Anti-Bacterial and Anti-Biofilm Activities of Anandamide against the Cariogenic Streptococcus mutans
Abstract
:1. Introduction
2. Results
2.1. Anandamide (AEA) Has a Bactericidal Effect on S. mutans
2.2. AEA Prevents Biofilm Formation by S. mutans
2.3. Live/Dead (SYTO 9/PI) and Dextran Staining of Biofilms Formed in the Presence of AEA
2.4. AEA Leads to Increased Dextran Binding to Bacteria
2.5. The Congo Red Assay Shows Reduced EPS Secretion following AEA Treatment
2.6. AEA Alters the Membrane Properties of S. mutans
2.7. AEA Leads to an Accumulation of DAPI in S. mutans
2.8. AEA Induces Immediate Membrane Hyperpolarization in S. mutans
2.9. AEA Affects the Cell Length and Morphology of S. mutans
2.10. AEA Affects the Gene Expression of the Cell Division Gene ftsZ in S. mutans
2.11. AEA Causes a Reduction in Preformed Biofilms
2.12. The Anti-Bacterial Concentrations of AEA Were Below Those Cytotoxic to Vero Epithelial Cells
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Bacterial Growth and Biofilm Formation
4.3. Colony-Forming Units (CFUs)
4.4. Kinetic Analysis of Planktonic Growing Bacteria and Simultaneous pH Measurements
4.5. Crystal Violet (CV) Staining of Biofilms
4.6. MTT Metabolic Assay
4.7. FilmTracer SYPRO Ruby Biofilm Matrix Staining
4.8. Biofilm Analysis by Spinning Disk Confocal Microscopy (SDCM)
4.9. Determination of Extracellular Polysaccharide (EPS) Production by Congo Red Assay
4.10. Determination of EPS Production of Individual S. mutans Cells Using Flow Cytometry
4.11. Membrane Permeability Assay
4.12. DAPI and Nile Red Staining
4.13. Measuring DNA Content with DAPI Staining
4.14. Membrane Potential Assay
4.15. High-Resolution Scanning Electron Microscopy (HR-SEM)
4.16. RNA Extraction
4.17. Reverse Transcription (RT) and Quantitative Real-Time PCR
4.18. Cytotoxicity Assay using Vero Kidney Epithelial Cells
4.19. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Krzyściak, W.; Jurczak, A.; Kościelniak, D.; Bystrowska, B.; Skalniak, A. The virulence of Streptococcus mutans and the ability to form biofilms. Eur. J. Clin. Microbiol. Infect. Dis. 2014, 33, 499–515. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- de la Fuente-Núñez, C.; Reffuveille, F.; Fernández, L.; Hancock, R.E.W. Bacterial biofilm development as a multicellular adaptation: Antibiotic resistance and new therapeutic strategies. Curr. Opin. Microbiol. 2013, 16, 580–589. [Google Scholar] [CrossRef] [PubMed]
- Jamal, M.; Ahmad, W.; Andleeb, S.; Jalil, F.; Imran, M.; Nawaz, M.A.; Hussain, T.; Ali, M.; Rafiq, M.; Kamil, M.A. Bacterial biofilm and associated infections. J. Chin. Med. Assoc. 2018, 81, 7–11. [Google Scholar] [CrossRef] [PubMed]
- Fuqua, W.C.; Winans, S.C.; Greenberg, E.P. Quorum sensing in bacteria: The LuxR-LuxI family of cell density-responsive transcriptional regulators. J. Bacteriol. 1994, 176, 269–275. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Serrage, H.J.; Jepson, M.A.; Rostami, N.; Jakubovics, N.S.; Nobbs, A.H. Understanding the matrix: The role of extracellular DNA in oral biofilms. Front. Oral Health 2021, 2, 640129. [Google Scholar] [CrossRef]
- Berger, D.; Rakhamimova, A.; Pollack, A.; Loewy, Z. Oral biofilms: Development, control, and analysis. High-Throughput 2018, 7, 24. [Google Scholar]
