Next Article in Journal
Mutational and Environmental Effects on the Dynamic Conformational Distributions of Lys48-Linked Ubiquitin Chains
Next Article in Special Issue
Assembly of the Complete Mitochondrial Genome of Pereskia aculeata Revealed That Two Pairs of Repetitive Elements Mediated the Recombination of the Genome
Previous Article in Journal
Generation of a Perfusable 3D Lung Cancer Model by Digital Light Processing
Previous Article in Special Issue
Pan-Plastome of Greater Yam (Dioscorea alata) in China: Intraspecific Genetic Variation, Comparative Genomics, and Phylogenetic Analyses
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Comparative Analysis of Chloroplast Genome of Desmodium stryacifolium with Closely Related Legume Genome from the Phaseoloid Clade

Department of Fine Chemistry, Seoul National University of Science and Technology, Seoul 01811, Republic of Korea
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(7), 6072; https://doi.org/10.3390/ijms24076072
Submission received: 9 February 2023 / Revised: 13 March 2023 / Accepted: 14 March 2023 / Published: 23 March 2023

Abstract

Desmodium styracifolium is a medicinal plant from the Desmodieae tribe, also known as Grona styracifolia. Its role in the treatment of urolithiasis, urinary infections, and cholelithiasis has previously been widely documented. The complete chloroplast genome sequence of D. Styracifolium is 149,155 bp in length with a GC content of 35.2%. It is composed of a large single copy (LSC) of 82,476 bp and a small single copy (SSC) of 18,439 bp, which are separated by a pair of inverted repeats (IR) of 24,120 bp each and has 128 genes. We performed a comparative analysis of the D. styracifolium cpDNA with the genome of previously investigated members of the Sesamoidea tribe and on the outgroup from its Phaseolinae sister tribe. The size of all seven cpDNAs ranged from 148,814 bp to 151,217 bp in length due to the contraction and expansion of the IR/SC boundaries. The gene orientation of the SSC region in D. styracifolium was inverted in comparison with the other six studied species. Furthermore, the sequence divergence of the IR regions was significantly lower than that of the LSC and the SSC, and five highly divergent regions, trnL-UAA-trnT-UGU, psaJ-ycf4, psbE-petL, rpl36-rps8, and rpl32-trnL-UGA, were identified that could be used as valuable molecular markers in future taxonomic studies and phylogenetic constructions.

1. Introduction

Chloroplasts are vital to plant organelles that function as metabolic centers. They possess their own genomes (cpDNA), which generally encode 110–130 genes and are essential for the photosynthesis pathways and the biosynthesis of nucleotides, fatty acids, starch, and pigments [1,2,3]. Plastid chromosomes are circularized, ranging from 120 to 160 kb [3], and contain a quadripartite architecture with two inverted repeat regions (IRs) that separate a large single-copy region (LSC) from a small single-copy region (SSC) [4,5]. The structural features and gene content of the plastome are highly conserved among land plants [6]. In addition, uniparental inheritance, low rates of substitution, and their small size, in comparison to the nuclear genome, facilitate their use as important models for evolutionary studies [7,8].
The Fabaceae or Leguminosae, commonly called the legume family, contain six subfamilies: Caesalpinideae, Cercidoideae, Detarioideae, Dialioideae, Duoarquetioideae, and Papilionoideae [9]. There has been morphological evidence and results from recent molecular phylogenetic studies suggesting that Fabaceae is a monophyletic family [10]. This family is composed of approximately 751 genera and over 19,500 species, and plays a crucial role in ecological habitat, boosting the economy, and providing a long-standing model for evolutionary studies [11].
The tribe, Desmodieae, is a large member of the Phaseoloid clade belonging to the Papolionoideae subfamily, which comprises the Desmodium, Lespedeza, and Phyllodium clades [12]. In several Asian regions, many species from this tribe are used as medicinal herbs because of their high levels of antioxidant and anti-inflammatory components [13,14,15]. Specifically, Desmodium styracifolium, from the tribe Desmodieae, is an important species in herbal medicine and has been employed to treat hepatitis and various types of urinary diseases such as renal stones, urinary tract infections, edema, and gallstone diseases [15,16,17]. While the whole plant has been used in traditional medicine, phytochemistry, and pharmacology, the complete chloroplast genome has not been previously sequenced or analyzed.
This investigation characterized the Desmodium styracifolium complete chloroplast genome and performed a comparative genome analysis with other Desmodieae species. We explored the taxonomic position of D. styracifolium as well as the genetic relationship between Desmodium styracifolium and other species in the same tribe, as it can serve as a reference for future studies of the Desmodieae tribe.

2. Results

2.1. Features of the D. styracrifolium Chloroplast Genome

The complete chloroplast genome of D. styracifolium was determined to be 149,155 bp in length and exhibits a four-region structure, with a pair of IR regions that are 24,120 bp each, separated by an LSC region and an SSC region with lengths of 82,476 bp and 18,439 bp, respectively. The complete genome harbors 128 genes, comprising 83 protein-coding genes, 37tRNA, and 8rRNA genes, in which LSC and SSC contain 82 genes and 12 genes, respectively, while 17 genes were duplicated in the IRs, shown in Figure 1. The protein-coding genes accounted for 55.3% (82,476 bp) of the total genome, whereas the remaining regions were composed of rRNA, tRNA, introns, and intergenic species.
In addition, we observed 19 intron-containing genes, in which 17 genes contained 1 intron (10 protein-coding genes and 7 tRNA genes) and 2 genes contained 2 introns (ycf3 and clnp), trnK-UUU was found to have the largest intron, at 2626 bp, while the smallest intron found was in trn4-UDG, at 40 bp. The total GC content of the cpDNA was 35.2% and there were distinct differences between the 3 regions. The highest content exhibited in the IR regions with 42.1% was followed by the LSC, 32.8%, while the lowest content was observed in the SSC with 28.1%. There were 27,492 codons in the protein-coding genes, of which, leucine was the most common amino acid and was encoded by 11.3% of all codons.

