenopus. Blood J. Am. Soc. Hematol. 2008, 112, 2287–2296. [Google Scholar] [CrossRef] [Green Version]
- Willis, S.N.; Tellier, J.; Liao, Y.; Trezise, S.; Light, A.; O’Donnell, K.; Garrett-Sinha, L.A.; Shi, W.; Tarlinton, D.M.; Nutt, S.L. Environmental sensing by mature B cells is controlled by the transcription factors PU. 1 and SpiB. Nat. Commun. 2017, 8, 1426. [Google Scholar] [CrossRef] [PubMed]
- Lugus, J.J.; Chung, Y.S.; Mills, J.C.; Kim, S.-I.; Grass, J.A.; Kyba, M.; Doherty, J.M.; Bresnick, E.H.; Choi, K. GATA2 functions at multiple steps in hemangioblast development and differentiation. Development 2007, 134, 393–405. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kazenwadel, J.; Betterman, K.L.; Chong, C.-E.; Stokes, P.H.; Lee, Y.K.; Secker, G.A.; Agalarov, Y.; Demir, C.S.; Lawrence, D.M.; Sutton, D.L. GATA2 is required for lymphatic vessel valve development and maintenance. J. Clin. Investig. 2015, 125, 2979–2994. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pan, Q.-Z.; Wu, X.-B.; Guan, C.; Zeng, Z.-J. A new method of queen rearing without grafting larvae. Am. Bee J. 2013, 153, 1279–1280. [Google Scholar]
- Zhang, Y.; Li, Z.; Wang, Z.-L.; Zhang, L.-Z.; Zeng, Z.-J. A Comparison of RNA Interference via Injection and Feeding in Honey Bees. Insects 2022, 13, 928. [Google Scholar] [CrossRef]
Genes | Forward Primer | Reverse Primer |
---|---|---|
GAPDH | GCTGGTTTCATCGATGGTTT | ACGATTTCGACCACCGTAAC |
JHe | CTTTTCTCGCTTCCACAACC | TCCTGGTCCAGCAATGTGTA |
VG | AAGACCAATCCACCGTTGAG | TGGTTCACGCTCCTAGCTTT |
JHAMT | GGATTTGCCCAAAGACACAT | CGAGGATTCGCGTACAATTT |
Hex70a | GAGGGTCAAGCATGGAACAT | GTTGTTCTTCGCCCAGAGAG |
Hsp90 | CTGAGAGTGACGCGAAGCTA | CTCCGGCATCTTTTCACAAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; Li, Z.; He, X.; Wang, Z.; Zeng, Z. H3K4me1 Modification Functions in Caste Differentiation in Honey Bees. Int. J. Mol. Sci. 2023, 24, 6217. https://doi.org/10.3390/ijms24076217
Zhang Y, Li Z, He X, Wang Z, Zeng Z. H3K4me1 Modification Functions in Caste Differentiation in Honey Bees. International Journal of Molecular Sciences. 2023; 24(7):6217. https://doi.org/10.3390/ijms24076217
Chicago/Turabian StyleZhang, Yong, Zhen Li, Xujiang He, Zilong Wang, and Zhijiang Zeng. 2023. "H3K4me1 Modification Functions in Caste Differentiation in Honey Bees" International Journal of Molecular Sciences 24, no. 7: 6217. https://doi.org/10.3390/ijms24076217
APA StyleZhang, Y., Li, Z., He, X., Wang, Z., & Zeng, Z. (2023). H3K4me1 Modification Functions in Caste Differentiation in Honey Bees. International Journal of Molecular Sciences, 24(7), 6217. https://doi.org/10.3390/ijms24076217