Pre-Diabetes-Linked miRNA miR-193b-3p Targets PPARGC1A, Disrupts Metabolic Gene Expression Profile and Increases Lipid Accumulation in Hepatocytes: Relevance for MAFLD
Abstract
1. Introduction
2. Results
2.1. MicroRNA hsa-miR-193b-3p Targets the 3’UTR of PPARGC1A mRNA and Downregulates PPARGC1A Expression in HepG2 Cells
2.2. Intracellular Lipid Droplet Content Is Increased by Overexpression of microRNA hsa-miR-193b-3p in HepG2 Cells
2.3. Changes in Expression of Genes Involved in Lipid Metabolism May in Part Explain Intracellular Lipid Accumulation Following Overexpression of hsa-miR-193b-3p in HepG2 Cells
2.4. Changes Favoring Insulin Signaling, Reduced Glycolysis, and Reduced Mitochondrial Biogenesis Are Observed When microRNA hsa-miR-193b-3p Is Overexpressed in HepG2 Cells
3. Discussion
4. Materials and Methods
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhang, J.; Li, S.; Li, L.; Li, M.; Guo, C.; Yao, J.; Mi, S. Exosome and Exosomal MicroRNA: Trafficking, Sorting, and Function. Genom. Proteom. Bioinform. 2015, 13, 17–24. [Google Scholar] [CrossRef] [Scilit]
- Lai, E.C. Micro RNAs Are Complementary to 3’ UTR Sequence Motifs That Mediate Negative Post-Transcriptional Regulation. Nat. Genet. 2002, 30, 363–364. [Google Scholar] [CrossRef] [Scilit]
- Agarwal, V.; Bell, G.W.; Nam, J.-W.; Bartel, D.P. Predicting Effective MicroRNA Target Sites in Mammalian MRNAs. eLife 2015, 4, e05005. [Google Scholar] [CrossRef] [Scilit]
- Párrizas, M.; Novials, A. Circulating MicroRNAs as Biomarkers for Metabolic Disease. Best Pract. Res. Clin. Endocrinol. Metab. 2016, 30, 591–601. [Google Scholar] [CrossRef] [Scilit]
- Mayans, L. Metabolic Syndrome: Insulin Resistance and Prediabetes. FP Essent 2015, 435, 11–16. [Google Scholar]
- Eslam, M.; Sanyal, A.J.; George, J. International Consensus Panel MAFLD: A Consensus-Driven Proposed Nomenclature for Metabolic Associated Fatty Liver Disease. Gastroenterology 2020, 158, 1999–2014.e1. [Google Scholar] [CrossRef] [Scilit]
- Kotronen, A.; Yki-Järvinen, H. Fatty Liver: A Novel Component of the Metabolic Syndrome. Arterioscler. Thromb. Vasc. Biol. 2008, 28, 27–38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lonardo, A.; Ballestri, S.; Marchesini, G.; Angulo, P.; Loria, P. Nonalcoholic Fatty Liver Disease: A Precursor of the Metabolic Syndrome. Dig. Liver Dis. 2015, 47, 181–190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Párrizas, M.; Brugnara, L.; Esteban, Y.; González-Franquesa, A.; Canivell, S.; Murillo, S.; Gordillo-Bastidas, E.; Cussó, R.; Cadefau, J.A.; García-Roves, P.M.; et al. Circulating MiR-192 and MiR-193b Are Markers of Prediabetes and Are Modulated by an Exercise Intervention. J. Clin. Endocrinol. Metab. 2015, 100, E407–E415. [Google Scholar] [CrossRef] [Scilit]