2.2. Comparative Analysis with Other Chloroplast Genomes from the Desmodieae Tribe

2.2.1. Gene Content

The D. styracifolium genome was compared to six Desmodieae species, namely Desmodium heterocarpon (NC_044113.1), Hylodesmum podocarpum (MG867568.1), Lespedeza mariticma (NC_044115.1), Ohwia caudate (NC_044105.1), and Campylotropis macrocarpa (NC_044100.1), alongside one outgroup, Vigna radiata (NC_013843.1). A detailed summary of their genomic features is shown in Table 1. The genome size ranged from 148,814 bp (C. macrocarpa) to 151,217 bp (V. radiata) in length. They exhibited typically quadripartite structures, consisting of the LSC (80,896–83,241 bp) and SSC (17,427–18,939 bp), separated by two IRs (23,720–26,474 bp).
In Table 1, a highly conserved structure was indicated in the Desmodieae complete chloroplast genome, regarding their gene content. This genome contained 128 genes, including 83 protein-coding, 37 tRNA genes, and 8 rRNA genes, while Vigna contained 127 genes with 1 tRNA (trnG-GCC) fewer than Desmodieae. There are 17 duplicated genes in Desmodieae, including 4 rRNA and 13 different genes (rps12, rpl2, rpl23, trnI-CAU, ycf2, trnL-CAA, ndhB, rps7, trnV-GAC, trnI-GAU, trnA-UGC, trnR-ACG, and trnN-GUU), while Vigna contained 1 more duplicated gene than Desmodium, rps19. Moreover, 19 intron-containing genes were found in the Desmodieae genomes. Two genes (ycf3 and clpP) had two introns and the remaining seventeen had single introns, including nine protein-coding genes and eight tRNA genes. However, there were 20 intron-containing genes in Vigna radiata, owing to the presence of an intron in two rpl2 genes and the loss of trnG-UCC.

2.2.2. Gene/Intron Loss

This study found that rpl22 and infA genes were lost in the seven chloroplast genomes due to their multiple transfers to the nucleus during evolution [18,19]. The seven chloroplast genomes were in accordance with this report. Moreover, the ycf4 gene was non-functional in D. heterocarpon because of numerous internal stop codons and its lost initial start codon, although it is functional in the others. A similar observation was seen for the sequence of the rps16 gene in V. radiata, which led to a loss of function. In addition, Vigna witnessed the rpl33 gene as a non-functional gene due to the premature stop codon. As a result, rpl22 and infA of Faboideae, the ycf4 gene of D. heterocarpon, and the rps16 and rpl33 genes of V. radiata, were pseudogenes. Moreover, all Desmodieae species showed a loss of intron regions in the rps12 and rpl2 genes, whereas the rpl2 was an intron-containing gene in V. radiata. and rps12 was a trans-spliced gene in all species, with a 3′ end duplication in the IR regions and a 5′ end located in the LSC.

2.2.3. Sequence Divergence Analysis

A structural characteristic comparison of D. styracifolium and six related species was performed using mVISTA. The results indicated that the D. styracifolium chloroplast genome was closer to D. heterocarpon and was most distinct from Vigna radiata. Figure 2 showed in detail that the coding region was more conserved than the non-coding region and the IR regions had the lowest level of divergence, compared to the LSC and SSC regions. These results were in arrangement with the pattern demonstrated in other legumes—for example, Lespedeza [20], Stryphnodendron [21], and Vigna [22]. The elevated level of nucleotide divergence was observed in several genes, matK/trnK, ycf4, rpl33, rpl16, ycf1, and in the intron regions of clpP and rps16. Moreover, intergenic spacer regions were in remarkably divergent regions, such as between trnH-GUG-psbA, trnK-rbcL, ndhJ-trnF-GAA, trnL UAA-trnT-UGU, petA-psbJ, psbE-petL, rps3-rps19, trnL-UAG-rpl32, and rpl32-ndhF.
The nucleotide variability (Pi) values among six Desmodieae species were calculated using DnaSP software version 6.10.03. The mean Pi value was estimated to be 0.0472, ranging from 0 to 0.254, and revealed a noticeable divergence among the sequences. As expected, we observed a consistent result with the diversity reported for the comparison of the cpDNA sequences. Briefly, the results showed that the SSC contains the highest levels of nucleotide diversity, followed by the LSC, while the IRs were the most conserved regions (Figure 3).
The comparative analysis of the genome structure among the seven species revealed an SSC inversion in D. styracifolium. The gene orientation in the SSC region is shown in Figure 4A. In D. styracifolium, the gene ycf1 was located at the IRb/SSC junction, then, followed by rps15, ndhH, ndhA, ndhI, ndhG, ndhE, psaC, ndhD, ccsA, trnL, rpl32, and ycf1 at the IRb/SSC junction. The other six genomes had the completely same gene order as D. styracifolium, although in the reverse order.
To further confirm the orientation of the SSC regions in D. styracifolium, PCR amplification was employed. Two pairs of primers were designed to amplify the IR/SSC junction, shown in Figure 4B. At the IRa/SSC boundary, the GC content was exceptionally low for primer design; thus, half the length was in the IRa and the other half in the SSC, while the primer, P2R, was 180 bp away from the SSC boulder. Figure 4C illustrates that lanes 1 and 3 provided PCR products from the primer pairs of P1F/P1R and P2F/P2R, while no PCR product is shown in lane 2 from using the primers P1F/P2F.

