Next Article in Journal
Burns: Classification, Pathophysiology, and Treatment: A Review
Previous Article in Journal
Bio-Guided Isolation of Compounds from Fraxinus excelsior Leaves with Anti-Inflammatory Activity
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Role of the Heat Shock Cognate Protein 70 Genes in Sex Determination and Differentiation of Chinese Tongue Sole (Cynoglossus semilaevis)

1
College of Fisheries and Life Science, Shanghai Ocean University, Shanghai 201306, China
2
National Key Laboratory of Mariculture Biobreeding and Sustainable Goods, Yellow Sea Fisheries Re-search Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China
3
Jiangsu Key Laboratory of Marine Biological Resources and Environment/Jiangsu Key Laboratory of Marine Biotechnology, Jiangsu Ocean University, Lianyungang 222000, China
4
Laboratory for Marine Fisheries Science and Food Production Processes, Pilot National Laboratory for Marine Science and Technology (Qingdao), Qingdao 266237, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(4), 3761; https://doi.org/10.3390/ijms24043761
Submission received: 11 January 2023 / Revised: 3 February 2023 / Accepted: 6 February 2023 / Published: 13 February 2023
(This article belongs to the Section Molecular Biology)

Abstract

:
Fish sex determination can be affected by environmental temperature. This process relies on temperature-sensitive proteins such as heat shock proteins (HSPs). Our previous work found that heat shock cognate proteins (HSCs) may participate in high-temperature associated sex reversal of Chinese tongue sole (Cynoglossus semilaevis). However, the role of hsc genes in responding to high temperature and affecting sex determination/differentiation remains unclear. Here, by using C. semilaevis as model, we identified hsc70 and hsc70-like. hsc70 was abundant in the gonads with a testicular-higher expression at all gonadal development stages except for 6 months post fertilization (mpf). Intriguingly, hsc70-like showed higher expression in testes from 6 mpf on. Both long-term heat treatment during the temperature-sensitive sex-determining period and short-term heat stress at the end of this period caused different expression of hsc70/hsc70-like between sexes. The dual-luciferase assay results also suggested that these genes can respond to high temperature rapidly in vitro. Heat treatment of C. semilaevis testis cells overexpressed with hsc70/hsc70-like could affect the expression of sex-related genes sox9a and cyp19a1a. Our results indicated that hsc70 and hsc70-like were key regulators linking external high-temperature signals with sex differentiation in vivo and provide a new idea for understanding the mechanism by which high temperature affects sex determination/differentiation in teleosts.