- Wu, H.; Deng, X.; Shi, Y.; Su, Y.; Wei, J.; Duan, H. PGC-1α, Glucose Metabolism and Type 2 Diabetes Mellitus. J. Endocrinol. 2016, 229, R99–R115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, C.-F.; Ku, H.-C.; Lin, H. PGC-1α as a Pivotal Factor in Lipid and Metabolic Regulation. Int. J. Mol. Sci. 2018, 19, 3447. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liang, H.; Ward, W.F. PGC-1α: A Key Regulator of Energy Metabolism. Adv. Physiol. Educ. 2006, 30, 145–151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rius-Pérez, S.; Torres-Cuevas, I.; Millán, I.; Ortega, Á.L.; Pérez, S. PGC-1α, Inflammation, and Oxidative Stress: An Integrative View in Metabolism. Oxid. Med. Cell. Longev. 2020, 2020, 1452696. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- la Cour Poulsen, L.; Siersbæk, M.; Mandrup, S. PPARs: Fatty Acid Sensors Controlling Metabolism. Semin. Cell Dev. Biol. 2012, 23, 631–639. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Charos, A.E.; Reed, B.D.; Raha, D.; Szekely, A.M.; Weissman, S.M.; Snyder, M. A Highly Integrated and Complex PPARGC1A Transcription Factor Binding Network in HepG2 Cells. Genome Res. 2012, 22, 1668–1679. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sanyal, A.J.; Campbell-Sargent, C.; Mirshahi, F.; Rizzo, W.B.; Contos, M.J.; Sterling, R.K.; Luketic, V.A.; Shiffman, M.L.; Clore, J.N. Nonalcoholic Steatohepatitis: Association of Insulin Resistance and Mitochondrial Abnormalities. Gastroenterology 2001, 120, 1183–1192. [Google Scholar] [CrossRef] [Scilit]
- Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Systematic and Integrative Analysis of Large Gene Lists Using DAVID Bioinformatics Resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef] [Scilit]
- Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Bioinformatics Enrichment Tools: Paths toward the Comprehensive Functional Analysis of Large Gene Lists. Nucleic Acids Res. 2009, 37, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Camon, E.; Barrell, D.; Brooksbank, C.; Magrane, M.; Apweiler, R. The Gene Ontology Annotation (GOA) Project—Application of GO in SWISS-PROT, TrEMBL and InterPro. Comp. Funct. Genom. 2003, 4, 71–74. [Google Scholar] [CrossRef] [Scilit]
- Aharoni-Simon, M.; Hann-Obercyger, M.; Pen, S.; Madar, Z.; Tirosh, O. Fatty Liver Is Associated with Impaired Activity of PPARγ-Coactivator 1α (PGC1α) and Mitochondrial Biogenesis in Mice. Lab. Investig. 2011, 91, 1018–1028. [Google Scholar] [CrossRef] [Scilit]
- Khatun, I.; Walsh, M.T.; Hussain, M.M. Loss of Both Phospholipid and Triglyceride Transfer Activities of Microsomal Triglyceride Transfer Protein in Abetalipoproteinemia. J. Lipid Res. 2013, 54, 1541–1549. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burkhardt, R.; Toh, S.-A.; Lagor, W.R.; Birkeland, A.; Levin, M.; Li, X.; Robblee, M.; Fedorov, V.D.; Yamamoto, M.; Satoh, T.; et al. Trib1 Is a Lipid- and Myocardial Infarction-Associated Gene That Regulates Hepatic Lipogenesis and VLDL Production in Mice. J. Clin. Investig. 2010, 120, 4410–4414. [Google Scholar] [CrossRef] [Scilit]