2.2.4. Repeat Sequence Analysis

The significant correlation between the number of repeat sequences with gene arrangement of the chloroplast genomes has previously been demonstrated [23]. Herein, a total of 325 tandem repeats were detected in the seven studied cpDNA genomes. C. macrocarpa contained the largest number of repeats (58), while V. radiata had the fewest (34). Among these repeats, 248 (76.3%) were in the intergenic spaces (IGS), followed by 59 (18.2%) in the coding regions, and the remaining 18 (5.5%) were found in the introns (Table 2). Repeat sequences in the IGS were abundant in C. macrocarpa (45), D. heterocarpon (42), D. styracifolium (41), and L. maritima (40), while the coding regions were highest in O. caudate. There were several genes in the coding regions that contained tandem repeats, namely, ycf1, ycf2, ndhF, rps18, clpP, ndhA, and petB. Tandem repeats were also detected in the intron regions of the two intron-containing genes (rpl16 and rpoC1).
According to the quadripartite structure, most of these tandem repeats were distributed in the LSC region (64%), followed by 21.5% in the IR regions, and only 14.5% in the SSC region, which is represented in Figure 5A. The size of the repeat sequences mostly ranged from 31 bp to 50 bp, as seen in Figure 5B.
Simple sequence repeats (SSRs) were also analyzed using the MISA software tool. SSRs occur in all seven genomes, as seen in Table 3, and most were mono repeats composed of A/T repeats (337) and G/C repeats (4). A total of di- and trinucleotide repeats were rich in AT, with 82 AT/TA repeats and 3 AAT/TTA repeats, respectively. These findings show a strong AT level in SSRs, which had previously been observed in the Lespedeza tribe [20], as well as other legume species [21,24], suggesting a role for SSRs in the identification of these plant species.

2.2.5. IR Expansion and Contraction

The length of the IRs was similar in Desmodieae species, ranging from 23,720 bp (C. macrocarpa) to 24,264 bp (O. caudate), whereas the outgroup V. radiata contained the longest IRs (26,474 bp), due to a duplicated gene (rps19). The boundary regions of the seven species are described in Figure 6.
It was noted that the IRa/LSC border in all six Desmodieae species was located downstream of the trnH-GUG gene and upstream of the rpl2 gene by 1 bp (D. heterocarpon) to 34 bp (D. styracifolium), from the endpoint of the boundary to trnH-GUG. However, this junction in V. radiata was in the intergenic region of rps19/rps3. In addition, ycf1 was present on the IRa/SSC junction in four species and the size of its fragments in IRa was largest in V. radiata (492 bp), followed by 463 bp in O. caudate, while that of H. podocarpum, and D. heterocarpon were 453 bp and 412 bp, respectively. On the other hand, the ycf1 did not extend to the IRa region in L. maritima and C. Macrocarpa because they were 144 bp and 131 bp, respectively, away from the endpoint of the junction. However, D. styracifolium witnesses a presence of ndhF at the IRa/SSC boundary with no separation to the junction.

2.2.6. Phylogenetic Relationship

In this study, the chloroplast genome from nine Desmodieae species and two outgroups were aligned using ETE3 [25] and the phylogeny reconstruction based on the RAxML analysis [26]. All eleven species produced two branches with dedicated support using bootstrap values of 100%. V. radiata and M. macrocarpa were in the Phaseolinae tribe, a sister group to Desmodieae. The remaining nine Desmodieae species were divided into three clades. O. caudata belongs to the genus Phyllodium. The second clade consisted of four taxa grouped to the genus Desmodium, including H. podocarpum, D. heterocarpon, D. styracifolium. C. macrocarpa, K. striata, L. maritima, L. davurica, and L. floribunda, which were grouped into the third clade, Lespedeza (Figure 7).