1. Introduction

In vertebrates, the structure of the gonads is highly conserved [1], while sex is affected by a wide range of mechanisms, mainly subdivided into genetic sex determination (GSD), environmental sex determination (ESD), and the combined genetic–environment interaction [2]. A number of factors can influence sex in an ESD system, including temperature, light, and social stress [2,3]. However, in lower vertebrates such as fish, GSD is often influenced by environmental factors, with the most important factor being temperature [4]. Therefore, in vertebrates, some external environmental factors may participate in sex determination and differentiation, which may lead to sex reversal. For example, during the gonad development of blue tilapia (Oreochromis aureus, Steindachner, 1864), high water temperature could lead the gonads to differentiate into testes [5]. During the early gonad differentiation of channel catfish (Ictalurus punctatus, Rafinesque, 1818), high temperature will increase the proportion of females in the population [6]. Situations in which water temperature can lead to sex reversal have also been found in Japanese flounder (Paralichthys olivaceus, Temminck and Schlegel, 1846) [7], zebrafish (Danio rerio, Hamilton, 1822) [8,9,10], Nile tilapia (Oreochromis niloticus, Linnaeus, 1758) [11], Chinese tongue sole (Cynoglossus semilaevis, Günther, 1873) [12], and bluegill sunfish (Lepomis macrochirus, Rafinesque, 1819) [13]. Previous studies of sex reversal have mostly focused on sex differentiation-related genes and pathways. Nonetheless, how individuals perceive external temperature changes and alter the expression of critical genes associated with sex differentiation is still worth intensive studying.
Some temperature-sensitive genes that respond to temperature changes and produce a series of stress reactions have been reported. Among them, the highly conserved heat shock proteins (HSPs) exist in both prokaryotic and eukaryotic cells, and they are widely studied as key factors in the response to environmental pressure [14,15]. Especially, heat shock protein 70 kDa (hsp70) and heat shock cognate protein 70 kDa (hsc70), which both have high sequence homology and similar biochemical properties, play important roles in stress stimulation, immune response, cell proliferation, development, and death [14,16,17,18,19,20]. A role for HSPs in affecting the original genetic sex of organisms under temperature change has been found in many fish species. For example, in medaka (Oryzias latipes, Temminck and Schlegel, 1846), hsp70.1 could directly regulate the expression of corticotropin-releasing hormone at high temperature and change the level of cortisol, thus inducing the sexual reversal [21]. In D. rerio, transcriptome analysis of the effect of high temperature at the gonad differentiation stage showed that hsp90a, hsp70l, and hspbp1 could be candidate genes involved in the masculinization after heat shock treatment [22]. In C. semilaevis, transcriptome studies of heat treatment during the key period of sexual differentiation and heat shock at the end of sexual differentiation pointed to genes related to the HSP family, with hsc70 being a key candidate gene for the formation of sex-reversed fish (pseudomale) [23,24]. Therefore, hsc70 may contribute to the perception of environmental temperature, then subsequently affect sex differentiation.
C. semilaevis is broadly distributed in the coastal areas of China, and it is a vital economic fish for aquaculture. C. semilaevis has a female heterotypic sex determination system (ZW ♀/ZZ ♂) [25], and there is obvious sex dimorphism between males and females. The growth rate of the female is 2–4 times faster than that of male individuals, and the full length and weight of mature females can reach several times that of males [26]. In addition, the genetic sex of C. semilaevis can be overturned by environmental factors. At the early developmental stage, culture of C. semilaevis under normal temperature (22 °C) will cause approximately 14% of ZW genotypic females to undergo sex reversal, and in the high-temperature environment (28 °C), 73% of ZW genotypic females can become pseudomales (phenotypic male) [27]. Thus, C. semilaevis can be used as an appropriate model for studying the response to temperature changes in teleosts.
In the present research, we cloned and studied two genes of the HSP70 family, hsc70 and hsc70-like. The relative quantification of the target genes in various tissues, different developmental stages, and under different heat treatments in C. semilaevis were certified. A dual-luciferase reporter assay coupled with a green fluorescent protein (GFP) reporter assay were used to test the abilities of hsc70 and hsc70-like to respond to high temperature. Furthermore, an overexpression experiment was carried out in the testis cell line of C. semilaevis to examine the relationship between the target gene and sex related genes. Our findings suggested that both hsc70 and hsc70-like respond to high temperature and play a major role in sex determination and differentiation in C. semilaevis.

2. Results

2.1. Cloning and Sequence Characteristics of hsc70 and hsc70-like

hsc70 had a full-length sequence of 2702 bp, which included a 480 bp 5′UTR, 272 bp 3′UTR and 1950 bp ORF (GenBank accession number OQ225307). The sequence contained nine exons encoding 649 amino acids. The predicted protein had an estimated molecular weight of 71.00 kDa and a theoretical isoelectric point (pI) of 5.27 (Figure 1a). The full-length sequence of hsc70-like was 2396 bp, including a 166 bp 5′UTR, 322 bp 3′UTR, and 1908 bp ORF (GenBank accession number OQ225308). The sequence contained nine exons encoding 635 amino acids. The predicted protein sequence had a calculated molecular weight of 70.30 kDa and a theoretical isoelectric point (pI) of 5.35 (Figure 1b). Both hsc70 and hsc70-like contained conserved sequences of the HSP70 family (IDLGTTYS, IFDLGGGTFDVSIL, IVLVGGSTRIPKIQK) and a conserved cytoplasm-specific EEVD sequence at the C-terminus (Figure 1).