- Arweiler, N.B.; Netuschil, L. The oral microbiota. Adv. Exp. Med. Biol. 2016, 902, 45–60. [Google Scholar] [CrossRef]
- Lemos, J.A.C.; Abranches, J.; Burne, R.A. Responses of cariogenic Streptococci to environmental stresses. Curr. Issues Mol. Biol. 2005, 7, 95–108. [Google Scholar]
- Feldman, M.; Sionov, R.; Smoum, R.; Mechoulam, R.; Ginsburg, I.; Steinberg, D. Comparative evaluation of combinatory interaction between endocannabinoid system compounds and poly-l-lysine against Streptococcus mutans growth and biofilm formation. Biomed. Res. Int. 2020, 2020, 7258380. [Google Scholar] [CrossRef] [Green Version]
- Sionov, R.V.; Steinberg, D. Anti-microbial activity of phytocannabinoids and endocannabinoids in the light of their physiological and pathophysiological roles. Biomedicines 2022, 10, 631. [Google Scholar] [CrossRef]
- Banerjee, S.; Sionov, R.V.; Feldman, M.; Smoum, R.; Mechoulam, R.; Steinberg, D. Anandamide alters the membrane properties, halts the cell division and prevents drug efflux in multidrug resistant Staphylococcus aureus. Sci. Rep. 2021, 11, 8690. [Google Scholar] [CrossRef]
- Feldman, M.; Smoum, R.; Mechoulam, R.; Steinberg, D. Antimicrobial potential of endocannabinoid and endocannabinoid-like compounds against methicillin-resistant Staphylococcus aureus. Sci. Rep. 2018, 8, 17696. [Google Scholar] [CrossRef] [Green Version]
- Sionov, R.V.; Banerjee, S.; Bogomolov, S.; Smoum, R.; Mechoulam, R.; Steinberg, D. Targeting the Achilles’ heel of multidrug-resistant Staphylococcus aureus by the endocannabinoid anandamide. Int. J. Mol. Sci. 2022, 23, 7798. [Google Scholar] [CrossRef]
- Fornelos, N.; Franzosa, E.A.; Bishai, J.; Annand, J.W.; Oka, A.; Lloyd-Price, J.; Arthur, T.D.; Garner, A.; Avila-Pacheco, J.; Haiser, H.J.; et al. Growth effects of N-acylethanolamines on gut bacteria reflect altered bacterial abundances in inflammatory bowel disease. Nat. Microbiol. 2020, 5, 486–497. [Google Scholar] [CrossRef]
- Sionov, R.V.; Feldman, M.; Smoum, R.; Mechoulam, R.; Steinberg, D. Anandamide prevents the adhesion of filamentous Candida albicans to cervical epithelial cells. Sci. Rep. 2020, 10, 13728. [Google Scholar] [CrossRef]
- Kouidhi, B.; Zmantar, T.; Jrah, H.; Souiden, Y.; Chaieb, K.; Mahdouani, K.; Bakhrouf, A. Antibacterial and resistance-modifying activities of thymoquinone against oral pathogens. Ann. Clin. Microbiol. Antimicrob. 2011, 10, 29. [Google Scholar] [CrossRef] [Green Version]
- Peterson, S.N.; Snesrud, E.; Liu, J.; Ong, A.C.; Kilian, M.; Schork, N.J.; Bretz, W. The dental plaque microbiome in health and disease. PLoS ONE 2013, 8, e58487. [Google Scholar] [CrossRef] [Green Version]
- Horst, J.A. Silver fluoride as a treatment for dental caries. Adv. Dent. Res. 2018, 29, 135–140. [Google Scholar] [CrossRef]
- Cui, T.; Luo, W.; Xu, L.; Yang, B.; Zhao, W.; Cang, H. Progress of antimicrobial discovery against the major cariogenic pathogen Streptococcus mutans. Curr. Issues. Mol. Biol. 2019, 32, 601–604. [Google Scholar] [CrossRef]
- Aqawi, M.; Sionov, R.V.; Gallily, R.; Friedman, M.; Steinberg, D. Anti-bacterial properties of cannabigerol toward Streptococcus mutans. Front. Microbiol. 2021, 12, 656471. [Google Scholar] [CrossRef]
