Vorinostat Improves Myotonic Dystrophy Type 1 Splicing Abnormalities in DM1 Muscle Cell Lines and Skeletal Muscle from a DM1 Mouse Model
Abstract
1. Introduction
2. Results
2.1. Immortalized DM1 Patient Myoblasts Display Hallmark Features of Disease: CUG RNA Foci and Aberrant Splicing
2.2. High Throughput Screening of FDA-Approved Compounds Identified Small Molecule Candidates for CUG Foci Reduction
2.3. Vorinostat, but Not Gemcitabine, Rescues SERCA1 Spliceopathy
2.4. Other pan-HDAC Inhibitors Also Alleviate DM1 Pathogenic Features, Similar to Vorinostat
2.5. Vorinostat Showed Promising Therapeutic Effects in the DM1 HSALR Mouse Model
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Southern Blot
4.3. High Throughput Screening of FDA-Approved Compounds Identified Small Molecule Candidates for CUG Foci Reduction
4.4. Forward Transfection of ASO
4.5. High-Throughput Screening and Analyzing (CUG)exp Foci in DM1 Patient Cells
4.5.1. Cell Growth, Treatment, and Staining
4.5.2. Image Acquisition and Analysis
4.6. In Vivo Validation of Vorinostat Treatment in hasLR Mice
4.7. Tissue Sectioning, Staining and Image Analysis of Mouse Skeletal Muscle
4.8. Protein Extraction, Quantification and Western Blotting
4.9. RNA Extraction and Polymerase Chain Reaction (PCR)
4.9.1. RNA Extraction from Cell Culture
4.9.2. RNA Extraction from Mouse Tissue
4.9.3. cDNA Synthesis
4.9.4. Quantitative, Real-Time PCR (qPCR) for Steady-State mRNA Levels and Alternative Splicing
4.9.5. Semi-Quantitative PCR (sqPCR) and qPCR for Alternative Splicing in Mouse Tissue
4.10. Statistical Analyses
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Suominen, T.; Bachinski, L.L.; Auvinen, S.; Hackman, P.; Baggerly, K.A.; Angelini, C.; Peltonen, L.; Krahe, R.; Udd, B. Population frequency of myotonic dystrophy: Higher than expected frequency of myotonic dystrophy type 2 (DM2) mutation in Finland. Eur. J. Hum. Genet. 2011, 19, 776–782. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johnson, N.E.; Butterfield, R.J.; Mayne, K.; Newcomb, T.; Imburgia, C.; Dunn, D.; Duval, B.; Feldkamp, M.L.; Weiss, R.B. Population-based prevalence of myotonic dystrophy type 1 using genetic analysis of statewide blood screening program. Neurology 2021, 96, e1045–e1053. [Google Scholar] [PubMed]
- Reardon, W.; MacMillan, J.; Myring, J.; Harley, H.; Rundle, S.; Beck, L.; Harper, P.; Shaw, D. Cataract and myotonic dystrophy: The role of molecular diagnosis. Br. J. Ophthalmol. 1993, 77, 579–583. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Antonini, G.; Clemenzi, A.; Bucci, E.; Morino, S.; Garibaldi, M.; Sepe-Monti, M.; Giubilei, F.; Novelli, G. Erectile dysfunction in myotonic dystrophy type 1 (DM1). J. Neurol. 2009, 256, 657. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Voermans, N.C.; Erasmus, C.E.; Ockeloen, C.W.; Van Engelen, B.G.; Eggink, C.A. Primary cataract as a key to recognition of myotonic dystrophy type 1. Eur. J. Ophthalmol. 2015, 25, e46–e49. [Google Scholar] [CrossRef] [Scilit]
