Comparative Analysis of Chloroplast Genome of Desmodium stryacifolium with Closely Related Legume Genome from the Phaseoloid Clade
Abstract
:1. Introduction
2. Results
2.1. Features of the D. styracrifolium Chloroplast Genome
2.2. Comparative Analysis with Other Chloroplast Genomes from the Desmodieae Tribe
2.2.1. Gene Content
2.2.2. Gene/Intron Loss
2.2.3. Sequence Divergence Analysis
2.2.4. Repeat Sequence Analysis
2.2.5. IR Expansion and Contraction
2.2.6. Phylogenetic Relationship
3. Discussion
4. Materials and Methods
4.1. Plant Materials and DNA Extractions
4.2. DNA Sequencing, and Genome Assembly and Annotation
4.3. Sequence Analysis
4.4. PCR Amplification
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Daniell, H.; Lin, C.S.; Yu, M.; Chang, W.J. Chloroplast genomes: Diversity, evolution, and applications in genetic engineering. Genome Biol. 2016, 17, 134. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sugiura, M. The chloroplast genome. Plant Mol. Biol. 1992, 19, 149–168. [Google Scholar] [CrossRef] [PubMed]
- Wicke, S.; Schneeweiss, G.M.; dePamphilis, C.W.; Müller, K.F.; Quandt, D. The evolution of the plastid chromosome in land plants: Gene content, gene order, gene function. Plant Mol. Biol. 2011, 76, 273–297. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thode, V.A.; Lohmann, L.G. Comparative Chloroplast Genomics at Low Taxonomic Levels: A Case Study Using Amphilophium (Bignonieae, Bignoniaceae). Front. Plant Sci. 2019, 10, 796. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Zhou, T.; Bai, G.; Zhao, Y. Complete chloroplast genome sequence of Fagopyrum dibotrys: Genome features, comparative analysis, and phylogenetic relationships. Sci. Rep. 2018, 8, 2907. [Google Scholar] [CrossRef] [Green Version]
- Li, B.; Zheng, Y. Dynamic evolution and phylogenomic analysis of the chloroplast genome in Schisandraceae. Sci. Rep. 2018, 8, 9285. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Birky, C.W., Jr. Uniparental inheritance of mitochondrial and chloroplast genes: Mechanisms and evolution. Proc Natl. Acad. Sci. USA 1995, 92, 11331–11338. [Google Scholar] [CrossRef] [Green Version]
- Huo, Y.; Gao, L.; Liu, B.; Yang, Y.; Kong, S.; Sun, Y.; Yang, Y.; Wu, X. Complete chloroplast genome sequences of four Allium species: Comparative and phylogenetic analyses. Sci. Rep. 2019, 9, 12250. [Google Scholar] [CrossRef] [Green Version]
- Azani, N.; Babineau, M.; Bailey, C.D.; Banks, H.; Barbosa, A.R.; Pinto, R.B.; Boatwright, J.S.; Borges, L.M.; Brown, G.K.; Bruneau, A.; et al. A new subfamily classification of the Leguminosae based on a taxonomically comprehensive phylogeny—The Legume Phylogeny Working Group (LPWG). Taxon 2018, 66, 44–77. [Google Scholar] [CrossRef] [Green Version]
- Lewis, G.P. (Ed.) Legumes of the World; Royal Botanic Gardens, Kew: Richmond, UK, 2005. [Google Scholar]
- Wojciechowski, M.F. Reconstructing the Phylogeny of Legumes (Leguminosae): An Early 21st Century Perspective. Adv. Legume Syst. 2003, 10, 5–35. [Google Scholar]
- Jabbour, F.; Gaudeul, M.; Lambourdière, J.; Ramstein, G.; Hassanin, A.; Labat, J.N.; Sarthou, C. Phylogeny, biogeography, and character evolution in the tribe Desmodieae (Fabaceae: Papilionoideae), with special emphasis on the New Caledonian endemic genera. Mol. Phylogenetics Evol. 2018, 118, 108–121. [Google Scholar] [CrossRef]