2.2. Multiple Sequence Alignment and Phylogenetic Analysis

The protein sequences of HSC70 and HSC70-LIKE in C. semilaevis were aligned with sequences of HSC70 and HSC70-LIKE protein sequences in other teleost fishes, amphibians, birds, and mammals. The HSC70 and HSC70-LIKE protein sequences were highly similar in C. semilaevis, with significant differences found in the last 20 amino acids of the sequence. Moreover, these protein sequences showed high similarity up to 95% with that of other species (Figure 2). Due to the high similarity of protein sequences, a phylogenetic tree was constructed based on nucleic acid sequences. Figure 3 shows that known hsc70 and hsc70-like form a homologous clade in teleosts, and hsc70 forms another homologous clade in birds, amphibians, and mammals.

2.3. Expression Pattern of hsc70 and hsc70-like in C. semilaevis

The expression of hsc70 and hsc70-like genes in differ tissues of adult C. semilaevis was verified by RT—qPCR. The results showed that the expression of hsc70 was enriched in gonads and much higher in testes than in ovaries. It also showed high expression in the heart, brain, spleen, intestine, stomach, gill, kidney, skin, and liver, and low expression only in the muscle (Figure 4a). The expression of hsc70-like was much higher in testes than that in ovaries, while its expression was hardly detected in the brain, skin, liver, muscle, spleen, stomach, kidney, gill, intestine, and heart (Figure 4b).

2.4. Expression Pattern of hsc70 and hsc70-like during Gonadal Development

The expression levels of hsc70 and hsc70-like genes in C. semilaevis during gonadal development were examined by RT—qPCR. The relative expression of hsc70 showed statistically significant differences at 1 month post fertilization (1 mpf), 6 mpf, and 12 mpf between testes and ovaries in C. semilaevis, with high expression in testes at 1 mpf and 12 mpf and higher expression in ovary at 6 mpf (Figure 5a). hsc70-like still showed a testicular-higher expression pattern from 6 mpf on (Figure 5b).

2.5. Expression Patterns of hsc70 and hsc70-like in Gonads after Heat Treatment in C. semilaevis

To verify whether the hsc70 and hsc70-like genes could respond to high temperature, their relative expression levels were measured with RT—qPCR in the 3 mpf female, male, and pseudomale C. semilaevis under short-term and long-term 28 °C heat treatment. hsc70 showed a similar expression trend in the C. semilaevis gonads in all sexes under these two modes of heat treatment, which was significantly downregulated in females and males while significantly upregulated in pseudomales (Figure 6a,b). On the other hand, hsc70-like showed significant downregulation under short-term heat stress and a downregulation trend of 45.6% under long-term heat treatment in pseudomales. There was a tendency for upregulation in males under these two modes of heat treatment, with the long-term increasing by 3.73 times and short-term increasing by 2.96 times. hsc70-like showed significant upregulation in females under long-term heat treatment (Figure 6c,d).

2.6. hsc70 and hsc70-like Genes Can Respond to High Temperature Rapidly In Vitro

To verify whether the hsc70 and hsc70-like genes could respond to high temperature, a 2309 bp hsc70 promoter and a 1781 bp hsc70-like promoter were cloned for activity analysis. The vectors phsc70-luc, phsc70-like-luc, phsc70-gfp, and phsc70-like-gfp were constructed. The dual-luciferase experiment showed that activity of both hsc70 and hsc70-like promoter were significantly elevated by 1.49 times and 1.89 times, respectively, under 42 °C heat shock within 0.5 h compared to the control temperature (37 °C) (Figure 7a,b). Fluorescence observation and RT—qPCR analysis of gfp also confirmed that hsc70 responded quickly to high temperature (Figure 7c,d).

2.7. hsc70 and hsc70-like Genes Can Affect the Expression of Sex-Related Genes under High Temperature

To verify whether hsc70 and hsc70-like were involved in sex determination and differentiation, the pcDNA3.1-hsc70 and pcDNA3.1-hsc70-like were transfected into the testis cell line of C. semilaevis, followed by 28 °C heat shock treatment. The expression level of sex-related genes was detected by RT-qPCR. As shown in Figure 8a, overexpression of hsc70 could significantly activate the male-related gene sox9a, while this activation was inhibited by high temperature, and the expression of sox9a decreased significantly from 0.75 h to 1 h post heat shock and rose back again from 1.5 h on. On the other hand, overexpression of hsc70-like could also significantly activate sox9a, and this activation was maintained under high temperature (Figure 8b). Neither hsc70 nor hsc70-like overexpression had effect on the female-related gene cyp19a1a under normal temperature, while it increased cyp19a1a expression significantly at 1.5 h (Figure 8c,d).