- Aqawi, M.; Sionov, R.V.; Gallily, R.; Friedman, M.; Steinberg, D. Anti-biofilm activity of cannabigerol against Streptococcus mutans. Microorganisms 2021, 9, 2031. [Google Scholar] [CrossRef] [PubMed]
- Barak, T.; Sharon, E.; Steinberg, D.; Feldman, M.; Sionov, R.V.; Shalish, M. Anti-bacterial effect of cannabidiol against the cariogenic Streptococcus mutans bacterium: An in vitro study. Int. J. Mol. Sci. 2022, 23, 15878. [Google Scholar] [CrossRef] [PubMed]
- Schneider-Rayman, M.; Steinberg, D.; Sionov, R.V.; Friedman, M.; Shalish, M. Effect of epigallocatechin gallate on dental biofilm of Streptococcus mutans: An in vitro study. BMC Oral Health 2021, 21, 447. [Google Scholar] [CrossRef] [PubMed]
- Blaskovich, M.A.T.; Kavanagh, A.M.; Elliott, A.G.; Zhang, B.; Ramu, S.; Amado, M.; Lowe, G.J.; Hinton, A.O.; Pham, D.M.T.; Zuegg, J.; et al. The antimicrobial potential of cannabidiol. Commun. Biol. 2021, 4, 7. [Google Scholar] [CrossRef]
- Suzuki, T.; Tagami, J.; Hanada, N. Role of F1F0-ATPase in the growth of Streptococcus mutans GS5. J. Appl. Microbiol. 2000, 88, 555–562. [Google Scholar] [CrossRef]
- Matsui, R.; Cvitkovitch, D. Acid tolerance mechanisms utilized by Streptococcus mutans. Future Microbiol. 2010, 5, 403–417. [Google Scholar] [CrossRef] [Green Version]
- Feldman, M.; Smoum, R.; Mechoulam, R.; Steinberg, D. Potential combinations of endocannabinoid/endocannabinoid-like compounds and antibiotics against methicillin-resistant Staphylococcus aureus. PLoS ONE 2020, 15, e0231583. [Google Scholar] [CrossRef] [Green Version]
- Nagayama, K.; Fujita, K.; Takashima, Y.; Ardin, A.C.; Ooshima, T.; Matsumoto-Nakano, M. Role of ABC transporter proteins in stress responses of Streptococcus mutans. Oral Health Dent. Manag. 2014, 13, 359–365. [Google Scholar]
- Liu, J.; Zhang, J.; Guo, L.; Zhao, W.; Hu, X.; Wei, X. Inactivation of a putative efflux pump (LmrB) in Streptococcus mutans results in altered biofilm structure and increased exopolysaccharide synthesis: Implications for biofilm resistance. Biofouling 2017, 33, 481–493. [Google Scholar] [CrossRef]
- Hashimoto, K.; Ogawa, W.; Nishioka, T.; Tsuchiya, T.; Kuroda, T. Functionally cloned pdrM from Streptococcus pneumoniae encodes a Na(+) coupled multidrug efflux pump. PLoS ONE 2013, 8, e59525. [Google Scholar] [CrossRef] [Green Version]
- Huang, M.; Meng, L.; Fan, M.; Hu, P.; Bian, Z. Effect of biofilm formation on virulence factor secretion via the general secretory pathway in Streptococcus mutans. Arch. Oral Biol. 2008, 53, 1179–1185. [Google Scholar] [CrossRef]
- Webb, A.J.; Homer, K.A.; Hosie, A.H. Two closely related ABC transporters in Streptococcus mutans are involved in disaccharide and/or oligosaccharide uptake. J. Bacteriol. 2008, 190, 168–178. [Google Scholar] [CrossRef] [Green Version]
- Akhtar, A.A.; Turner, D.P. The role of bacterial ATP-binding cassette (ABC) transporters in pathogenesis and virulence: Therapeutic and vaccine potential. Microb. Pathog. 2022, 171, 105734. [Google Scholar] [CrossRef]
- Bottomley, A.L.; Liew, A.T.F.; Kusuma, K.D.; Peterson, E.; Seidel, L.; Foster, S.J.; Harry, E.J. Coordination of chromosome segregation and cell division in Staphylococcus aureus. Front. Microbiol. 2017, 8, 1575. [Google Scholar] [CrossRef] [Green Version]