3. Discussion

The study was conducted as a comparative analysis of the complete chloroplast genome of D. styracifolium, with five species of the Desmodieae tribe and an outgroup. The results indicated that the chloroplast characteristics among the Desmodieae species were highly conserved, which was similar to a previous study [27], where similar features among the members of Desmodieae were also mentioned. However, a distinct feature was also identified in the Desmodium clade, which was the pseudogene, ycf4, in D. heterocarpon, however, it remained a functional gene in D. styracifolium and H. podocarpum. The ycf4 gene encoded the Ycf4 protein, which is involved in the biogenesis and assembly of the photosystem I (PS I) complex, although it was a nonessential factor for PSI activities in higher plants [28,29]. Furthermore, the evolution of the ycf4 gene may be varied in legumes, as it was considered to be a localized hypermutation in several legumes species, resulting in gene losses in the chloroplast genome [30].
The gene content of the D. styracifolium, when compared with the other six species, found that O. caundata have the largest coding size, followed by D. styracifolium, while L. maritima have the smallest. The remarkable reasons for the chloroplast genome size variations are the intergenic region variations, the shrinkage and expansion of the IR regions, and the gene/intron loss, which were consistent with a previous report [31]. Moreover, the GC content ranged from 34.9% in C. macrocarpa to 35.4% in V. radiata. The three Desmodium species had 35.2% GC content. The IR regions contained the highest percentage of GC because the four pairs of rRNA genes were in those regions. It was previously demonstrated that the rpl22 and infA genes were lost in all legumes due to its multiple transfers to the nucleus during evolution [18,19]. The seven chloroplast genomes showed some resemblance to this report. The crucial role of RNA editing in the translation process was observed in all mentioned species. In ndhD transcripts, the C-to-U editing was shown, resulting in the conversion of the start codon from ACG to AUG. The chloroplast RNA editing seemed to function as a mechanism to generate variations at the RNA and DNA levels [32].
Moreover, according to the results of the SSC inversion in D. styracifolium, which resulted in high divergences in the SSC region [Figure 3], suggesting that the sequence arrangements occurred in the chloroplast genome during evolution, even though conservation of the gene order in the chloroplast genome had previously been reported [6,33]. Furthermore, the number and size of the largest repeat sequences were significantly associated with the degree of genome recombination. The size of the repeat sequence had been observed in the range of 31–50 bp, which was in accordance with other legume species [34]. Both the smallest repeat (23 bp) and the longest repeat (175 bp) were found in D. heterocarpon. Repeats larger than 70 bp were absent in O. caudate and L. maritima.
SSRs consisted of tandemly repeated mono-, di-, tri-, or tetranucleotide motifs [35]. SSRs were useful genetic markers that could play a vital role in assessing chloroplast variations and for phylogenetic relationship studies [36]. The shift in the boundary between IR regions and single-copy regions was thought to cause size variations in the chloroplast genomes. At the border of the IRb/SSC junction, the distance from the ndhF end to the boulder was 24 bp in C. macrocarpa, 16 bp in L. maritima, and 5 bp in D. heterocarpon, while ycf1 extended to the IRb by 411 bp in D. styracifolium. The sizes of the ndhF gene fragments in the IRb were 23 bp in V. radiata, and 13 bp more than in H. podocarpum and O. caudate. Furthermore, rps19 crossed the LSC/IRb boundary in most studied species, except for V. radiata, in which rps19 was located 592 bp upstream of the boulder. The IRb region differently expanded to rps19 among the Desmodieae species, by 16 bp in O. caudate to 56 bp in D. heterocarpon. The expansion of IRs in V. radiata caused the duplication of rps19, the smaller size of its SSC, and the larger size of the IR regions, thus, the complete genome size was largest in these seven studied species.
DNA barcoding was the cost-effective and highly accurate biotechnology method for species identification by analyzing 400–800 bp long specific DNA regions, which could be mitochondrial, plastidial, or nuclear original genes. There were a number of chloroplast-derived DNA barcodes that had been used for phylogenetic analysis, such as rbcL, matK, rpoB, psbA-trnH, and atpF-atpH. In the tribe, Desmodiae, a short region of internal transcribed spacer (ITS) and a combination of rbcL + matK + ITS had been used as markers for the species-level identification, although these barcodes still had the limitation relating to the availability of the sequences and the rate of identification success. In this study, the Pi value was calculated to identify the highly divergent regions, trnL-UAA-trnT-UGU, psaJ-ycf4, psbE-petL, rpl36-rps8, and rpl32-trnL-UGA that could be utilized as DNA barcodes for investigating the phylogenetic relationship of Desmodiae.
In conclusion, the plastome size, GC content, gene orientation, gene content, tandem repeats, and microsatellites were highly conserved in the studied species, except for the SSC inversions in D. styracifolium. However, the IR/SC boundaries and sequence divergence showed differences among these species. The comparison of the chloroplast genomes indicated that the coding regions were more conserved than the non-coding regions, and the divergence level of the IRs was lower than that of the LSC and SSC, which is consistent with the results previously found for other legume species. Five variable regions (trnL-UAA-trnT-UGU, psaJ-ycf4, psbE-petL, rpl36-rps8, and rpl32-trnL-UGA) were identified, which may be useful as potential markers for further phylogenetic analysis and evolutionary studies. Overall, this research offers a useful method for choosing chloroplast markers, examining obscure phylogenetic relationships, and avoiding taxonomic mistakes brought on by significant sequence variations.

4. Materials and Methods

4.1. Plant Materials and DNA Extractions

Young and healthy leaves of Desmodium styracifolium were collected from the National Institute of Biological Resources, Incheon, South Korea (NIBRGR000001122251) and stored at −80 °C until use. The total genomic DNA was immediately extracted by using samples of 1 g of Desmodium leaves in the CTAB method, as previously described by [37]. The DNA concentration and quality were assessed using spectrophotometry and 1% (w/v) agarose gel electrophoresis.

4.2. DNA Sequencing, and Genome Assembly and Annotation

The extracted total genome DNA of D. styracifolium was sequenced for the complete genome using the PacBio RS II system (Pacific Bioscience Inc., Menlo park, CA, USA). The adapter sequences from the raw data were removed to obtain high-quality subreads. Filtered subreads were first mapped to the D. heterokaryon (NC_044113.1) chloroplast genome from the NCBI database using the BWA Aligner. The matched subreads were assembled for the chloroplast genome with CANU version 1.8 followed by checking the overlapped regions using nucmer and nummerplot, and they were, then, annotated with the GESqeq Annotation tool. The circular genome map was drawn with OGDraw software, version number 1.3.1 [38]. The complete DNA sequence was deposited in the GenBank database under the accession number: MN913536.