- Peric, S.; Nisic, T.; Milicev, M.; Basta, I.; Marjanovic, I.; Peric, M.; Lavrnic, D.; Stojanovic, V.R. Hypogonadism and erectile dysfunction in myotonic dystrophy type 1. Acta Myol. 2013, 32, 106. [Google Scholar]
- Savkur, R.S.; Philips, A.V.; Cooper, T.A. Aberrant regulation of insulin receptor alternative splicing is associated with insulin resistance in myotonic dystrophy. Nat. Genet. 2001, 29, 40–47. [Google Scholar] [CrossRef] [Scilit]
- Matsumura, T.; Iwahashi, H.; Funahashi, T.; Takahashi, M.P.; Saito, T.; Yasui, K.; Saito, T.; Iyama, A.; Toyooka, K.; Fujimura, H. A cross-sectional study for glucose intolerance of myotonic dystrophy. J. Neurol. Sci. 2009, 276, 60–65. [Google Scholar] [CrossRef] [Scilit]
- Mathieu, J.; Allard, P.; Potvin, L.; Prevost, C.; Begin, P. A 10-year study of mortality in a cohort of patients with myotonic dystrophy. Neurology 1999, 52, 1658. [Google Scholar] [CrossRef] [Scilit]
- Mahadevan, M.; Tsilfidis, C.; Sabourin, L.; Shutler, G.; Amemiya, C.; Jansen, G.; Neville, C.; Narang, M.; Barceló, J.; O’Hoy, K. Myotonic dystrophy mutation: An unstable CTG repeat in the 3′ untranslated region of the gene. Science 1992, 255, 1253–1255. [Google Scholar] [CrossRef] [Scilit]
- Lee, J.E.; Cooper, T.A. Pathogenic mechanisms of myotonic dystrophy. Biochem. Soc. Trans. 2009, 37, 1281–1286. [Google Scholar] [CrossRef] [Scilit]
- Harley, H.G.; Rundle, S.A.; Reardon, W.; Myring, J.; Crow, S.; Harper, P.; Shaw, D.; Brook, J. Unstable DNA sequence in myotonic dystrophy. Lancet 1992, 339, 1125–1128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brook, J.D.; McCurrach, M.E.; Harley, H.G.; Buckler, A.J.; Church, D.; Aburatani, H.; Hunter, K.; Stanton, V.P.; Thirion, J.-P.; Hudson, T. Molecular basis of myotonic dystrophy: Expansion of a trinucleotide (CTG) repeat at the 3′ end of a transcript encoding a protein kinase family member. Cell 1992, 68, 799–808. [Google Scholar] [CrossRef] [Scilit]
- Tsilfidis, C.; MacKenzie, A.E.; Mettler, G.; Barceló, J.; Korneluk, R.G. Correlation between CTG trinucleotide repeat length and frequency of severe congenital myotonic dystrophy. Nat. Genet. 1992, 1, 192–195. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Michalowski, S.; Miller, J.W.; Urbinati, C.R.; Paliouras, M.; Swanson, M.S.; Griffith, J. Visualization of double-stranded RNAs from the myotonic dystrophy protein kinase gene and interactions with CUG-binding protein. Nucleic Acids Res. 1999, 27, 3534–3542. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Napierala, M.; Krzyzosiak, W.J. CUG repeats present in myotonin kinase RNA form metastable “slippery” hairpins. J. Biol. Chem. 1997, 272, 31079–31085. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Davis, B.M.; McCurrach, M.E.; Taneja, K.L.; Singer, R.H.; Housman, D.E. Expansion of a CUG trinucleotide repeat in the 3′ untranslated region of myotonic dystrophy protein kinase transcripts results in nuclear retention of transcripts. Proc. Natl. Acad. Sci. USA 1997, 94, 7388–7393. [Google Scholar] [CrossRef] [Scilit]