- Lai, S.C.; Ho, Y.L.; Huang, S.C.; Huang, T.H.; Lai, Z.R.; Wu, C.R.; Lian, K.Y.; Chang, Y.S. Antioxidant and Antiproliferative Activities of Desmodium triflorum (L.) DC. Am. J. Chin. Med. 2010, 38, 329–342. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, W.; Sun, Y.N.; Yan, X.T.; Yang, S.Y.; Kim, S.; Chae, D.; Hyun, J.W.; Kang, H.K.; Koh, Y.S.; Kim, Y.H. Anti-inflammatory and antioxidant activities of phenolic compounds from Desmodium caudatum leaves and stems. Arch. Pharmacal Res. 2014, 37, 721–727. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Zheng, C.; Hu, C.; Rahman, K.; Qin, L. The genus Desmodium (Fabaceae)-traditional uses in Chinese medicine, phytochemistry and pharmacology. J. Ethnopharmacol. 2011, 138, 314–332. [Google Scholar] [CrossRef] [PubMed]
- Giang, P.M.; Son, P.T.; Matsunami, K.; Otsuka, H. Flavonoid compounds from Desmodium styracifolium of Vietnamese origin. Chem. Nat. Compd. 2010, 46, 797–798. [Google Scholar] [CrossRef]
- Liu, M.; Liu, C.; Chen, H.; Huang, X.; Zeng, X.; Zhou, J.; Mi, S. Prevention of cholesterol gallstone disease by schaftoside in lithogenic diet induced C57BL/6 mouse model. Eur. J. Pharmacol. 2017, 815, 1–9. [Google Scholar] [CrossRef]
- Gantt, J.S.; Baldauf, S.L.; Calie, P.J.; Weeden, N.F.; Palmer, J.D. Transfer of rpl22 to the nucleus greatly preceded its loss from the chloroplast and involved the gain of an intron. EMBO J. 1991, 10, 3073–3078. [Google Scholar] [CrossRef]
- Millen, R.S.; Olmstead, R.G.; Adams, K.L.; Palmer, J.D.; Lao, N.T.; Heggie, L.; Kavanagh, T.A.; Hibberd, J.M.; Gray, J.C.; Morden, C.W.; et al. Many Parallel Losses of infA from Chloroplast DNA during Angiosperm Evolution with Multiple Independent Transfers to the Nucleus. Plant Cell 2001, 13, 645–658. [Google Scholar] [CrossRef] [Green Version]
- Somaratne, Y.; Guan, D.L.; Wang, W.Q.; Zhao, L.; Xu, S.Q. The Complete Chloroplast Genomes of Two Lespedeza Species: Insights into Codon Usage Bias, RNA Editing Sites, and Phylogenetic Relationships in Desmodieae (Fabaceae: Papilionoideae). Plants 2020, 9, 51. [Google Scholar] [CrossRef] [Green Version]
- de Souza, U.J.B.; Nunes, R.; Targueta, C.P.; Diniz-Filho, J.A.F.; Telles, M.P.d.C. The complete chloroplast genome of Stryphnodendron adstringens (Leguminosae—Caesalpinioideae): Comparative analysis with related Mimosoid species. Sci. Rep. 2019, 9, 14206. [Google Scholar] [CrossRef] [Green Version]
- Tangphatsornruang, S.; Sangsrakru, D.; Chanprasert, J.; Uthaipaisanwong, P.; Yoocha, T.; Jomchai, N.; Tragoonrung, S. The Chloroplast Genome Sequence of Mungbean (Vigna radiata) Determined by High-throughput Pyrosequencing: Structural Organization and Phylogenetic Relationships. DNA Res. 2010, 17, 11–22. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Weng, M.-L.; Blazier, J.C.; Govindu, M.; Jansen, R.K. Reconstruction of the Ancestral Plastid Genome in Geraniaceae Reveals a Correlation between Genome Rearrangements, Repeats, and Nucleotide Substitution Rates. Mol. Biol. Evol. 2014, 31, 645–659. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaila, T.; Chaduvla, P.K.; Saxena, S.; Bahadur, K.; Gahukar, S.J.; Chaudhury, A.; Sharma, T.R.; Singh, N.K.; Gaikwad, K. Chloroplast Genome Sequence of Pigeonpea (Cajanus cajan (L.) Millspaugh) and Cajanus scarabaeoides (L.) Thouars: Genome Organization and Comparison with Other Legumes. Front. Plant Sci. 2016, 7, 1847. [Google Scholar] [CrossRef] [PubMed]
- Huerta-Cepas, J.; Serra, F.; Bork, P. ETE 3: Reconstruction, Analysis, and Visualization of Phylogenomic Data. Mol. Biol. Evol. 2016, 33, 1635–1638. [Google Scholar] [CrossRef] [Green Version]