4.3. Sequence Analysis

Genomes of six other species were obtained from the GenBank with the following accession numbers: Desmodium heterocarpon (NC_044113), Hylodesmum podocarpum (MG867568), Lespedeza maritima (NC_044115), ohwia caudate (NC_044105) [22], and Vigna radiata (NC_013843) [27]. The complete cpDNA of D. Styracifolium was compared to these species. The online comparison tool mVISTA [39] in the shuttle-LAGAN mode was chosen to perform sequence alignment analysis. The D. styracifolium and V. radiata plastomes were used as the reference and out group, respectively. To evaluate the nucleotide variability (Pi) among the six plastomes of the Desmodieae species, the sequences were initially aligned using CLUSTALX 1.81 [40]. Then, a sliding window analysis was performed to calculate the nucleotide diversity using DnaSP version 6.10.03, with a step size of 200 bp and window length of 600 bp [41].
Simple sequence repeats (SSRs) or microsatellites were determined using the online MISA (Microsatellite identification tool (https://webblast.ipk-gatersleben.de/misa/ accessed on 16 January 2020) [42]. The minimum numbers of repetitions of mono-, di-, tri-, tetra-, penta-, and hexanucleotide were 10, 6, 5, 5, 5, and 5, respectively. Tandem Repeats Finder (TRF) version 4.09 was used to detect the tandem repeats.

4.4. PCR Amplification

To validate the assembly at the IRs and SSC junction regions in D. styracifolium, we designed four primers, described in Table 4, to amplify the IR/SSC junctions. The PCR amplification reactions were performed using the BioFACTTM 2× Real-time PCR Master Mix (including SFCgreen I), with 15 min incubation at 95 °C, followed by 30 cycles of 30 s denaturation at 95 °C, 30 s annealing at 59 °C, and 50 s extension at 72 °C. Each 20 µL PCR reaction system included 10 µL of the Master Mix, 2 µM Primers, and 100 µg DNA. PCR products were separated by running them on 1% (w/v) agarose gel electrophoresis. A PCR 100 bp (Sigma-Aldrich) was used as the molecular weight marker.