- Mankodi, A.; Teng-Umnuay, P.; Krym, M.; Henderson, D.; Swanson, M.; Thornton, C.A. Ribonuclear inclusions in skeletal muscle in myotonic dystrophy types 1 and 2. Ann. Neurol. Off. J. Am. Neurol. Assoc. Child Neurol. Soc. 2003, 54, 760–768. [Google Scholar] [CrossRef] [Scilit]
- Miller, J.W.; Urbinati, C.R.; Teng-umnuay, P.; Stenberg, M.G.; Byrne, B.J.; Thornton, C.A.; Swanson, M.S. Recruitment of human muscleblind proteins to (CUG) n expansions associated with myotonic dystrophy. EMBO J. 2000, 19, 4439–4448. [Google Scholar] [CrossRef] [Scilit]
- Kino, Y.; Mori, D.; Oma, Y.; Takeshita, Y.; Sasagawa, N.; Ishiura, S. Muscleblind protein, MBNL1/EXP, binds specifically to CHHG repeats. Hum. Mol. Genet. 2004, 13, 495–507. [Google Scholar] [CrossRef] [Scilit]
- Lin, X.; Miller, J.W.; Mankodi, A.; Kanadia, R.N.; Yuan, Y.; Moxley, R.T.; Swanson, M.S.; Thornton, C.A. Failure of MBNL1-dependent post-natal splicing transitions in myotonic dystrophy. Hum. Mol. Genet. 2006, 15, 2087–2097. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kanadia, R.N.; Johnstone, K.A.; Mankodi, A.; Lungu, C.; Thornton, C.A.; Esson, D.; Timmers, A.M.; Hauswirth, W.W.; Swanson, M.S. A muscleblind knockout model for myotonic dystrophy. Science 2003, 302, 1978–1980. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chamberlain, C.M.; Ranum, L.P. Mouse model of muscleblind-like 1 overexpression: Skeletal muscle effects and therapeutic promise. Hum. Mol. Genet. 2012, 21, 4645–4654. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wheeler, T.M.; Sobczak, K.; Lueck, J.D.; Osborne, R.J.; Lin, X.; Dirksen, R.T.; Thornton, C.A. Reversal of RNA dominance by displacement of protein sequestered on triplet repeat RNA. Science 2009, 325, 336–339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wheeler, T.M.; Leger, A.J.; Pandey, S.K.; MacLeod, A.R.; Nakamori, M.; Cheng, S.H.; Wentworth, B.M.; Bennett, C.F.; Thornton, C.A. Targeting nuclear RNA for in vivo correction of myotonic dystrophy. Nature 2012, 488, 111–115. [Google Scholar] [CrossRef] [Scilit]
- Langlois, M.-A.; Lee, N.S.; Rossi, J.J.; Puymirat, J. Hammerhead ribozyme-mediated destruction of nuclear foci in myotonic dystrophy myoblasts. Mol. Ther. 2003, 7, 670–680. [Google Scholar] [CrossRef] [Scilit]
- De Serres-Berard, T.; Ait Benichou, S.; Jauvin, D.; Boutjdir, M.; Puymirat, J.; Chahine, M. Recent Progress and Challenges in the Development of Antisense Therapies for Myotonic Dystrophy Type 1. Int. J. Mol. Sci. 2022, 23, 13359. [Google Scholar] [CrossRef] [Scilit]
- Ait Benichou, S.; Jauvin, D.; De Serres-Berard, T.; Bennett, F.; Rigo, F.; Gourdon, G.; Boutjdir, M.; Chahine, M.; Puymirat, J. Enhanced Delivery of Ligand-Conjugated Antisense Oligonucleotides (C16-HA-ASO) Targeting Dystrophia Myotonica Protein Kinase Transcripts for the Treatment of Myotonic Dystrophy Type 1. Hum. Gene. Ther. 2022, 33, 810–820. [Google Scholar] [CrossRef] [Scilit]
- Ait Benichou, S.; Jauvin, D.; De Serres-Berard, T.; Pierre, M.; Ling, K.K.; Bennett, C.F.; Rigo, F.; Gourdon, G.; Chahine, M.; Puymirat, J. Antisense oligonucleotides as a potential treatment for brain deficits observed in myotonic dystrophy type 1. Gene. Ther. 2022, 29, 698–709. [Google Scholar] [CrossRef] [Scilit]