3. Discussion

Our research verified the sequences of hsc70 and hsc70-like genes from C. semilaevis. The HSC70 protein contained 649 amino acids, and the HSC70-LIKE protein contained 635 amino acids. Both of them contained three consensus-conserved sequences from the HSP70 family, as well as a conserved cytoplasmic-specific EEVD sequence at their C-terminus [28]. The HSC70 and HSC70-LIKE protein sequences differed significantly in the last 20 amino acids, and this region contained a low-complexity domain. Comparisons of the predicted sequences of HSC70 and HSC70-LIKE with similar proteins from various species showed a high identity. In the phylogenetic tree, the predicted target gene proteins were clustered into a class of HSC70 and HSC70-LIKE proteins in other teleosts. These results suggested that the HSC70 and HSC70-LIKE proteins were highly conserved structurally.
Studies have shown that there are many subtypes of HSC70 in an individual’s genome [29]. According to the expression analysis, hsc70 was widely distributed in the tissues of 12 mpf C. semilaevis and only expressed at low levels in muscle. This extensive tissue distribution pattern has been verified in teleosts, for instance, rainbow trout (Oncorhynchus mykiss, Walbaum, 1792) [30], common carp (Cyprinus Carpio, Linnaeus, 1758) [31], and grass carp (Ctenopharyngodon idella, Valenciennes, 1844) [17]. This further supports that the hsc70 sequence obtained in this experiment was correct. The expression pattern of hsc70-like was not exactly the same as that of hsc70. hsc70-like was specifically detected in the gonads, especially highly expressed in the testes. This differential expression pattern of different hsc genes has been previously reported [17,32,33]. At different stages of gonadal development, hsc70-like always showed a testicular-higher expression pattern from 6 mpf on, and hsc70 exhibited ovarian-higher expression at only 6 mpf. Previous studies have shown that ovarian differentiation of C. semilaevis has been completed by 6 mpf [34], and oocytes began to proliferate and differentiate into the oogenesis stage [35]. It is inferred that hsc70 may be vital in oogenesis, and hsc70 and hsc70-like may be crucial in gonadal development.
To examine the relationship between the response of the hsc70 and hsc70-like genes to external high temperature and the regulation of sex differentiation [24,27], we conducted different heat treatments during critical times of sex differentiation in C. semilaevis. The mRNA expression trend of hsc70 was the same before and after short-term and long-term heat treatment (Figure 6a,b). However, hsc70-like showed different expression patterns under these two modes of heat treatment (Figure 6c,d). Therefore, it is speculated that both hsc70 and hsc70-like may affect the sex of C. semilaevis, but their influence mechanisms may be different. This is possibly due to the significant differences between hsc70 and hsc70-like in their carboxy-terminal domain, which is involved in mediating substrate specificity and specific biological functions [36]. In addition, the response of the target genes to high temperature was tested in vitro, and the results also showed that the target genes had a rapid response to high temperature. Under the action of the hsc70 promoter and hsc70-like promoter, the expression of luciferase-reporter genes increased significantly after 0.5 h of thermal stress. It has been reported that the expression level of hsc70 in tiger shrimp (Penaeus monodon, Fabricius, 1798) is also affected by temperature and could rapidly respond to high temperature in vitro [37]. Therefore, it is inferred that the rapid inductions of transcription for hsc70 and hsc70-like may be relatively conserved across species.
After overexpression of the hsc70 and hsc70-like genes in the C. semilaevis testis cell line and heat shock treatment, it was further proven that the target genes can affect the relative mRNA level of the sex-related genes sox9a and cyp19a1a [38,39,40,41,42]. Figure 8 shows that overexpression of hsc70 and hsc70-like could directly activate the expression of sox9a and that sox9a expression changed with the length of heat shock treatment time until it remained at a high expression level. In the high-temperature experiment in vivo, the results showed that the expression level of hsc70 in pseudomales and females was comparable in the normal-temperature group, while high temperature significantly upregulated the expression level of hsc70 in pseudomales to approach the expression level of males at normal temperature. The expression of hsc70-like was highest in pseudomales at normal temperature, while significantly down-regulated at high temperature. It is speculated that hsc70 and hsc70-like may be noteworthy in the process of sex reversal induced by high temperature, and that these two genes seem to have a coordinated effect in pseudomales. At normal-temperature, the hsc70-like gene was responsible for elevating the expression of male-related genes such as sox9a. While at high temperature, hsc70 gene switched to rapidly upregulated and participate in promoting male-related genes expression. The overexpression of hsc70 and hsc70-like cannot directly affect the expression of cyp19a1a, but it will affect the response of cyp19a1a to high temperature.In females, long-term high temperature inhibits the expression of hsc70 expression and activates the expression of hsc70-like, thus keep the high expression of female sex-related genes such as cyp19a1a to maintain female sexual characteristics. In pseudomales with phenotypic males, high temperature inhibits the expression of hsc70-like and promote the expression of hsc70, which may inhibit cyp19a1a and promoting sox9a, resulting in the production of pseudomales. Hence, these two genes may be potential molecular markers for identifying pseudomales. However, since samples during the formation process of pseudomale fish were hardly collected, the assumption is still need to be verified.