- Du, S.; Lutkenhaus, J. At the heart of bacterial cytokinesis: The Z ring. Trends Microbiol. 2019, 27, 781–791. [Google Scholar] [CrossRef]
- Ma, X.; Ehrhardt, D.W.; Margolin, W. Colocalization of cell division proteins FtsZ and FtsA to cytoskeletal structures in living Escherichia coli cells by using green fluorescent protein. Proc. Natl. Acad. Sci. USA 1996, 93, 12998–13003. [Google Scholar] [CrossRef] [Green Version]
- Dong, L.; Tong, Z.; Linghu, D.; Lin, Y.; Tao, R.; Liu, J.; Tian, Y.; Ni, L. Effects of sub-minimum inhibitory concentrations of antimicrobial agents on Streptococcus mutans biofilm formation. Int. J. Antimicrob. Agents 2012, 39, 390–395. [Google Scholar] [CrossRef]
- Simon, A.; von Einem, T.; Seidinger, A.; Matthey, M.; Bindila, L.; Wenzel, D. The endocannabinoid anandamide is an airway relaxant in health and disease. Nat. Commun. 2022, 13, 6941. [Google Scholar] [CrossRef]
- Jackson, A.R.; Nagarkatti, P.; Nagarkatti, M. Anandamide attenuates Th-17 cell-mediated delayed-type hypersensitivity response by triggering IL-10 production and consequent microRNA induction. PLoS ONE 2014, 9, e93954. [Google Scholar] [CrossRef]
- Calignano, A.; La Rana, G.; Giuffrida, A.; Piomelli, D. Control of pain initiation by endogenous cannabinoids. Nature 1998, 394, 277–281. [Google Scholar] [CrossRef] [Green Version]
- Mock, E.D.; Gagestein, B.; van der Stelt, M. Anandamide and other N-acylethanolamines: A class of signaling lipids with therapeutic opportunities. Prog. Lipid Res. 2023, 89, 101194. [Google Scholar] [CrossRef] [PubMed]
- Sionov, R.V.; Tsavdaridou, D.; Aqawi, M.; Zaks, B.; Steinberg, D.; Shalish, M. Tooth mousse containing casein phosphopeptide-amorphous calcium phosphate prevents biofilm formation of Streptococcus mutans. BMC Oral Health 2021, 21, 136. [Google Scholar] [CrossRef]
- Veerman, E.C.I.; Nazmi, K.; Van’t Hof, W.; Bolscher, J.G.M.; Den Hertog, A.L.; Nieuw Amerongen, A.V. Reactive oxygen species play no role in the candidacidal activity of the salivary antimicrobial peptide histatin 5. Biochem. J. 2004, 381, 447–452. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bernabè, G.; Pauletto, A.; Zamuner, A.; Cassari, L.; Castagliuolo, I.; Brun, P.; Dettin, M. Exploiting conserved quorum sensing signals in Streptococcus mutans and Streptococcus pneumoniae. Microorganisms 2022, 10, 2386. [Google Scholar] [CrossRef] [PubMed]
- Al-Ansari, M.M.; Al-Dahmash, N.D.; Ranjitsingh, A.J.A. Synthesis of silver nanoparticles using gum arabic: Evaluation of its inhibitory action on Streptococcus mutans causing dental caries and endocarditis. J. Infect. Public Health 2021, 14, 324–330. [Google Scholar] [CrossRef]
- Nakano, K.; Lapirattanakul, J.; Nomura, R.; Nemoto, H.; Alaluusua, S.; Grönroos, L.; Vaara, M.; Hamada, S.; Ooshima, T.; Nakagawa, I. Streptococcus mutans clonal variation revealed by multilocus sequence typing. J. Clin. Microbiol. 2007, 45, 2616–2625. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Burne, R.A. Regulation of the gtfBC and ftf genes of Streptococcus mutans in biofilms in response to pH and carbohydrate. Microbiology 2001, 147, 2841–2848. [Google Scholar] [CrossRef] [Green Version]
- Lemos, J.A.; Luzardo, Y.; Burne, R.A. Physiologic effects of forced down-regulation of dnaK and groEL expression in Streptococcus mutans. J. Bacteriol. 2007, 189, 1582–1588. [Google Scholar] [CrossRef] [Green Version]