Author Contributions

Conceptualization, J.P., L.-T.Y.; data analysis, L.-T.Y.; writing —original draft preparation, L.-T.Y.; writing —review and editing, M.K.; Supervision, J.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Research Program funded by SeoulTech (Seoul National University of Science and Technology, 2021-0999).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All other relevant data are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Daniell, H.; Lin, C.S.; Yu, M.; Chang, W.J. Chloroplast genomes: Diversity, evolution, and applications in genetic engineering. Genome Biol. 2016, 17, 134. [Google Scholar] [CrossRef] [PubMed]
  2. Sugiura, M. The chloroplast genome. Plant Mol. Biol. 1992, 19, 149–168. [Google Scholar] [CrossRef] [PubMed]
  3. Wicke, S.; Schneeweiss, G.M.; dePamphilis, C.W.; Müller, K.F.; Quandt, D. The evolution of the plastid chromosome in land plants: Gene content, gene order, gene function. Plant Mol. Biol. 2011, 76, 273–297. [Google Scholar] [CrossRef] [PubMed]
  4. Thode, V.A.; Lohmann, L.G. Comparative Chloroplast Genomics at Low Taxonomic Levels: A Case Study Using Amphilophium (Bignonieae, Bignoniaceae). Front. Plant Sci. 2019, 10, 796. [Google Scholar] [CrossRef]
  5. Wang, X.; Zhou, T.; Bai, G.; Zhao, Y. Complete chloroplast genome sequence of Fagopyrum dibotrys: Genome features, comparative analysis, and phylogenetic relationships. Sci. Rep. 2018, 8, 2907. [Google Scholar] [CrossRef]
  6. Li, B.; Zheng, Y. Dynamic evolution and phylogenomic analysis of the chloroplast genome in Schisandraceae. Sci. Rep. 2018, 8, 9285. [Google Scholar] [CrossRef] [PubMed]
  7. Birky, C.W., Jr. Uniparental inheritance of mitochondrial and chloroplast genes: Mechanisms and evolution. Proc Natl. Acad. Sci. USA 1995, 92, 11331–11338. [Google Scholar] [CrossRef]
  8. Huo, Y.; Gao, L.; Liu, B.; Yang, Y.; Kong, S.; Sun, Y.; Yang, Y.; Wu, X. Complete chloroplast genome sequences of four Allium species: Comparative and phylogenetic analyses. Sci. Rep. 2019, 9, 12250. [Google Scholar] [CrossRef]
  9. Azani, N.; Babineau, M.; Bailey, C.D.; Banks, H.; Barbosa, A.R.; Pinto, R.B.; Boatwright, J.S.; Borges, L.M.; Brown, G.K.; Bruneau, A.; et al. A new subfamily classification of the Leguminosae based on a taxonomically comprehensive phylogeny—The Legume Phylogeny Working Group (LPWG). Taxon 2018, 66, 44–77. [Google Scholar] [CrossRef]
  10. Lewis, G.P. (Ed.) Legumes of the World; Royal Botanic Gardens, Kew: Richmond, UK, 2005. [Google Scholar]
  11. Wojciechowski, M.F. Reconstructing the Phylogeny of Legumes (Leguminosae): An Early 21st Century Perspective. Adv. Legume Syst. 2003, 10, 5–35. [Google Scholar]
  12. Jabbour, F.; Gaudeul, M.; Lambourdière, J.; Ramstein, G.; Hassanin, A.; Labat, J.N.; Sarthou, C. Phylogeny, biogeography, and character evolution in the tribe Desmodieae (Fabaceae: Papilionoideae), with special emphasis on the New Caledonian endemic genera. Mol. Phylogenetics Evol. 2018, 118, 108–121. [Google Scholar] [CrossRef]
  13. Lai, S.C.; Ho, Y.L.; Huang, S.C.; Huang, T.H.; Lai, Z.R.; Wu, C.R.; Lian, K.Y.; Chang, Y.S. Antioxidant and Antiproliferative Activities of Desmodium triflorum (L.) DC. Am. J. Chin. Med. 2010, 38, 329–342. [Google Scholar] [CrossRef] [PubMed]
  14. Li, W.; Sun, Y.N.; Yan, X.T.; Yang, S.Y.; Kim, S.; Chae, D.; Hyun, J.W.; Kang, H.K.; Koh, Y.S.; Kim, Y.H. Anti-inflammatory and antioxidant activities of phenolic compounds from Desmodium caudatum leaves and stems. Arch. Pharmacal Res. 2014, 37, 721–727. [Google Scholar] [CrossRef] [PubMed]
  15. Ma, X.; Zheng, C.; Hu, C.; Rahman, K.; Qin, L. The genus Desmodium (Fabaceae)-traditional uses in Chinese medicine, phytochemistry and pharmacology. J. Ethnopharmacol. 2011, 138, 314–332. [Google Scholar] [CrossRef] [PubMed]
  16. Giang, P.M.; Son, P.T.; Matsunami, K.; Otsuka, H. Flavonoid compounds from Desmodium styracifolium of Vietnamese origin. Chem. Nat. Compd. 2010, 46, 797–798. [Google Scholar] [CrossRef]
  17. Liu, M.; Liu, C.; Chen, H.; Huang, X.; Zeng, X.; Zhou, J.; Mi, S. Prevention of cholesterol gallstone disease by schaftoside in lithogenic diet induced C57BL/6 mouse model. Eur. J. Pharmacol. 2017, 815, 1–9. [Google Scholar] [CrossRef]
  18. Gantt, J.S.; Baldauf, S.L.; Calie, P.J.; Weeden, N.F.; Palmer, J.D. Transfer of rpl22 to the nucleus greatly preceded its loss from the chloroplast and involved the gain of an intron. EMBO J. 1991, 10, 3073–3078. [Google Scholar] [CrossRef]
  19. Millen, R.S.; Olmstead, R.G.; Adams, K.L.; Palmer, J.D.; Lao, N.T.; Heggie, L.; Kavanagh, T.A.; Hibberd, J.M.; Gray, J.C.; Morden, C.W.; et al. Many Parallel Losses of infA from Chloroplast DNA during Angiosperm Evolution with Multiple Independent Transfers to the Nucleus. Plant Cell 2001, 13, 645–658. [Google Scholar] [CrossRef]
  20. Somaratne, Y.; Guan, D.L.; Wang, W.Q.; Zhao, L.; Xu, S.Q. The Complete Chloroplast Genomes of Two Lespedeza Species: Insights into Codon Usage Bias, RNA Editing Sites, and Phylogenetic Relationships in Desmodieae (Fabaceae: Papilionoideae). Plants 2020, 9, 51. [Google Scholar] [CrossRef]
  21. de Souza, U.J.B.; Nunes, R.; Targueta, C.P.; Diniz-Filho, J.A.F.; Telles, M.P.d.C. The complete chloroplast genome of Stryphnodendron adstringens (Leguminosae—Caesalpinioideae): Comparative analysis with related Mimosoid species. Sci. Rep. 2019, 9, 14206. [Google Scholar] [CrossRef]
  22. Tangphatsornruang, S.; Sangsrakru, D.; Chanprasert, J.; Uthaipaisanwong, P.; Yoocha, T.; Jomchai, N.; Tragoonrung, S. The Chloroplast Genome Sequence of Mungbean (Vigna radiata) Determined by High-throughput Pyrosequencing: Structural Organization and Phylogenetic Relationships. DNA Res. 2010, 17, 11–22. [Google Scholar] [CrossRef] [PubMed]