4. Materials and Methods

4.1. Ethics Statement

All C. semilaevis samples were obtained from the Haiyang High-Tech Experimental Base (Haiyang, China) and acclimated for 48 h under laboratory conditions. After approval by the Institutional Animal Care and Use Committee (IACUC) of the Yellow Sea Fisheries Research Institute (CAFS) (Qingdao, China), the fish were collected and handled in accordance with the “Guidelines for Experimental Animals” of the Ministry of Science and Technology (Beijing, China).

4.2. Heat Shock Treatment Experiment and Fish Collection

Female and male samples of juvenile and adult fish reared under normal temperature (22 °C), at 1 mpf, 3 mpf, 6 mpf, 9 mpf, and 12 mpf were collected. Eleven tissue samples were collected for 12 mpf C. semilaevis, including heart, brain, liver, spleen, kidney, intestine, stomach, gill, skin, muscle, and gonads. Samples of gonad were taken from the remaining four stages, as well as from the 3 mpf females, males, and pseudomales after high-temperature (28 °C) long-term heat treatment (from 1 mpf to 3 mpf) and 48 h short-term heat treatment. Triplicate samples were frozen in liquid nitrogen and then stored in a freezer at −80 °C until use. The tail fin of each fish was soaked in 75% ethanol for extraction genomic DNA.

4.3. Extraction of Total RNA/Genomic DNA, and Identification of Genetic Sex

TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA from each sample. RNA concentration was measured with a NanoDrop 2000 spectrophotometer (Thermo, Waltham, MA, USA), and quality was assessed with agarose gel electrophoresis. A traditional phenol-chloroform extraction method was used to obtain genomic DNA from the tail fin. Using established methods and primer pairs (sex F and sex R in Table 1), we determined genetic sex of each fish.

4.4. Obtaining the Full-Length cDNA of hsc70 and hsc70-like though RACE

The first strand cDNA was synthesized from purified total RNA using the PrimeScriptTM II 1st Strand cDNA Synthesis Kit (Takara, Kusatsu, Japan). Primers (Table 1) were designed based on predicted sequences in the NCBI database to obtain partial cDNA fragments of hsc70 and hsc70-like with PCR. After sequence confirmation of the CDS region, 5′ and 3′ gene-specific primers (GSPs) and nested gene-specific primers (NGSPs) were designed for 5′ and 3′ Rapid Amplifi-cation of cDNA Ends (RACE) PCR (Table 1). In accordance with the manufacturer’s instructions, we used the SMARTer® RACE 5’/3’ Kit (Clontech, Mountain View, CA, USA) to amplify the 5′ and 3′ ends of hsc70 and hsc70-like. The PCR products were detected by agarose gel electrophoresis, and the corresponding band of interest was purified using a product purification kit (Vazyme, Nanjing, China). Finally, the purified fragments were connected to the pEASY-T1 (TransGen, Beijing, China) vector for Sanger sequencing.