- Shin, E.; Bae, J.-S.; Han, J.-Y.; Lee, J.; Jeong, Y.-S.; Lee, H.-J.; Ahn, Y.-H.; Cha, J.-Y. Hepatic DGAT2 Gene Expression Is Regulated by the Synergistic Action of ChREBP and SP1 in HepG2 Cells. Anim. Cells Syst. 2016, 20, 7–14. [Google Scholar] [CrossRef] [Scilit]
- Xu, X.; So, J.-S.; Park, J.-G.; Lee, A.-H. Transcriptional Control of Hepatic Lipid Metabolism by SREBP and ChREBP. Semin. Liver Dis. 2013, 33, 301–311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wilson, C.G.; Tran, J.L.; Erion, D.M.; Vera, N.B.; Febbraio, M.; Weiss, E.J. Hepatocyte-Specific Disruption of CD36 Attenuates Fatty Liver and Improves Insulin Sensitivity in HFD-Fed Mice. Endocrinology 2016, 157, 570–585. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Besse-Patin, A.; Jeromson, S.; Levesque-Damphousse, P.; Secco, B.; Laplante, M.; Estall, J.L. PGC1A Regulates the IRS1:IRS2 Ratio during Fasting to Influence Hepatic Metabolism Downstream of Insulin. Proc. Natl. Acad. Sci. USA 2019, 116, 4285–4290. [Google Scholar] [CrossRef] [Scilit]
- Yoon, J.C.; Puigserver, P.; Chen, G.; Donovan, J.; Wu, Z.; Rhee, J.; Adelmant, G.; Stafford, J.; Kahn, C.R.; Granner, D.K.; et al. Control of Hepatic Gluconeogenesis through the Transcriptional Coactivator PGC-1. Nature 2001, 413, 131–138. [Google Scholar] [CrossRef] [Scilit]
- Ogihara, T.; Isobe, T.; Ichimura, T.; Taoka, M.; Funaki, M.; Sakoda, H.; Onishi, Y.; Inukai, K.; Anai, M.; Fukushima, Y.; et al. 14-3-3 Protein Binds to Insulin Receptor Substrate-1, One of the Binding Sites of Which Is in the Phosphotyrosine Binding Domain. J. Biol. Chem. 1997, 272, 25267–25274. [Google Scholar] [CrossRef] [Scilit]
- Du, K.; Herzig, S.; Kulkarni, R.N.; Montminy, M. TRB3: A Tribbles Homolog That Inhibits Akt/PKB Activation by Insulin in Liver. Science 2003, 300, 1574–1577. [Google Scholar] [CrossRef] [Scilit]
- Lima, A.F.; Ropelle, E.R.; Pauli, J.R.; Cintra, D.E.; Frederico, M.J.S.; Pinho, R.A.; Velloso, L.A.; De Souza, C.T. Acute Exercise Reduces Insulin Resistance-Induced TRB3 Expression and Amelioration of the Hepatic Production of Glucose in the Liver of Diabetic Mice. J. Cell. Physiol. 2009, 221, 92–97. [Google Scholar] [CrossRef] [Scilit]
- Thomou, T.; Mori, M.A.; Dreyfuss, J.M.; Konishi, M.; Sakaguchi, M.; Wolfrum, C.; Rao, T.N.; Winnay, J.N.; Garcia-Martin, R.; Grinspoon, S.K.; et al. Adipose-Derived Circulating MiRNAs Regulate Gene Expression in Other Tissues. Nature 2017, 542, 450–455. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sefried, S.; Häring, H.-U.; Weigert, C.; Eckstein, S.S. Suitability of Hepatocyte Cell Lines HepG2, AML12 and THLE-2 for Investigation of Insulin Signalling and Hepatokine Gene Expression. Open Biol. 2018, 8, 180147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pina, A.F.; Patarrão, R.S.; Ribeiro, R.T.; Penha-Gonçalves, C.; Raposo, J.F.; Gardete-Correia, L.; Duarte, R.; MBoavida, J.; LMedina, J.; Henriques, R.; et al. Metabolic Footprint, towards Understanding Type 2 Diabetes beyond Glycemia. J. Clin. Med. 2020, 9, 2588. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagiec, M.M.; Skepner, A.P.; Negri, J.; Eichhorn, M.; Kuperwasser, N.; Comer, E.; Muncipinto, G.; Subramanian, A.; Clish, C.; Musunuru, K.; et al. Modulators of Hepatic Lipoprotein Metabolism Identified in a Search for Small-Molecule Inducers of Tribbles Pseudokinase 1 Expression. PLoS ONE 2015, 10, e0120295. [Google Scholar] [CrossRef] [Scilit]
- Wong, R.H.F.; Sul, H.S. Insulin Signaling in Fatty Acid and Fat Synthesis: A Transcriptional Perspective. Curr. Opin. Pharm. 2010, 10, 684–691. [Google Scholar] [CrossRef] [Scilit]
- Postic, C.; Burcelin, R.; Rencurel, F.; Pegorier, J.P.; Loizeau, M.; Girard, J.; Leturque, A. Evidence for a Transient Inhibitory Effect of Insulin on GLUT2 Expression in the Liver: Studies in Vivo and in Vitro. Biochem. J. 1993, 293 Pt 1, 119–124. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.-A.; Wei, Y.; Sowers, J.R. Role of Mitochondrial Dysfunction in Insulin Resistance. Circ. Res. 2008, 102, 401–414. [Google Scholar] [CrossRef] [Scilit]
- Reddy, J.K.; Rao, M.S. Lipid Metabolism and Liver Inflammation. II. Fatty Liver Disease and Fatty Acid Oxidation. Am. J. Physiol. Gastrointest. Liver Physiol. 2006, 290, G852–G858. [Google Scholar] [CrossRef] [Scilit]
- Miyazaki, Y.; Mahankali, A.; Matsuda, M.; Mahankali, S.; Hardies, J.; Cusi, K.; Mandarino, L.J.; DeFronzo, R.A. Effect of Pioglitazone on Abdominal Fat Distribution and Insulin Sensitivity in Type 2 Diabetic Patients. J. Clin. Endocrinol. Metab. 2002, 87, 2784–2791. [Google Scholar] [CrossRef]
- Martins, F.O.; Delgado, T.C.; Viegas, J.; Gaspar, J.M.; Scott, D.K.; O’Doherty, R.M.; Paula Macedo, M.; Jones, J.G. Mechanisms by Which the Thiazolidinedione Troglitazone Protects against Sucrose-Induced Hepatic Fat Accumulation and Hyperinsulinaemia: Thiazolidinediones Enhance Insulin Clearance. Br. J. Pharmacol. 2016, 173, 267–278. [Google Scholar] [CrossRef] [Scilit]
- Musso, G.; Cassader, M.; Paschetta, E.; Gambino, R. Thiazolidinediones and Advanced Liver Fibrosis in Nonalcoholic Steatohepatitis: A Meta-Analysis. JAMA Intern. Med. 2017, 177, 633. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cho, H.J.; Hwang, S.; Park, J.I.; Yang, M.J.; Hwang, J.C.; Yoo, B.M.; Lee, K.M.; Shin, S.J.; Lee, K.J.; Kim, J.H.; et al. Improvement of Nonalcoholic Fatty Liver Disease Reduces the Risk of Type 2 Diabetes Mellitus. Gut Liver 2019, 13, 440–449. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McVean, D.E.; Patrick, R.L.; Witchett, C.E. An Aqueous Oil Red O Fixative Stain for Histological Preparations. Am. J. Clin. Pathol. 1965, 43, 291–293. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An Open-Source Platform for Biological-Image Analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Gene (Exon Boundary) | Forward Primer | Reverse Primer |
|---|---|---|