  23. Weng, M.-L.; Blazier, J.C.; Govindu, M.; Jansen, R.K. Reconstruction of the Ancestral Plastid Genome in Geraniaceae Reveals a Correlation between Genome Rearrangements, Repeats, and Nucleotide Substitution Rates. Mol. Biol. Evol. 2014, 31, 645–659. [Google Scholar] [CrossRef] [PubMed]
  24. Kaila, T.; Chaduvla, P.K.; Saxena, S.; Bahadur, K.; Gahukar, S.J.; Chaudhury, A.; Sharma, T.R.; Singh, N.K.; Gaikwad, K. Chloroplast Genome Sequence of Pigeonpea (Cajanus cajan (L.) Millspaugh) and Cajanus scarabaeoides (L.) Thouars: Genome Organization and Comparison with Other Legumes. Front. Plant Sci. 2016, 7, 1847. [Google Scholar] [CrossRef] [PubMed]
  25. Huerta-Cepas, J.; Serra, F.; Bork, P. ETE 3: Reconstruction, Analysis, and Visualization of Phylogenomic Data. Mol. Biol. Evol. 2016, 33, 1635–1638. [Google Scholar] [CrossRef]
  26. Price, M.N.; Dehal, P.S.; Arkin, A.P. FastTree: Computing Large Minimum Evolution Trees with Profiles instead of a Distance Matrix. Mol. Biol. Evol. 2009, 26, 1641–1650. [Google Scholar] [CrossRef]
  27. Jin, D.P.; Choi, I.S.; Choi, B.H. Plastid genome evolution in tribe Desmodieae (Fabaceae: Papilionoideae). PLoS ONE 2019, 14, e0218743. [Google Scholar] [CrossRef]
  28. Boudreau, E.; Takahashi, L.C.; Turmel, M.; Rochaix, J.D. The chloroplast ycf3 and ycf4 open reading frames of Chlamydomonas reinhardtii are required for the accumulation of the photosystem I complex. EMBO J 1997, 16, 6095–6104. [Google Scholar] [CrossRef]
  29. Krech, K.; Ruf, S.; Masduki, F.F.; Thiele, W.; Bednarczyk, D.; Albus, C.A.; Tiller, N.; Hasse, C.; Schöttler, M.A.; Bock, R. The Plastid Genome-Encoded Ycf4 Protein Functions as a Nonessential Assembly Factor for Photosystem I in Higher Plants. Plant Physiol. 2012, 159, 579–591. [Google Scholar] [CrossRef]
  30. Magee, A.M. Plastid genes transcribed by the nucleus-encoded plastid RNA polymerase show increased transcript accumulation in transgenic plants expressing a chloroplast-localized phage T7 RNA polymerase. J. Exp. Bot. 2002, 53, 2341–2349. [Google Scholar] [CrossRef]
  31. Xiao-Ming, Z.; Junrui, W.; Li, F.; Sha, L.; Hongbo, P.; Lan, Q.; Jing, L.; Yan, S.; Weihua, Q.; Lifang, Z.; et al. Inferring the evolutionary mechanism of the chloroplast genome size by comparing whole-chloroplast genome sequences in seed plants. Sci Rep. 2017, 7, 1555. [Google Scholar] [CrossRef]
  32. Tillich, M.; Lehwark, P.; Morton, B.R.; Maier, U.G. The Evolution of Chloroplast RNA Editing. Mol. Biol. Evol. 2006, 23, 1912–1921. [Google Scholar] [CrossRef]
  33. Jiao, Y.; Guo, H. Prehistory of the Angiosperms. Adv. Bot. Res. 2014, 69, 223–245. [Google Scholar]
  34. Saski, C.; Lee, S.B.; Daniell, H.; Wood, T.C.; Tomkins, J.; Kim, H.G.; Jansen, R.K. Complete Chloroplast Genome Sequence of Glycine max and Comparative Analyses with other Legume Genomes. Plant Mol. Biol. 2005, 59, 309–322. [Google Scholar] [CrossRef] [PubMed]
  35. Powell, W.; Morgante, M.; McDevitt, R.; Vendramin, G.G.; Rafalski, J.A. Polymorphic simple sequence repeats regions in chloroplast genomes: Applications to the population genetics of pines. Proc. Natl. Acad. Sci. USA 1995, 92, 7759–7763. [Google Scholar] [CrossRef] [PubMed]
  36. Provan, J.; Russell, J.R.; Booth, A.; Powell, W. Polymorphic chloroplast simple sequence repeat primers for systematic and population studies in the genus Hordeum. Mol. Ecol. 1999, 8, 505–511. [Google Scholar] [CrossRef] [PubMed]
  37. Sahu, S.K.; Thangaraj, M.; Kathiresan, K. DNA Extraction Protocol for Plants with High Levels of Secondary Metabolites and Polysaccharides without Using Liquid Nitrogen and Phenol. ISRN Mol. Biol. 2012, 2012, 205049. [Google Scholar] [CrossRef]
  38. Greiner, S.; Lehwark, P.; Bock, R. OrganellarGenomeDRAW (OGDRAW) version 1.3.1: Expanded toolkit for the graphical visualization of organellar genomes. Nucleic Acids Res. 2019, 47, W59–W64. [Google Scholar] [CrossRef]
  39. Frazer, K.A.; Pachter, L.; Poliakov, A.; Rubin, E.M.; Dubchak, I. VISTA: Computational tools for comparative genomics. Nucleic Acids Res. 2004, 32, W273–W279. [Google Scholar] [CrossRef]
  40. Thompson, J.D.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F.; Higgins, D.G. The CLUSTAL_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997, 25, 4876–4882. [Google Scholar] [CrossRef]
  41. Rozas, J.; Ferrer-Mata, A.; Sánchez-DelBarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sánchez-Gracia, A. DnaSP 6: DNA Sequence Polymorphism Analysis of Large Data Sets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef]
  42. Beier, S.; Thiel, T.; Münch, T.; Scholz, U.; Mascher, M. MISA-web: A web server for microsatellite prediction. Bioinformatics 2017, 33, 2583–2585. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Gene map of Desmodium styracifolium. The genes outside the circle are transcribed counterclockwise, while those inside is transcribed clockwise. Genes are color based on the identified functional groups.
Figure 1. Gene map of Desmodium styracifolium. The genes outside the circle are transcribed counterclockwise, while those inside is transcribed clockwise. Genes are color based on the identified functional groups.
Ijms 24 06072 g001
Figure 2. Sequence identify plot for seven Phaseoloid species using mVISTA with Desmodium styracifolium as a reference. Gray arrows represent gene orientation and position. The Y-axis indicates the percentage identity between 50 and 100%. Red and blue bars indicate non-coding sequences (CNSs) and exons, respectively.