- Price, M.N.; Dehal, P.S.; Arkin, A.P. FastTree: Computing Large Minimum Evolution Trees with Profiles instead of a Distance Matrix. Mol. Biol. Evol. 2009, 26, 1641–1650. [Google Scholar] [CrossRef]
- Jin, D.P.; Choi, I.S.; Choi, B.H. Plastid genome evolution in tribe Desmodieae (Fabaceae: Papilionoideae). PLoS ONE 2019, 14, e0218743. [Google Scholar] [CrossRef] [Green Version]
- Boudreau, E.; Takahashi, L.C.; Turmel, M.; Rochaix, J.D. The chloroplast ycf3 and ycf4 open reading frames of Chlamydomonas reinhardtii are required for the accumulation of the photosystem I complex. EMBO J 1997, 16, 6095–6104. [Google Scholar] [CrossRef] [Green Version]
- Krech, K.; Ruf, S.; Masduki, F.F.; Thiele, W.; Bednarczyk, D.; Albus, C.A.; Tiller, N.; Hasse, C.; Schöttler, M.A.; Bock, R. The Plastid Genome-Encoded Ycf4 Protein Functions as a Nonessential Assembly Factor for Photosystem I in Higher Plants. Plant Physiol. 2012, 159, 579–591. [Google Scholar] [CrossRef] [Green Version]
- Magee, A.M. Plastid genes transcribed by the nucleus-encoded plastid RNA polymerase show increased transcript accumulation in transgenic plants expressing a chloroplast-localized phage T7 RNA polymerase. J. Exp. Bot. 2002, 53, 2341–2349. [Google Scholar] [CrossRef] [Green Version]
- Xiao-Ming, Z.; Junrui, W.; Li, F.; Sha, L.; Hongbo, P.; Lan, Q.; Jing, L.; Yan, S.; Weihua, Q.; Lifang, Z.; et al. Inferring the evolutionary mechanism of the chloroplast genome size by comparing whole-chloroplast genome sequences in seed plants. Sci Rep. 2017, 7, 1555. [Google Scholar] [CrossRef]
- Tillich, M.; Lehwark, P.; Morton, B.R.; Maier, U.G. The Evolution of Chloroplast RNA Editing. Mol. Biol. Evol. 2006, 23, 1912–1921. [Google Scholar] [CrossRef] [Green Version]
- Jiao, Y.; Guo, H. Prehistory of the Angiosperms. Adv. Bot. Res. 2014, 69, 223–245. [Google Scholar]
- Saski, C.; Lee, S.B.; Daniell, H.; Wood, T.C.; Tomkins, J.; Kim, H.G.; Jansen, R.K. Complete Chloroplast Genome Sequence of Glycine max and Comparative Analyses with other Legume Genomes. Plant Mol. Biol. 2005, 59, 309–322. [Google Scholar] [CrossRef] [PubMed]
- Powell, W.; Morgante, M.; McDevitt, R.; Vendramin, G.G.; Rafalski, J.A. Polymorphic simple sequence repeats regions in chloroplast genomes: Applications to the population genetics of pines. Proc. Natl. Acad. Sci. USA 1995, 92, 7759–7763. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Provan, J.; Russell, J.R.; Booth, A.; Powell, W. Polymorphic chloroplast simple sequence repeat primers for systematic and population studies in the genus Hordeum. Mol. Ecol. 1999, 8, 505–511. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sahu, S.K.; Thangaraj, M.; Kathiresan, K. DNA Extraction Protocol for Plants with High Levels of Secondary Metabolites and Polysaccharides without Using Liquid Nitrogen and Phenol. ISRN Mol. Biol. 2012, 2012, 205049. [Google Scholar] [CrossRef] [Green Version]
- Greiner, S.; Lehwark, P.; Bock, R. OrganellarGenomeDRAW (OGDRAW) version 1.3.1: Expanded toolkit for the graphical visualization of organellar genomes. Nucleic Acids Res. 2019, 47, W59–W64. [Google Scholar] [CrossRef] [Green Version]
- Frazer, K.A.; Pachter, L.; Poliakov, A.; Rubin, E.M.; Dubchak, I. VISTA: Computational tools for comparative genomics. Nucleic Acids Res. 2004, 32, W273–W279. [Google Scholar] [CrossRef] [Green Version]
- Thompson, J.D.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F.; Higgins, D.G. The CLUSTAL_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997, 25, 4876–4882. [Google Scholar] [CrossRef] [Green Version]