| ACACA (31_32) | TTTGTCAGGATCTTTGATGAAGTG | TCATAAAGAGACGTGTGACCTG |
| ACOX1 (13_14) | GATGTGACACTTGGCTCTGT | TTCGTGGACCTCTGCTTTG |
| APOB (20_21) | TTCTGTCAGCGCAACCTATG | CTTCGCACCTTCTGCTTGA |
| CD36 (4_5) | GTCCTTATACGTACAGAGTTCGTT | CAGCCTCTGTTCCAACTGATAG |
| DGAT2 (6_7) | CAAAGAATGGGAGTGGCAATG | CAGGTCAGCTCCATGACG |
| FASN (3_4) | GTGGACGGAGGCATCAAC | TGTAGCCCACGAGTGTCT |
| GPT (4_5) | CCATCGTGACGGTGCTG | GCCGAGTAGAGTGGGTACT |
| IDH3A (10_11) | GCTCAGTGCCGTGATGAT | GTCAAGCTCTTTCCGTCCTT |
| LDLR (15_16) | CGTAAGGACACAGCACACA | GCCCAGAGCTTGGTGAG |
| MFN2 (17_18) | AAGTCCAGCAGGAACTGTC | ATTTCCTGCTCCAGGTTCTC |
| MLXIPL (15_16) | TTTGACCAGATGCGAGACAT | GATGCTGAACACCCAGAACT |
| MTTP (16_17) | CATTCTCAGGAACTTCAGTTACAATC | ACTCACGATACCACAAGCTAAA |
| PC (12_13) | CTGTGGACACCCAGTTCATC | TGACATGGCCGAGGTAGT |
| PDHA1 (2_3) | GAAATTAAGAAATGTGACCTTCACC | CAGTCTGCATCATCCTGTAGTA |
| PDK4 (7_8) | TCCAGACCAACCAATTCACATC | GCCCGCATTGCATTCTTAAATAG |
| PFKL (13_14) | ATCTCCCATGGACACACAGTAT | TACTTCTTGCACCTGACCCT |
| PKLR (10_11) | CTTTACCGTGAACCTCCAGAAG | CACGGAGCTTTCCACTTTCA |
| PPARGC1A (8_9) | GCAGTAGATCCTCTTCAAGATCC | AACGTGATCTCACATACAAGGG |
| SLC2A2 (8_9) | GACGGCTGGTATCAGCAAA | CTCCACAAGGAATACAGAGACAG |
| SREBF1 (5_6) | CACTGAGGCAAAGCTGAATAAAT | TAGGTTCTCCTGCTTGAGTTTC |
| SREBF2 (2_3) | CTGCAACAACAGACGGTAATG | GCTGAAGGACTTGAAAGCTAGTA |
| TBP (4_5) Reference | TCCACAGTGAATCTTGGTTGT | AGCAAACCGCTTGGGATTA |
| TFAM (2_3_4) | GCTCAGAACCCAGATGCAAA | TGCCACTCCGCCCTATAA |
| TRIB1 (2_3) | AGGAGAGAACCCAGCTTAGA | TGGGCAGCCATGTTTGT |
| TRIB3 (3_4) | GACCGTGAGAGGAAGAAGC | CTTGTCCCACAGGGAATCAT |
| YWHAZ (5_6) | GAAGCCATTGCTGAACTTGATAC | TCCACAATGTCAAGTTGTCTCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mollet, I.G.; Macedo, M.P. Pre-Diabetes-Linked miRNA miR-193b-3p Targets PPARGC1A, Disrupts Metabolic Gene Expression Profile and Increases Lipid Accumulation in Hepatocytes: Relevance for MAFLD. Int. J. Mol. Sci. 2023, 24, 3875. https://doi.org/10.3390/ijms24043875
Mollet IG, Macedo MP. Pre-Diabetes-Linked miRNA miR-193b-3p Targets PPARGC1A, Disrupts Metabolic Gene Expression Profile and Increases Lipid Accumulation in Hepatocytes: Relevance for MAFLD. International Journal of Molecular Sciences. 2023; 24(4):3875. https://doi.org/10.3390/ijms24043875
Chicago/Turabian StyleMollet, Inês Guerra, and Maria Paula Macedo. 2023. "Pre-Diabetes-Linked miRNA miR-193b-3p Targets PPARGC1A, Disrupts Metabolic Gene Expression Profile and Increases Lipid Accumulation in Hepatocytes: Relevance for MAFLD" International Journal of Molecular Sciences 24, no. 4: 3875. https://doi.org/10.3390/ijms24043875
APA StyleMollet, I. G., & Macedo, M. P. (2023). Pre-Diabetes-Linked miRNA miR-193b-3p Targets PPARGC1A, Disrupts Metabolic Gene Expression Profile and Increases Lipid Accumulation in Hepatocytes: Relevance for MAFLD. International Journal of Molecular Sciences, 24(4), 3875. https://doi.org/10.3390/ijms24043875