Figure 2. Sequence identify plot for seven Phaseoloid species using mVISTA with Desmodium styracifolium as a reference. Gray arrows represent gene orientation and position. The Y-axis indicates the percentage identity between 50 and 100%. Red and blue bars indicate non-coding sequences (CNSs) and exons, respectively.
Ijms 24 06072 g002
Figure 3. Nucleotide variability (Pi) values of the six Desmodieae chloroplast genomes using a sliding window analysis.
Figure 3. Nucleotide variability (Pi) values of the six Desmodieae chloroplast genomes using a sliding window analysis.
Ijms 24 06072 g003
Figure 4. Analysis of the SSC inversion in Desmodium styracifolium. (A) Comparison of the gene order in the SSC region of D. styracifolium and D. heterocarpon. (B). Primer design for the PCR to amplify the IR/SSC junction regions in D. styracifolium. Two pairs of primers, primer 1 (P1F/P1R) and primer 2 (P2F/P2R) are designed to amplify the IRb/SSC junction. Primer P1F is located at the IRb/SSC boundary, while P1R and P2R are in ycf1 and ndhF, respectively, which are in the SSC region. (C) PCR amplification of the IR/SSC junctions in D. styracifolium. M: PCR 100 bp Low Ladder.
Figure 4. Analysis of the SSC inversion in Desmodium styracifolium. (A) Comparison of the gene order in the SSC region of D. styracifolium and D. heterocarpon. (B). Primer design for the PCR to amplify the IR/SSC junction regions in D. styracifolium. Two pairs of primers, primer 1 (P1F/P1R) and primer 2 (P2F/P2R) are designed to amplify the IRb/SSC junction. Primer P1F is located at the IRb/SSC boundary, while P1R and P2R are in ycf1 and ndhF, respectively, which are in the SSC region. (C) PCR amplification of the IR/SSC junctions in D. styracifolium. M: PCR 100 bp Low Ladder.
Ijms 24 06072 g004
Figure 5. Tandem repeat analysis among seven studied species. (A) Percentage distribution of all tandem repeats based on the quadripartite structure. (B) Frequency of tandem repeats by length.
Figure 5. Tandem repeat analysis among seven studied species. (A) Percentage distribution of all tandem repeats based on the quadripartite structure. (B) Frequency of tandem repeats by length.
Ijms 24 06072 g005
Figure 6. Comparison of the IR/SC junctions among seven chloroplast genomes.
Figure 6. Comparison of the IR/SC junctions among seven chloroplast genomes.
Ijms 24 06072 g006
Figure 7. Maximum-likelihood phylogenetic tree reconstruction based on the complete chloroplast genome of eleven species.
Figure 7. Maximum-likelihood phylogenetic tree reconstruction based on the complete chloroplast genome of eleven species.
Ijms 24 06072 g007
Table 1. Summary of the chloroplast genome features of six Desmodieae and an outgroup (Phaselous vulgaris).
Table 1. Summary of the chloroplast genome features of six Desmodieae and an outgroup (Phaselous vulgaris).
FeaturesD. styracifoliumD. heterocarponH. podocarpumO. caudataL. maritimaC. macrocarpaVigna radiata
Genome size149,155149,696149,564150,249149,022148,814151,271
LSC Length82,47682,96783,12583,24182,42982,56680,896
SSC Length18,43918,44118,15918,48018,93918,80817,427
IR length24,12024,14424,14024,26423,82723,72026,474
Coding Size78,03377,42777,92578,04577,26577,92577,469
GC content 35.235.235.235.135.034.935.4
Total genes128128128128128128127
Protein-coding genes83838383838383
Duplicated genes17171717171719
tRNA genes37373737373736
rRNA genes8888888
Genes-with introns19191919191918
Pseudogenes ycf4 rpl33, rps16
Table 2. Tandem repeat distribution among six Desmodieae species and an outgroup (Vigna).
Table 2. Tandem repeat distribution among six Desmodieae species and an outgroup (Vigna).
Intergenic SpaceCoding RegionRegion of Introns
Desmodium styracifolium4181
Desmodium heterocarpon4282
Hylodesmum podocarpum3372
Ohwia caudate23114
Lespedeza maritima4083
Campylotropis macrocarpa4594
Vigna radiata2482
Total2485918
Table 3. Type and number of SSRs in the chloroplast genome.
Table 3. Type and number of SSRs in the chloroplast genome.
SSR TypeRepeat UnitD. styracifoliumD. heterocarponH. podocarpumO. caudataL. maritimaC. macrocarpaV. radiataTotal
MonoA/T49505655444538337
C/G00202004
DiAT/AT810328712582
TriAAT/ATT00000213
Table 4. PCR primers used in PCR amplification.
Table 4. PCR primers used in PCR amplification.
PrimerSequence
PIFTCTTATTTTTCAGTTATTAAATCCCCT
PIRGGGGGCGGTATTCTACCTA
P2FACGCAACTTTTTCAGTGATTCT
P2RGCGCCTTTGCATCTAGCATT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yen, L.-T.; Kousar, M.; Park, J. Comparative Analysis of Chloroplast Genome of Desmodium stryacifolium with Closely Related Legume Genome from the Phaseoloid Clade. Int. J. Mol. Sci. 2023, 24, 6072. https://doi.org/10.3390/ijms24076072

AMA Style

Yen L-T, Kousar M, Park J. Comparative Analysis of Chloroplast Genome of Desmodium stryacifolium with Closely Related Legume Genome from the Phaseoloid Clade. International Journal of Molecular Sciences. 2023; 24(7):6072. https://doi.org/10.3390/ijms24076072

Chicago/Turabian Style

Yen, Le-Thi, Muniba Kousar, and Joonho Park. 2023. "Comparative Analysis of Chloroplast Genome of Desmodium stryacifolium with Closely Related Legume Genome from the Phaseoloid Clade" International Journal of Molecular Sciences 24, no. 7: 6072. https://doi.org/10.3390/ijms24076072

APA Style

Yen, L.-T., Kousar, M., & Park, J. (2023). Comparative Analysis of Chloroplast Genome of Desmodium stryacifolium with Closely Related Legume Genome from the Phaseoloid Clade. International Journal of Molecular Sciences, 24(7), 6072. https://doi.org/10.3390/ijms24076072

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop