Oxidative-Stress-Mediated ER Stress Is Involved in Regulating Manoalide-Induced Antiproliferation in Oral Cancer Cells
Abstract
1. Introduction
2. Results
2.1. ER Expansion Change by Manoalide: Oral Cancer vs. Normal Cells
2.2. Aggresome Change by Manoalide: Oral Cancer vs. Normal Cells
2.3. Modulation of ER Stress Signaling by Manoalide: Oral Cancer vs. Normal Cells
2.4. Antiproliferation by Manoalide and ER Stress Inducer: Oral Cancer vs. Normal Cells
2.5. Modulation of Apoptosis by Manoalide and ER Stress Inducer: Oral Cancer vs. Normal Cells
2.6. Modulation of Autophagy by Manoalide and ER Stress Inducer: Oral Cancer vs. Normal Cells
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Chemicals
4.2. ER Expansion
4.3. Aggresome
4.4. mRNA Expressions of ER-Stress-Associated Genes
4.5. Western Blotting for ER-Stress-Associated Genes
4.6. Cell Viability
4.7. Caspase 3/7
4.8. Autophagy
4.9. Statistics
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Fuchs, H.E.; Jemal, A. Cancer statistics, 2022. CA Cancer J. Clin. 2022, 72, 7–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chung, C.H.; Yang, Y.H.; Wang, T.Y.; Shieh, T.Y.; Warnakulasuriya, S. Oral precancerous disorders associated with areca quid chewing, smoking, and alcohol drinking in southern Taiwan. J. Oral Pathol. Med. 2005, 34, 460–466. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Awan, K.H.; Patil, S.; Habib, S.R.; Pejcic, A.; Zain, R.B. Evaluation of medicinal interventions for the management of oral submucous fibrosis: A systematic review of the literature. J. Contemp. Dent. Pract. 2014, 15, 812–817. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, S.H.; Chen, M.K.; Chang, J.H.; Velmurugan, B.K.; Annamanedi, M.; Su, S.C.; Yeh, K.T.; Yang, S.F. Impact of polymorphisms in casein kinase 1 epsilon and environmental factors in oral cancer susceptibility. J. Cancer 2019, 10, 5065–5069. [Google Scholar] [CrossRef] [Scilit]
- Singh, R.; Sharma, M.; Joshi, P.; Rawat, D.S. Clinical status of anti-cancer agents derived from marine sources. Anticancer Agents Med. Chem. 2008, 8, 603–617. [Google Scholar] [CrossRef]
- Sithranga Boopathy, N.; Kathiresan, K. Anticancer drugs from marine flora: An overview. J. Oncol. 2010, 2010, 214186. [Google Scholar] [CrossRef] [Scilit]
- Farooqi, A.A.; Fayyaz, S.; Hou, M.F.; Li, K.T.; Tang, J.Y.; Chang, H.W. Reactive oxygen species and autophagy modulation in non-marine drugs and marine drugs. Mar. Drugs 2014, 12, 5408–5424. [Google Scholar] [CrossRef] [Scilit]
- Lee, M.G.; Liu, Y.C.; Lee, Y.L.; El-Shazly, M.; Lai, K.H.; Shih, S.P.; Ke, S.C.; Hong, M.C.; Du, Y.C.; Yang, J.C.; et al. Heteronemin, a marine sesterterpenoid-type metabolite, induces apoptosis in prostate LNcap cells via oxidative and ER stress combined with the inhibition of topoisomerase II and Hsp90. Mar. Drugs 2018, 16, 204. [Google Scholar] [CrossRef] [Scilit]
- Abdelaleem, E.R.; Samy, M.N.; Desoukey, S.Y.; Liu, M.; Quinn, R.J.; Abdelmohsen, U.R. Marine natural products from sponges (Porifera) of the order Dictyoceratida (2013 to 2019); a promising source for drug discovery. RSC Adv. 2020, 10, 34959–34976. [Google Scholar] [CrossRef] [Scilit]
- Elgoud Said, A.A.; Mahmoud, B.K.; Attia, E.Z.; Abdelmohsen, U.R.; Fouad, M.A. Bioactive natural products from marine sponges belonging to family Hymedesmiidae. RSC Adv. 2021, 11, 16179–16191. [Google Scholar] [CrossRef] [Scilit]
- Sakai, E.; Kato, H.; Rotinsulu, H.; Losung, F.; Mangindaan, R.E.; de Voogd, N.J.; Yokosawa, H.; Tsukamoto, S. Variabines A and B: New beta-carboline alkaloids from the marine sponge Luffariella variabilis. J. Nat. Med. 2014, 68, 215–219. [Google Scholar] [CrossRef] [Scilit]
- de Silva, E.D.; Scheuer, P.J. Manoalide, an antibiotic sesterterpenoid from the marine sponge Luffariella variabilis (polejaeff). Tetrahedron Lett. 1980, 21, 1611–1614. [Google Scholar] [CrossRef] [Scilit]
- Soriente, A.; De Rosa, M.M.; Scettri, A.; Sodano, G.; Terencio, M.C.; Paya, M.; Alcaraz, M.J. Manoalide. Curr. Med. Chem. 1999, 6, 415–431. [Google Scholar] [CrossRef] [Scilit]
- Kobayashi, J.; Zeng, C.M.; Ishibashi, M.; Sasaki, T. Luffariolides F and G, new manoalide derivatives from the Okinawan marine sponge Luffariella sp. J. Nat. Prod. 1993, 56, 436–439. [Google Scholar] [CrossRef] [Scilit]
- Kaweetripob, W.; Mahidol, C.; Tuntiwachwuttikul, P.; Ruchirawat, S.; Prawat, H. Cytotoxic sesterterpenes from Thai marine sponge Hyrtios erectus. Mar. Drugs 2018, 16, 474. [Google Scholar] [CrossRef] [Scilit]
- Fernandez, A.; Ordonez, R.; Reiter, R.J.; Gonzalez-Gallego, J.; Mauriz, J.L. Melatonin and endoplasmic reticulum stress: Relation to autophagy and apoptosis. J. Pineal Res. 2015, 59, 292–307. [Google Scholar] [CrossRef] [Scilit]
- Schwarz, D.S.; Blower, M.D. The endoplasmic reticulum: Structure, function and response to cellular signaling. Cell. Mol. Life Sci. 2016, 73, 79–94. [Google Scholar] [CrossRef] [Scilit]
- Ozcan, L.; Tabas, I. Role of endoplasmic reticulum stress in metabolic disease and other disorders. Annu. Rev. Med. 2012, 63, 317–328. [Google Scholar] [CrossRef] [Scilit]
- Limonta, P.; Moretti, R.M.; Marzagalli, M.; Fontana, F.; Raimondi, M.; Montagnani Marelli, M. Role of endoplasmic reticulum stress in the anticancer activity of natural compounds. Int. J. Mol. Sci. 2019, 20, 961. [Google Scholar] [CrossRef] [Scilit]
- Yadav, R.K.; Chae, S.W.; Kim, H.R.; Chae, H.J. Endoplasmic reticulum stress and cancer. J. Cancer Prev. 2014, 19, 75–88. [Google Scholar] [CrossRef] [Scilit]
- Yorimitsu, T.; Nair, U.; Yang, Z.; Klionsky, D.J. Endoplasmic reticulum stress triggers autophagy. J. Biol. Chem. 2006, 281, 30299–30304. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qin, L.; Wang, Z.; Tao, L.; Wang, Y. ER stress negatively regulates AKT/TSC/mTOR pathway to enhance autophagy. Autophagy 2010, 6, 239–247. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zeeshan, H.M.; Lee, G.H.; Kim, H.R.; Chae, H.J. Endoplasmic reticulum stress and associated ROS. Int. J. Mol. Sci. 2016, 17, 327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burgos-Moron, E.; Abad-Jimenez, Z.; Maranon, A.M.; Iannantuoni, F.; Escribano-Lopez, I.; Lopez-Domenech, S.; Salom, C.; Jover, A.; Mora, V.; Roldan, I.; et al. Relationship between oxidative stress, ER stress, and inflammation in type 2 diabetes: The battle continues. J. Clin. Med. 2019, 8, 1385. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.K.; Kang, K.A.; Ryu, Y.S.; Piao, M.J.; Han, X.; Oh, M.C.; Boo, S.J.; Jeong, S.U.; Jeong, Y.J.; Chae, S.; et al. Induction of endoplasmic reticulum stress via reactive oxygen species mediated by luteolin in melanoma cells. Anticancer Res. 2016, 36, 2281–2289. [Google Scholar]