- Zhu, L.; Kreth, J.; Cross, S.E.; Gimzewski, J.K.; Shi, W.; Qi, F. Functional characterization of cell-wall-associated protein WapA in Streptococcus mutans. Microbiology 2006, 152, 2395–2404. [Google Scholar] [CrossRef] [Green Version]
- Jeong, D.; Kim, D.H.; Song, K.Y.; Seo, K.H. Antimicrobial and anti-biofilm activities of Lactobacillus kefiranofaciens DD2 against oral pathogens. J. Oral Microbiol. 2018, 10, 1472985. [Google Scholar] [CrossRef] [Green Version]
- Shemesh, M.; Tam, A.; Feldman, M.; Steinberg, D. Differential expression profiles of Streptococcus mutans ftf, gtf and vicR genes in the presence of dietary carbohydrates at early and late exponential growth phases. Carbohydr. Res. 2006, 341, 2090–2097. [Google Scholar] [CrossRef]
- Yamamoto, Y.; Higuchi, M.; Poole, L.B.; Kamio, Y. Role of the dpr product in oxygen tolerance in Streptococcus mutans. J. Bacteriol. 2000, 182, 3740–3747. [Google Scholar] [CrossRef] [Green Version]
- Fujishima, K.; Kawada-Matsuo, M.; Oogai, Y.; Tokuda, M.; Torii, M.; Komatsuzawa, H. dpr and sod in Streptococcus mutans are involved in coexistence with S. sanguinis, and PerR is associated with resistance to H2O2. Appl. Environ. Microbiol. 2013, 79, 1436–1443. [Google Scholar] [CrossRef] [Green Version]
- Nascimento, M.M.; Lemos, J.A.; Abranches, J.; Lin, V.K.; Burne, R.A. Role of RelA of Streptococcus mutans in global control of gene expression. J. Bacteriol. 2008, 190, 28–36. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.; Li, Y.; Yuan, C.; Liu, S.; Xin, F.; Deng, X.; Wang, X. Streptococcus mutans cell division protein FtsZ has higher GTPase and polymerization activities in acidic environment. Mol. Oral Microbiol. 2022, 37, 97–108. [Google Scholar] [CrossRef]
- Zaidi, S.; Singh, S.L.; Khan, A.U. Exploring antibiofilm potential of bacitracin against Streptococcus mutans. Microb. Pathog. 2020, 149, 104279. [Google Scholar] [CrossRef]
- Yoshida, A.; Ansai, T.; Takehara, T.; Kuramitsu, H.K. LuxS-based signaling affects Streptococcus mutans biofilm formation. Appl. Environ. Microbiol. 2005, 71, 2372–2380. [Google Scholar] [CrossRef] [Green Version]
- Busuioc, M.; Buttaro, B.A.; Piggot, P.J. The pdh operon is expressed in a subpopulation of stationary-phase bacteria and is important for survival of sugar-starved Streptococcus mutans. J. Bacteriol. 2010, 192, 4395–4402. [Google Scholar] [CrossRef] [Green Version]
- Klein, M.I.; DeBaz, L.; Agidi, S.; Lee, H.; Xie, G.; Lin, A.H.; Hamaker, B.R.; Lemos, J.A.; Koo, H. Dynamics of Streptococcus mutans transcriptome in response to starch and sucrose during biofilm development. PLoS ONE 2010, 5, e13478. [Google Scholar] [CrossRef]
- Jung, H.Y.; Cai, J.N.; Yoo, S.C.; Kim, S.H.; Jeon, J.G.; Kim, D. Collagen peptide in a combinatorial treatment with Lactobacillus rhamnosus inhibits the cariogenic properties of Streptococcus mutans: An in vitro study. Int. J. Mol. Sci. 2022, 23, 1860. [Google Scholar] [CrossRef]