4.5. Bioinformatics Analysis

A BLASTn tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 27 March 2022) was used to confirm the open reading frame (ORF). Expasy (https://prosite.expasy.org/ (accessed on 3 April 2022) was used to predict the protein domains. Multiple alignment of protein sequences from teleost fishes, amphibians, birds, and mammals were performed with Clustal Omega (http://www.clustal.org/omega/ (accessed on 5 April 2022) and colored using Adobe Illustrator 2020 (Adobe, San Jose, CA, USA). A neighbor-joining phylogenetic tree with 1000 bootstraps was constructed in MEGA-X.

4.6. Real-Time Quantitative PCR

TRIzol-extracted total RNA was synthesized into cDNA templates by using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Dalian, China). The QuantiNova SYBR Green PCR Kit (Qiagen, Hilden, Germany) was used for the RT—qPCR experiments. The system was 10 μL, which contained 5 μL 2 × SYBR Green PCR Master Mix, 0.4 μL primers (Table 1), and 1 μL of cDNA. Cycles consisted of 95 °C for 2 min, followed by 40 cycles of 95 °C for 5 s, and 60 °C for 10 s. Melting curve reaction conditions were 95°C for 15 s, 65 °C for 1 min, +0.11 °C/s to 95 °C, and 40 °C for 10 s, using a LightCycler ® 480 II system (Basel, Switzerland). β-actin was used as an internal reference gene. Each experiment was performed with three biological and three technical replicates. The data were processed by the 2−ΔΔCt method, and the relative expression of the target genes were analyzed by GraphPad Prism 6.0 (GraphPad, San Diego, CA, USA). Finally, t-tests or one-way ANOVA were used to ascertain significant differences.

4.7. Promoter Cloning and Plasmid Construction

Based on the C. semilaevis genomic sequencing data, the primer pair hsc70-pro F/R was designed for amplification and validation of the 2312 bp 5’ upstream sequence of hsc70 promoter, with SacI and XhoI recognition sites added to the 5’ ends of each specific primer, respectively (Table 1). The primer pair hsc70-like-pro F/R was designed to amplify and verify the 1781 bp 5’ upstream sequence of hsc70-like promoter. For forward and reverse primers, KpnI and XhoI identification sites were added at the 5’ ends, respectively (Table 1). The purified PCR product and pGL3-basic vector (Promega, Madison, WI, USA), which contains the firefly luciferase gene, were cleaved with corresponding enzymes and ligated with T4 DNA ligase (Monad, Suzhou, China) to obtain phsc70-luc and phsc70-like-luc. Negative control was set with pGL3-basic, and positive control was set with pGL3-control. For the GFP observation experiment, NdeI and XhoI identification sites were added to the 5’ ends of each promoter primer, respectively (Table 1). The purified PCR product and pEGFP-N3 vector, which contains the GFP, were cleaved with corresponding enzymes and ligated with T4 DNA ligase to obtain phsc70-gfp and phsc70-like-gfp. The pEGFP-N3 vector was used as the negative control. The ORFs of hsc70 and hsc70-like were amplified and cloned into the KpnI and XbaI identification sites of pcDNA3.1(+) (Invitrogen) to obtain pcDNA3.1-hsc70 and pcDNA3.1-hsc70-like. An EndoFree Plasmid Mini Kit (TIANGEN, Beijing, China) was used to prepare all plasmids.