- Tang, J.Y.; Ou-Yang, F.; Hou, M.F.; Huang, H.W.; Wang, H.R.; Li, K.T.; Fayyaz, S.; Shu, C.W.; Chang, H.W. Oxidative stress-modulating drugs have preferential anticancer effects—Involving the regulation of apoptosis, DNA damage, endoplasmic reticulum stress, autophagy, metabolism, and migration. Semin. Cancer Biol. 2019, 58, 109–117. [Google Scholar] [CrossRef] [Scilit]
- Lin, Y.; Jiang, M.; Chen, W.; Zhao, T.; Wei, Y. Cancer and ER stress: Mutual crosstalk between autophagy, oxidative stress and inflammatory response. Biomed. Pharmacother. 2019, 118, 109249. [Google Scholar] [CrossRef] [Scilit]
- Cheng, W.C.; Wen, Y.; Chiu, Y.S.; Chou, C.H.; Lim, C.J.; Lin, S.H.; Chang, J.M.; Lin, C.C. Pendulone induces apoptosis via the ROS-mediated ER-stress pathway in human non-small cell lung cancer cells. Toxicol. In Vitro 2022, 81, 105346. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.R.; Tang, J.Y.; Wang, Y.Y.; Farooqi, A.A.; Yen, C.Y.; Yuan, S.F.; Huang, H.W.; Chang, H.W. Manoalide preferentially provides antiproliferation of oral cancer cells by oxidative stress-mediated apoptosis and DNA damage. Cancers 2019, 11, 1303. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.R.; Chen, P.H.; Tang, J.Y.; Yen, C.Y.; Su, Y.C.; Huang, M.Y.; Chang, H.W. Manoalide shows mutual interaction between cellular and mitochondrial reactive species with apoptosis in oral cancer cells. Oxid. Med. Cell. Longev. 2021, 2021, 6667355. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.D.; Ko, S.; Xu, Y.; Fattah, E.A.; Xiang, Q.; Jagannath, C.; Ishii, T.; Komatsu, M.; Eissa, N.T. Transient aggregation of ubiquitinated proteins is a cytosolic unfolded protein response to inflammation and endoplasmic reticulum stress. J. Biol. Chem. 2012, 287, 19687–19698. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Shi, Q.; Xu, K.; Gao, C.; Chen, C.; Li, X.L.; Wang, G.R.; Tian, C.; Han, J.; Dong, X.P. Familial CJD associated PrP mutants within transmembrane region induced Ctm-PrP retention in ER and triggered apoptosis by ER stress in SH-SY5Y cells. PLoS ONE 2011, 6, e14602. [Google Scholar] [CrossRef] [Scilit]
- Petty, R.D.; Sutherland, L.A.; Hunter, E.M.; Cree, I.A. Comparison of MTT and ATP-based assays for the measurement of viable cell number. J. Biolumin. Chemilumin. 1995, 10, 29–34. [Google Scholar] [CrossRef] [Scilit]
- Maehara, Y.; Anai, H.; Tamada, R.; Sugimachi, K. The ATP assay is more sensitive than the succinate-dehydrogenase inhibition test for predicting cell viability. Eur. J. Cancer Clin. Oncol. 1987, 23, 273–276. [Google Scholar] [CrossRef] [Scilit]
- Hu, L.; Zhang, T.; Liu, D.; Guan, G.; Huang, J.; Proksch, P.; Chen, X.; Lin, W. Notoamide-type alkaloid induced apoptosis and autophagy via a P38/JNK signaling pathway in hepatocellular carcinoma cells. RSC Adv. 2019, 9, 19855–19868. [Google Scholar] [CrossRef] [Scilit]
- Sasabe, E.; Tomomura, A.; Kitamura, N.; Yamamoto, T. Metal nanoparticles-induced activation of NLRP3 inflammasome in human oral keratinocytes is a possible mechanism of oral lichenoid lesions. Toxicol. In Vitro 2020, 62, 104663. [Google Scholar] [CrossRef] [Scilit]
- Bhattarai, K.R.; Riaz, T.A.; Kim, H.R.; Chae, H.J. The aftermath of the interplay between the endoplasmic reticulum stress response and redox signaling. Exp. Mol. Med. 2021, 53, 151–167. [Google Scholar] [CrossRef] [Scilit]
- Yuan, X.; Wang, B.; Yang, L.; Zhang, Y. The role of ROS-induced autophagy in hepatocellular carcinoma. Clin. Res. Hepatol. Gastroenterol. 2018, 42, 306–312. [Google Scholar] [CrossRef] [Scilit]
- Backer, J.M.; Krivoshein, A.V.; Hamby, C.V.; Pizzonia, J.; Gilbert, K.S.; Ray, Y.S.; Brand, H.; Paton, A.W.; Paton, J.C.; Backer, M.V. Chaperone-targeting cytotoxin and endoplasmic reticulum stress-inducing drug synergize to kill cancer cells. Neoplasia 2009, 11, 1165–1173. [Google Scholar] [CrossRef] [Scilit]
- Wu, L.; Huang, X.; Kuang, Y.; Xing, Z.; Deng, X.; Luo, Z. Thapsigargin induces apoptosis in adrenocortical carcinoma by activating endoplasmic reticulum stress and the JNK signaling pathway: An in vitro and in vivo study. Drug Des. Dev. Ther. 2019, 13, 2787–2798. [Google Scholar] [CrossRef] [Scilit]
- Huang, F.; Wang, P.; Wang, X. Thapsigargin induces apoptosis of prostate cancer through cofilin-1 and paxillin. Oncol. Lett. 2018, 16, 1975–1980. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pan, M.Y.; Shen, Y.C.; Lu, C.H.; Yang, S.Y.; Ho, T.F.; Peng, Y.T.; Chang, C.C. Prodigiosin activates endoplasmic reticulum stress cell death pathway in human breast carcinoma cell lines. Toxicol. Appl. Pharmacol. 2012, 265, 325–334. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, Y.; Pu, L.Y.; Lu, L.; Wang, X.H.; Zhang, F.; Rao, J.H. N-acetylcysteine attenuates reactive-oxygen-species-mediated endoplasmic reticulum stress during liver ischemia-reperfusion injury. World J. Gastroenterol. 2014, 20, 15289–15298. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chiu, C.C.; Chen, Y.C.; Bow, Y.D.; Chen, J.Y.; Liu, W.; Huang, J.L.; Shu, E.D.; Teng, Y.N.; Wu, C.Y.; Chang, W.T. diTFPP, a phenoxyphenol, sensitizes hepatocellular carcinoma cells to c2-ceramide-induced autophagic stress by increasing oxidative stress and ER stress accompanied by LAMP2 hypoglycosylation. Cancers 2022, 14, 2528. [Google Scholar] [CrossRef] [Scilit]
- Su, M.; Mei, Y.; Sinha, S. Role of the crosstalk between autophagy and apoptosis in cancer. J. Oncol. 2013, 2013, 102735. [Google Scholar] [CrossRef] [Scilit]
- Holczer, M.; Marton, M.; Kurucz, A.; Banhegyi, G.; Kapuy, O. A comprehensive systems biological study of autophagy-apoptosis crosstalk during endoplasmic reticulum stress. BioMed Res. Int. 2015, 2015, 319589. [Google Scholar] [CrossRef] [Scilit]
- Song, S.; Tan, J.; Miao, Y.; Li, M.; Zhang, Q. Crosstalk of autophagy and apoptosis: Involvement of the dual role of autophagy under ER stress. J. Cell. Physiol. 2017, 232, 2977–2984. [Google Scholar] [CrossRef] [Scilit]
- Bhutia, S.K.; Dash, R.; Das, S.K.; Azab, B.; Su, Z.Z.; Lee, S.G.; Grant, S.; Yacoub, A.; Dent, P.; Curiel, D.T.; et al. Mechanism of autophagy to apoptosis switch triggered in prostate cancer cells by antitumor cytokine melanoma differentiation-associated gene 7/interleukin-24. Cancer Res. 2010, 70, 3667–3676. [Google Scholar] [CrossRef] [Scilit]
- Lee, Y.S.; Lee, D.H.; Choudry, H.A.; Bartlett, D.L.; Lee, Y.J. Ferroptosis-induced endoplasmic reticulum stress: Cross-talk between ferroptosis and apoptosis. Mol. Cancer Res. 2018, 16, 1073–1076. [Google Scholar] [CrossRef] [Scilit]
- Kasten, F.H.; Pineda, L.F.; Schneider, P.E.; Rawls, H.R.; Foster, T.A. Biocompatibility testing of an experimental fluoride releasing resin using human gingival epithelial cells in vitro. In Vitro Cell. Dev. Biol. 1989, 25, 57–62. [Google Scholar] [CrossRef] [Scilit]