- Jeon, J.G.; Klein, M.I.; Xiao, J.; Gregoire, S.; Rosalen, P.L.; Koo, H. Influences of naturally occurring agents in combination with fluoride on gene expression and structural organization of Streptococcus mutans in biofilms. BMC Microbiol. 2009, 9, 228. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fozo, E.M.; Quivey, R.G., Jr. The fabM gene product of Streptococcus mutans is responsible for the synthesis of monounsaturated fatty acids and is necessary for survival at low pH. J. Bacteriol. 2004, 186, 4152–4158. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jeon, J.G.; Pandit, S.; Xiao, J.; Gregoire, S.; Falsetta, M.L.; Klein, M.I.; Koo, H. Influences of trans-trans farnesol, a membrane-targeting sesquiterpenoid, on Streptococcus mutans physiology and survival within mixed-species oral biofilms. Int. J. Oral Sci. 2011, 3, 98–106. [Google Scholar] [CrossRef] [PubMed]
- Sato, Y.; Okamoto-Shibayama, K.; Azuma, T. The malQ gene is essential for starch metabolism in Streptococcus mutans. J. Oral Microbiol. 2013, 5, 21285. [Google Scholar] [CrossRef] [Green Version]
Species | MIC | MBIC |
---|---|---|
S. mutans | 12.5 µg/mL | 12.5 µg/mL |
S. sobrinus | 12.5 µg/mL | 12.5 µg/mL |
S. sanguinis | 12.5 µg/mL | 12.5 µg/mL |
Genes | Gene Function | Forward Primers | Reverse Primers | Reference |
---|---|---|---|---|
gyrA | DNA gyrase subunit, used as housekeeping gene [45] | TACAGGTGATGTCATGGGTAAATAC | CCGGGTAGTACTTCCATTAGGTCAC | [46] |
gtfB | Glycosyltransferase-I catalyzes the formation of water-insoluble adherent glucans (one type of EPS) [45] | AGCAATGCAGCCAATCTACAAAT | ACGAACTTTGCCGTTATTGTCA | [21] |
gtfC | Glycosyltransferase-SI catalyzes the formation of water-insoluble adherent glucans (one type of EPS) [45] | GGTTTAACGTCAAAATTAGCTGTATT | CTCAACCAACCGCCACTGTT | [21] |
gbpB | Glucan-binding protein B. It mediates cell surface interactions with glucans [45] | AGGGCAATGTACTTGGGGTG | TTTGGCCACCTTGAACACCT | [21] |
brpA | Biofilm-regulating protein A. It regulates biofilm formation, autolysis, cell division, and acid and oxidative stress responses [45] | GGAGGAGCTGCATCAGGATTC | AACTCCAGCACATCCAGCAAG | [21] |
ftf | Fructosyltransferase (Levansucrase) catalyzes the formation of fructans (one type of EPS) [47] | AAATATGAAGGCGGCTACAACG | CTTCACCAGTCTTAGCATCCTGAA | [21] |
secA | Protein translocase subunit SecA involved in the secretion of virulence factors [31] | ATCATGGTACGTGTCACATCAA | CAGAATAATCCTATTGTTGAAT | [31] |
pac | Major cell surface protein antigen c (PAc) is an adhesin that promotes bacterial adhesion to tooth surfaces [31] | AGCTGGAGAGACAAATGGTTCAT | GACACCAGCAGACTTAGCATCTT | [31] |
dnaK | A chaperone protein (Hsp70) involved in environmental stress responses [48] | GCAGGTCAAGAGGGAGCTCA | CCGCCCTTGTCTGAGAATC | [21] |
groEL | A chaperone protein (Hsp60) involved in environmental stress responses [48] | CCAGGAGCTTTGACTGCGAC | TTGCGGATGATGATGTAGATGGT | [21] |
wapA | Wall-associated protein assists in adhesion to tooth surface and is involved in biofilm formation [49] | GCACGCTTGCAGTACATTGC | CATAAGGTCGCGAGCAGCT | [21] |
spaP | Surface protein antigen P is cleaved into the two cell surface antigens I/II involved in sucrose-independent adhesion [45] | GACTTTGGTAATGGTTATGCATCAA | TTTGTATCAGCCGGATCAAGTG | [50] |
vicR | A global response regulator which is part of the two-component VicRK system. It regulates expression of genes associated with cell wall biogenesis and biofilm formation [51] | CGCAGTGGCTGAGGAAAATG | ACCTGTGTGTGTCGCTAAGTGATG | [21] |