4.8. HEK293T Cell Culture, Transfection, Heat Shock, and Luciferase Assay

Human embryonal kidney (HEK) 293T cells used in the study was purchased from the Shanghai Institute of Cell Biology and were cultured using 293T [HEK-293T] cell-specific medium (Procell, Wuhan, China). The incubating conditions were 37 °C with 5% CO2. For the dual-luciferase experiment, 500 ng of promoter-luciferase overexpression vector and 40 ng of pRL-TK plasmid (Renilla luciferase gene driven by HSV thymidine kinase promoter) were cotransfected in a 24-well culture plate using Lipofectamine 3000 Reagent (Invitrogen). After cotransfection for 48 h, the heat treatment was conducted with a water bath that gradually increased the temperature from 37 to 42 °C. The heat shock was conducted for 0.5, 1, and 1.5 h, respectively. Cells were collected using the Dual-Luciferase ® Reporter Assay System (Promega) and Varioskan Flash Spectro-Scopic Scan multimode reader (Thermo, Vantaa, Finland) for testing. For the GFP reporter assay, 500 ng of promoter-gfp vector was transfected in a 24-well culture plate using Lipofectamine 3000 Reagent. After 48 h of transfection, the same heat treatment was performed as in the dual-luciferase experiment. The gfp fluorescence was observed and recorded using an Olympus IX73 inverted microscope (Olympus, Tokyo, Japan). Each experiment was performed in triplicate.

4.9. Culture, Transfection, and Heat Shock of C. semilaevis Testis Cell Line

The C. semilaevis testis cell line originated from the researchers’ own laboratory and was cultured at 24 °C in L15 medium (Solarbio, Beijing, China) added with 20% fetal bovine serum (FBS) (Gibco, Carlsbad, CA, USA), 2 ng/mL bFGF, 2 ng/mL LIF, 800 U/mL penicillin, 800 μg/mL streptomycin, and 400 μg/mL gentamicin (Solarbio). Lipofectamine 3000 Reagent was used to transfect 500 ng of pcDNA 3.1-hsc70 and pcDNA 3.1-hsc70-like into 24-well plates. After transfection for 24 h, the cells were treated in a water bath gradually heated from 24 to 28 °C and heat treated for 0.5, 0.75, 1, 1.5, and 2 h, respectively. RNA was extracted using TRIzol reagents and sex-related gene expression abundance was detected with RT—qPCR. Three repetitions were performed each treatment.

4.10. Statistical Analysis

All experiments were performed in triplicate. All data were shown as means ± SEM. Prism 6.0 (GraphPad) was used for data processing, and t-tests and one-way ANOVA followed by Bonferroni’s multiple comparison tests were used for analysis; p-values of ≤0.05 were considered statistically significant. (* p < 0.05; ** p < 0.01; *** p < 0.001).

5. Conclusions

In conclusion, the hsc70 and hsc70-like genes were validated in C. semilaevis whose sexes can be related to ambient temperature. According to bioinformatics analysis, the hsc70 and hsc70-like genes were highly conserved in vertebrates. In addition, the expression pattern results showed that both hsc70 and hsc70-like were highly expressed in the gonads of adult fish and much higher in testes than in ovaries. At different stages of gonadal development, hsc70 showed ovarian-higher expression at 6 mpf, and hsc70-like showed a testicular-higher expression from 6 mpf on. All these findings supported the potential role of the target genes in sex determination and differentiation. Both long-term heat treatment during the temperature-sensitive sex-determining period and short-term heat stress at the end of this period caused upregulated expression of hsc70 in pseudomales and downregulated expression of hsc70-like in pseudomales. The dual-luciferase assay and fluorescence observation also proved that the target genes could rapidly respond to high temperature in vitro. Heat shock treatment of C. semilaevis testis cell line overexpressed with hsc70 and hsc70-like could affect the expression of sex-related genes sox9a and cyp19a1a. These results indicated that hsc70 and hsc70-like could rapidly respond to external high temperatures and were related to gonadal differentiation. Therefore, hsc70 and hsc70-like are key elements linking external high temperature signals with sex differentiation in vivo.