- Rozas, J.; Ferrer-Mata, A.; Sánchez-DelBarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sánchez-Gracia, A. DnaSP 6: DNA Sequence Polymorphism Analysis of Large Data Sets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef]
- Beier, S.; Thiel, T.; Münch, T.; Scholz, U.; Mascher, M. MISA-web: A web server for microsatellite prediction. Bioinformatics 2017, 33, 2583–2585. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Features | D. styracifolium | D. heterocarpon | H. podocarpum | O. caudata | L. maritima | C. macrocarpa | Vigna radiata |
---|---|---|---|---|---|---|---|
Genome size | 149,155 | 149,696 | 149,564 | 150,249 | 149,022 | 148,814 | 151,271 |
LSC Length | 82,476 | 82,967 | 83,125 | 83,241 | 82,429 | 82,566 | 80,896 |
SSC Length | 18,439 | 18,441 | 18,159 | 18,480 | 18,939 | 18,808 | 17,427 |
IR length | 24,120 | 24,144 | 24,140 | 24,264 | 23,827 | 23,720 | 26,474 |
Coding Size | 78,033 | 77,427 | 77,925 | 78,045 | 77,265 | 77,925 | 77,469 |
GC content | 35.2 | 35.2 | 35.2 | 35.1 | 35.0 | 34.9 | 35.4 |
Total genes | 128 | 128 | 128 | 128 | 128 | 128 | 127 |
Protein-coding genes | 83 | 83 | 83 | 83 | 83 | 83 | 83 |
Duplicated genes | 17 | 17 | 17 | 17 | 17 | 17 | 19 |
tRNA genes | 37 | 37 | 37 | 37 | 37 | 37 | 36 |
rRNA genes | 8 | 8 | 8 | 8 | 8 | 8 | 8 |
Genes-with introns | 19 | 19 | 19 | 19 | 19 | 19 | 18 |
Pseudogenes | ycf4 | rpl33, rps16 |
Intergenic Space | Coding Region | Region of Introns | |
---|---|---|---|
Desmodium styracifolium | 41 | 8 | 1 |
Desmodium heterocarpon | 42 | 8 | 2 |
Hylodesmum podocarpum | 33 | 7 | 2 |
Ohwia caudate | 23 | 11 | 4 |
Lespedeza maritima | 40 | 8 | 3 |
Campylotropis macrocarpa | 45 | 9 | 4 |
Vigna radiata | 24 | 8 | 2 |
Total | 248 | 59 | 18 |
SSR Type | Repeat Unit | D. styracifolium | D. heterocarpon | H. podocarpum | O. caudata | L. maritima | C. macrocarpa | V. radiata | Total |
---|---|---|---|---|---|---|---|---|---|
Mono | A/T | 49 | 50 | 56 | 55 | 44 | 45 | 38 | 337 |
C/G | 0 | 0 | 2 | 0 | 2 | 0 | 0 | 4 | |
Di | AT/AT | 8 | 10 | 32 | 8 | 7 | 12 | 5 | 82 |
Tri | AAT/ATT | 0 | 0 | 0 | 0 | 0 | 2 | 1 | 3 |
Primer | Sequence |
---|---|
PIF | TCTTATTTTTCAGTTATTAAATCCCCT |
PIR | GGGGGCGGTATTCTACCTA |
P2F | ACGCAACTTTTTCAGTGATTCT |
P2R | GCGCCTTTGCATCTAGCATT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yen, L.-T.; Kousar, M.; Park, J. Comparative Analysis of Chloroplast Genome of Desmodium stryacifolium with Closely Related Legume Genome from the Phaseoloid Clade. Int. J. Mol. Sci. 2023, 24, 6072. https://doi.org/10.3390/ijms24076072
Yen L-T, Kousar M, Park J. Comparative Analysis of Chloroplast Genome of Desmodium stryacifolium with Closely Related Legume Genome from the Phaseoloid Clade. International Journal of Molecular Sciences. 2023; 24(7):6072. https://doi.org/10.3390/ijms24076072
Chicago/Turabian StyleYen, Le-Thi, Muniba Kousar, and Joonho Park. 2023. "Comparative Analysis of Chloroplast Genome of Desmodium stryacifolium with Closely Related Legume Genome from the Phaseoloid Clade" International Journal of Molecular Sciences 24, no. 7: 6072. https://doi.org/10.3390/ijms24076072
APA StyleYen, L.-T., Kousar, M., & Park, J. (2023). Comparative Analysis of Chloroplast Genome of Desmodium stryacifolium with Closely Related Legume Genome from the Phaseoloid Clade. International Journal of Molecular Sciences, 24(7), 6072. https://doi.org/10.3390/ijms24076072