- Kasten, F.H.; Soileau, K.; Meffert, R.M. Quantitative evaluation of human gingival epithelial cell attachment to implant surfaces in vitro. Int. J. Periodontics Restor. Dent. 1990, 10, 68–79. [Google Scholar]
- Chang, H.H.; Guo, M.K.; Kasten, F.H.; Chang, M.C.; Huang, G.F.; Wang, Y.L.; Wang, R.S.; Jeng, J.H. Stimulation of glutathione depletion, ROS production and cell cycle arrest of dental pulp cells and gingival epithelial cells by HEMA. Biomaterials 2005, 26, 745–753. [Google Scholar] [CrossRef] [Scilit]
- Zieniewska, I.; Maciejczyk, M.; Zalewska, A. The effect of selected dental materials used in conservative dentistry, endodontics, surgery, and orthodontics as well as during the periodontal treatment on the redox balance in the oral cavity. Int. J. Mol. Sci. 2020, 21, 9684. [Google Scholar] [CrossRef] [Scilit]
- Hsieh, P.L.; Liao, Y.W.; Hsieh, C.W.; Chen, P.N.; Yu, C.C. Soy isoflavone genistein impedes cancer stemness and mesenchymal transition in head and neck cancer through activating miR-34a/RTCB axis. Nutrients 2020, 12, 1924. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.Y.; Chang, Y.L.; Liu, S.T.; Chen, G.S.; Lee, S.P.; Huang, S.M. Differential cytotoxicity mechanisms of copper complexed with disulfiram in oral cancer cells. Int. J. Mol. Sci. 2021, 22, 3711. [Google Scholar] [CrossRef] [Scilit]
- Chan, W.H.; Shiao, N.H.; Lu, P.Z. CdSe quantum dots induce apoptosis in human neuroblastoma cells via mitochondrial-dependent pathways and inhibition of survival signals. Toxicol. Lett. 2006, 167, 191–200. [Google Scholar] [CrossRef] [Scilit]
- Hung, J.H.; Chen, C.Y.; Omar, H.A.; Huang, K.Y.; Tsao, C.C.; Chiu, C.C.; Chen, Y.L.; Chen, P.H.; Teng, Y.N. Reactive oxygen species mediate Terbufos-induced apoptosis in mouse testicular cell lines via the modulation of cell cycle and pro-apoptotic proteins. Environ. Toxicol. 2016, 31, 1888–1898. [Google Scholar] [CrossRef] [Scilit]
- Huang, C.H.; Yeh, J.M.; Chan, W.H. Hazardous impacts of silver nanoparticles on mouse oocyte maturation and fertilization and fetal development through induction of apoptotic processes. Environ. Toxicol. 2018, 33, 1039–1049. [Google Scholar] [CrossRef] [Scilit]
- Wang, T.S.; Lin, C.P.; Chen, Y.P.; Chao, M.R.; Li, C.C.; Liu, K.L. CYP450-mediated mitochondrial ROS production involved in arecoline N-oxide-induced oxidative damage in liver cell lines. Environ. Toxicol. 2018, 33, 1029–1038. [Google Scholar] [CrossRef] [Scilit]
- Mocan, T.; Matea, C.; Tabaran, F.; Iancu, C.; Orasan, R.; Mocan, L. In vitro administration of gold nanoparticles functionalized with MUC-1 protein fragment generates anticancer vaccine response via macrophage activation and polarization mechanism. J. Cancer 2015, 6, 583–592. [Google Scholar] [CrossRef] [Scilit]
- Hirata, Y.; Motoyama, M.; Kimura, S.; Takashima, M.; Ikawa, T.; Oh-Hashi, K.; Kamatari, Y.O. Artepillin C, a major component of Brazilian green propolis, inhibits endoplasmic reticulum stress and protein aggregation. Eur. J. Pharmacol. 2021, 912, 174572. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, H.W.; Yen, C.Y.; Chen, C.H.; Tsai, J.H.; Tang, J.Y.; Chang, Y.T.; Kao, Y.H.; Wang, Y.Y.; Yuan, S.F.; Lee, S.Y. Evaluation of the mRNA expression levels of integrins alpha3, alpha5, beta1 and beta6 as tumor biomarkers of oral squamous cell carcinoma. Oncol. Lett. 2018, 16, 4773–4781. [Google Scholar] [PubMed]