nox | NADH oxidase reduces diatomic oxygen to water when oxidizing NADH to NAD+, thereby acting as a reactive oxygen species scavenger [52] | GGGTTGTGGAATGGCACTTTGG | CAATGGCTGTCACTGGCGATTC | [21] |
sodA | Superoxidase dismutase converts superoxide anions to molecular oxygen and water and thus constitutes a major defense mechanism against oxidative stress [53] | GCAGTGCTAAGACTCCCGAATC | TTGCGGAAGTGTGAGATTGGC | [21] |
relA | GTP diphosphokinase is involved in the production of (p)ppGpp, which mediates the stringent responses. It regulates biofilm formation and glucose uptake [54] | ACAAAAAGGGTATCGTCCGTACAT | AATCACGCTTGGTATTGCTAATTG | [21] |
ftsZ | A GTPase cell division protein involved in formation of the Z-ring of the septum [55] | CAACCAAGAGCACAACAGCAAG | ACGACGAAGATTCCAATCGCC | [56] |
luxS | LuxS encodes for a precursor of autoinducer-2, which is involved in quorum sensing and biofilm formation [57] | ACTGTTCCCCTTTTGGCTGTC | AACTTGCTTTGATGACTGTGGC | [21] |
pdhA | Pyruvate dehydrogenase A (Acetoin dehydrogenase) is involved in glycolysis. It contributes to bacterial survival in acidic environments [58] | ATGCCAAACTATAAAGATTTAC | TCTTGGGCTTCAATATCT | [59] |
atpD | The ATP synthase β-subunit of F1F0-H/ATPase, which produces ATP from ADP in the presence of a proton gradient across the membrane. It promotes tolerance to acidic stress by pumping out protons [60] | CGTGCTCTCTCGCCTGAAATAG | ACTCACGATAACGCTGCAAGAC | [61] |
aguD | Agmatine:putrescine antiporter comprising the agmatine deiminase system, which produce the alkaline conditions required for acid tolerance [60] | ATCCCGTGAGTGATAGTATTTG | CAAGCCACCAACAAGTAAGG | [61] |
fabM | Trans-2-decenoyl-(acyl-carrier-protein) isomerase is responsible for the synthesis of monounsaturated fatty acids and is required for survival at low pH (acid tolerance) [62] | ACTGATTAATGCCAATGGGAAAGTC | TGCGAACAAGAGATTGTACATCATC | [63] |
glgP | Alpha-1,4 glucan phosphorylase catalyzes the rate-limiting step in glycogen catabolism and is thus involved in glucose homeostasis [64] | GACTTTAAAGACACTCTGCATGAAG | ACGAACAACCTTAGCCAAAGAAG | [63] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wolfson, G.; Sionov, R.V.; Smoum, R.; Korem, M.; Polacheck, I.; Steinberg, D. Anti-Bacterial and Anti-Biofilm Activities of Anandamide against the Cariogenic Streptococcus mutans. Int. J. Mol. Sci. 2023, 24, 6177. https://doi.org/10.3390/ijms24076177
Wolfson G, Sionov RV, Smoum R, Korem M, Polacheck I, Steinberg D. Anti-Bacterial and Anti-Biofilm Activities of Anandamide against the Cariogenic Streptococcus mutans. International Journal of Molecular Sciences. 2023; 24(7):6177. https://doi.org/10.3390/ijms24076177
Chicago/Turabian StyleWolfson, Goldie, Ronit Vogt Sionov, Reem Smoum, Maya Korem, Itzhack Polacheck, and Doron Steinberg. 2023. "Anti-Bacterial and Anti-Biofilm Activities of Anandamide against the Cariogenic Streptococcus mutans" International Journal of Molecular Sciences 24, no. 7: 6177. https://doi.org/10.3390/ijms24076177
APA StyleWolfson, G., Sionov, R. V., Smoum, R., Korem, M., Polacheck, I., & Steinberg, D. (2023). Anti-Bacterial and Anti-Biofilm Activities of Anandamide against the Cariogenic Streptococcus mutans. International Journal of Molecular Sciences, 24(7), 6177. https://doi.org/10.3390/ijms24076177