- Pantic, B.; Borgia, D.; Giunco, S.; Malena, A.; Kiyono, T.; Salvatori, S.; De Rossi, A.; Giardina, E.; Sangiuolo, F.; Pegoraro, E. Reliable and versatile immortal muscle cell models from healthy and myotonic dystrophy type 1 primary human myoblasts. Exp. Cell Res. 2016, 342, 39–51. [Google Scholar] [CrossRef] [Scilit]
- Hino, S.-i.; Kondo, S.; Sekiya, H.; Saito, A.; Kanemoto, S.; Murakami, T.; Chihara, K.; Aoki, Y.; Nakamori, M.; Takahashi, M.P. Molecular mechanisms responsible for aberrant splicing of SERCA1 in myotonic dystrophy type 1. Hum. Mol. Genet. 2007, 16, 2834–2843. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kimura, T.; Nakamori, M.; Lueck, J.D.; Pouliquin, P.; Aoike, F.; Fujimura, H.; Dirksen, R.T.; Takahashi, M.P.; Dulhunty, A.F.; Sakoda, S. Altered mRNA splicing of the skeletal muscle ryanodine receptor and sarcoplasmic/endoplasmic reticulum Ca2+-ATPase in myotonic dystrophy type 1. Hum. Mol. Genet. 2005, 14, 2189–2200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.-H.; Chung, T.D.; Oldenburg, K.R. A simple statistical parameter for use in evaluation and validation of high throughput screening assays. J. Biomol. Screen. 1999, 4, 67–73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, F.; Bodycombe, N.E.; Haskell, K.M.; Sun, Y.L.; Wang, E.T.; Morris, C.A.; Jones, L.H.; Wood, L.D.; Pletcher, M.T. A flow cytometry-based screen identifies MBNL1 modulators that rescue splicing defects in myotonic dystrophy type I. Hum. Mol. Genet. 2017, 26, 3056–3068. [Google Scholar] [CrossRef] [Scilit]
- Ravel-Chapuis, A.; Al-Rewashdy, A.; Bélanger, G.; Jasmin, B.J. Pharmacological and physiological activation of AMPK improves the spliceopathy in DM1 mouse muscles. Hum. Mol. Genet. 2018, 27, 3361–3376. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Weng, W.-C.; Stock, L.; Lindquist, D.; Martinez, A.; Gourdon, G.; Timchenko, N.; Snape, M.; Timchenko, L. Correction of glycogen synthase kinase 3β in myotonic dystrophy 1 reduces the mutant RNA and improves postnatal survival of DMSXL mice. Mol. Cell. Biol. 2019, 39, e00155-19. [Google Scholar] [CrossRef] [Scilit]
- Landis, S.C.; Amara, S.G.; Asadullah, K.; Austin, C.P.; Blumenstein, R.; Bradley, E.W.; Crystal, R.G.; Darnell, R.B.; Ferrante, R.J.; Fillit, H. A call for transparent reporting to optimize the predictive value of preclinical research. Nature 2012, 490, 187–191. [Google Scholar] [CrossRef] [Scilit]
- Charlet-B, N.; Savkur, R.S.; Singh, G.; Philips, A.V.; Grice, E.A.; Cooper, T.A. Loss of the muscle-specific chloride channel in type 1 myotonic dystrophy due to misregulated alternative splicing. Mol. Cell 2002, 10, 45–53. [Google Scholar] [CrossRef] [Scilit]
- Wheeler, T.M.; Lueck, J.D.; Swanson, M.S.; Dirksen, R.T.; Thornton, C.A. Correction of ClC-1 splicing eliminates chloride channelopathy and myotonia in mouse models of myotonic dystrophy. J. Clin. Investig. 2007, 117, 3952–3957. [Google Scholar] [CrossRef] [Scilit]