- Fujii, Y.; Yoshihashi, K.; Suzuki, H.; Tsutsumi, S.; Mutoh, H.; Maeda, S.; Yamagata, Y.; Seto, Y.; Aburatani, H.; Hatakeyama, M. CDX1 confers intestinal phenotype on gastric epithelial cells via induction of stemness-associated reprogramming factors SALL4 and KLF5. Proc. Natl. Acad. Sci. USA 2012, 109, 20584–20589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Laddha, N.C.; Dwivedi, M.; Mansuri, M.S.; Singh, M.; Patel, H.H.; Agarwal, N.; Shah, A.M.; Begum, R. Association of neuropeptide Y (NPY), interleukin-1B (IL1B) genetic variants and correlation of IL1B transcript levels with vitiligo susceptibility. PLoS ONE 2014, 9, e107020. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Peng, S.Y.; Yen, C.Y.; Lan, T.H.; Jeng, J.H.; Tang, J.Y.; Chang, H.W. Combined treatment (ultraviolet-C/physapruin A) enhances antiproliferation and oxidative-stress-associated mechanism in oral cancer cells. Antioxidants 2022, 11, 2227. [Google Scholar] [CrossRef] [Scilit]
- Yeh, C.C.; Tseng, C.N.; Yang, J.I.; Huang, H.W.; Fang, Y.; Tang, J.Y.; Chang, F.R.; Chang, H.W. Antiproliferation and induction of apoptosis in Ca9-22 oral cancer cells by ethanolic extract of Gracilaria tenuistipitata. Molecules 2012, 17, 10916–10927. [Google Scholar] [CrossRef] [Scilit]
- Shiau, J.P.; Chuang, Y.T.; Tang, J.Y.; Chen, S.R.; Hou, M.F.; Jeng, J.H.; Cheng, Y.B.; Chang, H.W. Antiproliferation effects of marine-sponge-derived methanol extract of Theonella swinhoei in oral cancer cells in vitro. Antioxidants 2022, 11, 1982. [Google Scholar] [CrossRef] [Scilit]






| Genes | Forward Primers (5′→3′) | Reverse primers (5′→3′) | Accession Numbers |
|---|---|---|---|
| BIP | TGATCAAGATACAGGTGACCTGG | GTCTTTCACCTTCATAGACCTTGAT | NM_005347.5 |
| PERK | TCATCCTCACAGGCAAAGGAAG | AGCCAATTCCCTATTGGGGA | NM_004836.7 |
| IRE1α | AATTGTGTACCGGGGCATGT | TGCTCCACATACTCTTGCAGG | NM_001433.5 |
| ATF6 | ACAGAGTCTCTCAGGTTAAATCATG | GAGTTCCTGCTGATACTACTAGTGG | NM_007348.4 |
| GAPDH | CCTCAACTACATGGTTTACATGTTCC | CAAATGAGCCCCAGCCTTCT | NM_002046.7 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Peng, S.-Y.; Tang, J.-Y.; Lan, T.-H.; Shiau, J.-P.; Chen, K.-L.; Jeng, J.-H.; Yen, C.-Y.; Chang, H.-W. Oxidative-Stress-Mediated ER Stress Is Involved in Regulating Manoalide-Induced Antiproliferation in Oral Cancer Cells. Int. J. Mol. Sci. 2023, 24, 3987. https://doi.org/10.3390/ijms24043987
Peng S-Y, Tang J-Y, Lan T-H, Shiau J-P, Chen K-L, Jeng J-H, Yen C-Y, Chang H-W. Oxidative-Stress-Mediated ER Stress Is Involved in Regulating Manoalide-Induced Antiproliferation in Oral Cancer Cells. International Journal of Molecular Sciences. 2023; 24(4):3987. https://doi.org/10.3390/ijms24043987
Chicago/Turabian StylePeng, Sheng-Yao, Jen-Yang Tang, Ting-Hsun Lan, Jun-Ping Shiau, Kuan-Liang Chen, Jiiang-Huei Jeng, Ching-Yu Yen, and Hsueh-Wei Chang. 2023. "Oxidative-Stress-Mediated ER Stress Is Involved in Regulating Manoalide-Induced Antiproliferation in Oral Cancer Cells" International Journal of Molecular Sciences 24, no. 4: 3987. https://doi.org/10.3390/ijms24043987
APA StylePeng, S.-Y., Tang, J.-Y., Lan, T.-H., Shiau, J.-P., Chen, K.-L., Jeng, J.-H., Yen, C.-Y., & Chang, H.-W. (2023). Oxidative-Stress-Mediated ER Stress Is Involved in Regulating Manoalide-Induced Antiproliferation in Oral Cancer Cells. International Journal of Molecular Sciences, 24(4), 3987. https://doi.org/10.3390/ijms24043987