- Applegate, T.J.; Krafsur, G.M.; Boon, J.A.; Zhang, H.; Li, M.; Holt, T.N.; Ambler, S.K.; Abrams, B.A.; Gustafson, D.L.; Bartels, K.; et al. Brief Report: Case Comparison of Therapy With the Histone Deacetylase Inhibitor Vorinostat in a Neonatal Calf Model of Pulmonary Hypertension. Front. Physiol. 2021, 12, 712583. [Google Scholar] [CrossRef] [Scilit]
- Richon, V. Cancer biology: Mechanism of antitumour action of vorinostat (suberoylanilide hydroxamic acid), a novel histone deacetylase inhibitor. Br. J. Cancer 2006, 95, S2–S6. [Google Scholar] [CrossRef] [Scilit]
- Mann, B.S.; Johnson, J.R.; Cohen, M.H.; Justice, R.; Pazdur, R. FDA approval summary: Vorinostat for treatment of advanced primary cutaneous T-cell lymphoma. Oncologist 2007, 12, 1247–1252. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pratap, J.; Akech, J.; Wixted, J.J.; Szabo, G.; Hussain, S.; McGee-Lawrence, M.E.; Li, X.; Bedard, K.; Dhillon, R.J.; Van Wijnen, A.J. The histone deacetylase inhibitor, vorinostat, reduces tumor growth at the metastatic bone site and associated osteolysis, but promotes normal bone loss. Mol. Cancer Ther. 2010, 9, 3210–3220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hrzenjak, A.; Moinfar, F.; Kremser, M.-L.; Strohmeier, B.; Petru, E.; Zatloukal, K.; Denk, H. Histone deacetylase inhibitor vorinostat suppresses the growth of uterine sarcomas in vitro and in vivo. Mol. Cancer 2010, 9, 27–31. [Google Scholar] [CrossRef] [Scilit]
- Tran, K.; Risingsong, R.; Royce, D.B.; Williams, C.R.; Sporn, M.B.; Pioli, P.A.; Gediya, L.K.; Njar, V.C.; Liby, K.T. The combination of the histone deacetylase inhibitor vorinostat and synthetic triterpenoids reduces tumorigenesis in mouse models of cancer. Carcinogenesis 2013, 34, 199–210. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ramalingam, S.S.; Parise, R.A.; Ramananthan, R.K.; Lagattuta, T.F.; Musguire, L.A.; Stoller, R.G.; Potter, D.M.; Argiris, A.E.; Zwiebel, J.A.; Egorin, M.J. Phase I and pharmacokinetic study of vorinostat, a histone deacetylase inhibitor, in combination with carboplatin and paclitaxel for advanced solid malignancies. Clin. Cancer Res. 2007, 13, 3605–3610. [Google Scholar] [CrossRef] [Scilit]
- Dickson, M.A.; Rathkopf, D.E.; Carvajal, R.D.; Grant, S.; Roberts, J.D.; Reid, J.M.; Ames, M.M.; McGovern, R.M.; Lefkowitz, R.A.; Gonen, M. A phase I pharmacokinetic study of pulse-dose vorinostat with flavopiridol in solid tumors. Investig. New Drugs 2011, 29, 1004–1012. [Google Scholar] [CrossRef] [Scilit]
- Iwamoto, M.; Friedman, E.J.; Sandhu, P.; Agrawal, N.G.; Rubin, E.H.; Wagner, J.A. Clinical pharmacology profile of vorinostat, a histone deacetylase inhibitor. Cancer Chemother. Pharmacol. 2013, 72, 493–508. [Google Scholar] [CrossRef] [Scilit]
- Munkacsi, A.B.; Hammond, N.; Schneider, R.T.; Senanayake, D.S.; Higaki, K.; Lagutin, K.; Bloor, S.J.; Ory, D.S.; Maue, R.A.; Chen, F.W. Normalization of hepatic homeostasis in the Npc1nmf164 mouse model of Niemann-Pick type C disease treated with the histone deacetylase inhibitor vorinostat. J. Biol. Chem. 2017, 292, 4395–4410. [Google Scholar] [CrossRef] [Scilit]
- Nair, A.B.; Jacob, S. A simple practice guide for dose conversion between animals and human. J. Basic Clin. Pharm. 2016, 7, 27–31. [Google Scholar] [CrossRef] [Scilit]
- Debacker, K.; Frizzell, A.; Gleeson, O.; Kirkham-McCarthy, L.; Mertz, T.; Lahue, R.S. Histone deacetylase complexes promote trinucleotide repeat expansions. PLoS Biol. 2012, 10, e1001257. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Sousa Cavalcante, L.; Monteiro, G. Gemcitabine: Metabolism and molecular mechanisms of action, sensitivity and chemoresistance in pancreatic cancer. Eur. J. Pharmacol. 2014, 741, 8–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ketley, A.; Chen, C.Z.; Li, X.; Arya, S.; Robinson, T.E.; Granados-Riveron, J.; Udosen, I.; Morris, G.E.; Holt, I.; Furling, D. High-content screening identifies small molecules that remove nuclear foci, affect MBNL distribution and CELF1 protein levels via a PKC-independent pathway in myotonic dystrophy cell lines. Hum. Mol. Genet. 2014, 23, 1551–1562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Obayashi, M.; Stevanin, G.; Synofzik, M.; Monin, M.-L.; Duyckaerts, C.; Sato, N.; Streichenberger, N.; Vighetto, A.; Desestret, V.; Tesson, C. Spinocerebellar ataxia type 36 exists in diverse populations and can be caused by a short hexanucleotide GGCCTG repeat expansion. J. Neurol. Neurosurg. Psychiatry 2015, 86, 986–995. [Google Scholar] [CrossRef] [Scilit]
- Furuta, N.; Tsukagoshi, S.; Hirayanagi, K.; Ikeda, Y. Suppression of the yeast elongation factor Spt4 ortholog reduces expanded SCA36 GGCCUG repeat aggregation and cytotoxicity. Brain Res. 2019, 1711, 29–40. [Google Scholar] [CrossRef] [Scilit]
- Bassez, G.; Audureau, E.; Hogrel, J.-Y.; Arrouasse, R.; Baghdoyan, S.; Bhugaloo, H.; Gourlay-Chu, M.-L.; Le Corvoisier, P.; Peschanski, M. Improved mobility with metformin in patients with myotonic dystrophy type 1: A randomized controlled trial. Brain 2018, 141, 2855–2865. [Google Scholar] [CrossRef] [Scilit]
- Laustriat, D.; Gide, J.; Barrault, L.; Chautard, E.; Benoit, C.; Auboeuf, D.; Boland, A.; Battail, C.; Artiguenave, F.; Deleuze, J.-F. In vitro and in vivo modulation of alternative splicing by the biguanide metformin. Mol. Ther.-Nucleic Acids 2015, 4, e262. [Google Scholar] [CrossRef] [Scilit]
- Neault, N.; O’Reilly, S.; Baig, A.T.; Plaza-Diaz, J.; Azimi, M.; Farooq, F.; Baird, S.D.; MacKenzie, A. High-throughput kinome-RNAi screen identifies protein kinase R activator (PACT) as a novel genetic modifier of CUG foci integrity in myotonic dystrophy type 1 (DM1). PLoS ONE 2021, 16, e0256276. [Google Scholar] [CrossRef] [Scilit]
- Pandey, S.K.; Wheeler, T.M.; Justice, S.L.; Kim, A.; Younis, H.S.; Gattis, D.; Jauvin, D.; Puymirat, J.; Swayze, E.E.; Freier, S.M.; et al. Identification and characterization of modified antisense oligonucleotides targeting DMPK in mice and nonhuman primates for the treatment of myotonic dystrophy type 1. J. Pharmacol. Exp. Ther. 2015, 355, 329–340. [Google Scholar] [CrossRef] [Scilit]
- Mankodi, A.; Logigian, E.; Callahan, L.; McClain, C.; White, R.; Henderson, D.; Krym, M.; Thornton, C.A. Myotonic dystrophy in transgenic mice expressing an expanded CUG repeat. Science 2000, 289, 1769–1772. [Google Scholar] [CrossRef] [Scilit]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments; Oxford University Press: Oxford, UK, 2009. [Google Scholar]








| DMPK | Forward | GGCTCACTGCCATGGTGA |
| Reverse | GCTGTTTCATCCTGTGGGGA | |
| MBNL1 | Forward | TGATTGTCGGTTTGCTCATC |
| Reverse | TTGATCTTGGCTTGCAAATG | |
| GAPDH | Forward | TGCACCACCAACTGCTTAGC |
| Reverse | GCATGGACTGTGGTCATGAG | |
| HPRT | Forward | TGACACTGGCAAAACAATGCA |
| Reverse | GTCCTTTTCACCAGCAAGCT | |
| SERCA1-A | Forward | CCCTCCTCCATCTCTGAGC |
| Reverse | GCTCTGCCTGAAGATGTGTC | |
| SERCA1-AB | Forward | CTCCATCTGCCTCTCCATGT |
| Reverse | CTTGAGGACCATGAGCCACT |
| SERCA1 | Forward | ATCTTCAAGCTCCGGGCCCT |
| Reverse | CAGCTTTGGCTGAAGATGCA | |
| RYR1 | Forward | GACAATAAGAGCAAAATGGC |
| Reverse | CTTGGTGCGTTCCTGATCTG | |
| CLCN1 | Forward | GGAATACCTCACACTCAAGGCC |
| Reverse | CACGGAACACAAAGGCACTGAATGT |
| has | Forward | GTGGATCACCAAGCAGGAGT |
| Reverse | GTCAGTTTACGATGGCAGCA | |
| mmGAPDH | Forward | CGTCCCGTAGACAAAATGGT |
| Reverse | CTCCTGGAAGATGGTGATGG | |
| mmHPRT | Forward | GCAAACTTTGCTTTCCCTGGTT |
| Reverse | CAAGGGCATATCCAACAACA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Neault, N.; Ravel-Chapuis, A.; Baird, S.D.; Lunde, J.A.; Poirier, M.; Staykov, E.; Plaza-Diaz, J.; Medina, G.; Abadía-Molina, F.; Jasmin, B.J.; et al. Vorinostat Improves Myotonic Dystrophy Type 1 Splicing Abnormalities in DM1 Muscle Cell Lines and Skeletal Muscle from a DM1 Mouse Model. Int. J. Mol. Sci. 2023, 24, 3794. https://doi.org/10.3390/ijms24043794
Neault N, Ravel-Chapuis A, Baird SD, Lunde JA, Poirier M, Staykov E, Plaza-Diaz J, Medina G, Abadía-Molina F, Jasmin BJ, et al. Vorinostat Improves Myotonic Dystrophy Type 1 Splicing Abnormalities in DM1 Muscle Cell Lines and Skeletal Muscle from a DM1 Mouse Model. International Journal of Molecular Sciences. 2023; 24(4):3794. https://doi.org/10.3390/ijms24043794
Chicago/Turabian StyleNeault, Nafisa, Aymeric Ravel-Chapuis, Stephen D. Baird, John A. Lunde, Mathieu Poirier, Emiliyan Staykov, Julio Plaza-Diaz, Gerardo Medina, Francisco Abadía-Molina, Bernard J. Jasmin, and et al. 2023. "Vorinostat Improves Myotonic Dystrophy Type 1 Splicing Abnormalities in DM1 Muscle Cell Lines and Skeletal Muscle from a DM1 Mouse Model" International Journal of Molecular Sciences 24, no. 4: 3794. https://doi.org/10.3390/ijms24043794
APA StyleNeault, N., Ravel-Chapuis, A., Baird, S. D., Lunde, J. A., Poirier, M., Staykov, E., Plaza-Diaz, J., Medina, G., Abadía-Molina, F., Jasmin, B. J., & MacKenzie, A. E. (2023). Vorinostat Improves Myotonic Dystrophy Type 1 Splicing Abnormalities in DM1 Muscle Cell Lines and Skeletal Muscle from a DM1 Mouse Model. International Journal of Molecular Sciences, 24(4), 3794. https://doi.org/10.3390/ijms24043794