Author Contributions

Conceptualization, C.S., Q.W. and Q.L.; methodology, Q.L., Q.W., Y.W. and L.T.; software, Q.L. and W.M.; validation, L.T., X.Z., Y.W. and Q.L.; investigation, Y.W. and Q.L.; writing—original draft preparation, Q.L., Q.W. and C.S.; writing—review and editing, Q.L., Q.W. and C.S.; visualization, Q.L.; supervision, Q.W. and C.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Central Public-interest Scientific Institution Basal Research Fund, YSFRI, CAFS (grant number 20603022021018), the National Key R&D Program of China (grant number 2022YFD2400100), the National Nature Science Foundation of China (grant numbers 31722058 and 31472269), the AoShan Talents Cultivation Program Supported by Qingdao National Laboratory for Marine Science and Technology (grant number 2017ASTCP-ES06), the Taishan Scholars Program (NO. tstp20221149) to C.S, the National Ten-Thousands Talents Special Support Program to C.S., the Central Public-interest Scientific Institution Basal Research Fund, CAFS (grant number 2020TD19), the China Agriculture Research System (grant number CARS-47-G03), and the project by the National Marine Genetic Resource Center.

Institutional Review Board Statement

The animal study protocol was approved by the Institutional Animal Care and Use Committee (IACUC) of the Yellow Sea Fisheries Research Institute (CAFS) (Qingdao, China) (Approval No.: YSFRI-2023001).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Morrish, B.C.; Sinclair, A.H. Vertebrate sex determination: Many means to an end. Reproduction 2002, 124, 447–457. [Google Scholar] [CrossRef]
  2. Doris, B.; Judith, E.M.; Catherine, L.P.; Mark, K.; Sarah, P.O.; Tia-Lynn, A.; Matthew, W.H.; Jun, K.; Itay, M.; Ray, M.; et al. Sex determination: Why so many ways of doing it? PLoS Biol. 2014, 12, e1001899. [Google Scholar]
  3. Bull, J.J. Evolution of environmental sex determination from genotypic sex determination. Heredity 1981, 47, 173–184. [Google Scholar] [CrossRef]
  4. Marshall Graves, J.A. Weird animal genomes and the evolution of vertebrate sex and sex chromosomes. Annu. Rev. Genet. 2008, 42, 565–586. [Google Scholar] [CrossRef]
  5. Desprez, D.; Mélard, C. Effect of ambient water temperature on sex determinism in the blue tilapia Oreochromis aureus. Aquaculture 1998, 162, 79–84. [Google Scholar] [CrossRef]
  6. Patiño, R.; Davis, K.B.; Schoore, J.E.; Uguz, C.; Strüssmann, C.A.; Parker, N.C.; Simco, B.A.; Goudie, C.A. Sex differentiation of channel catfish gonads: Normal development and effects of temperature. J. Exp. Zool. 1996, 276, 209–218. [Google Scholar] [CrossRef]
  7. Kitano, T.; Takamune, K.; Kobayashi, T.; Nagahama, Y.; Abe, S.-I. Suppression of P450 aromatase gene expression in sex-reversed males produced by rearing genetically female larvae at a high water temperature during a period of sex differentiation in the Japanese flounder (Paralichthys olivaceus). J. Mol. Endocrinol. 1999, 23, 167–176. [Google Scholar] [CrossRef]
  8. Abozaid, H.; Wessels, S.; Hörstgen-Schwark, G. Effect of rearing temperatures during embryonic development on the phenotypic sex in zebrafish (Danio rerio). Sex Dev. 2011, 5, 259–265. [Google Scholar] [CrossRef] [PubMed]
  9. Daisuke, U.; Michiaki, Y.; Takeshi, K.; Taisen, I. Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish. J. Exp. Biol. 2002, 205, 711–718. [Google Scholar]
  10. Uchida, D.; Yamashita, M.; Kitano, T.; Iguchi, T. An aromatase inhibitor or high water temperature induce oocyte apoptosis and depletion of P450 aromatase activity in the gonads of genetic female zebrafish during sex-reversal. Comp. Biochem. Physiol. Part A 2004, 137, 11–20. [Google Scholar] [CrossRef]
  11. Baroiller, J.F.; Chourrout, D.; Fostier, A.; Jalabert, B. Temperature and sex chromosomes govern sex ratios of the mouthbrooding Cichlid fish Oreochromis niloticus. J. Exp. Zool. 1995, 273, 216–223. [Google Scholar] [CrossRef]
  12. Chen, S.; Zhang, G.; Shao, C.; Huang, Q.; Liu, G.; Zhang, P.; Song, W.; An, N.; Chalopin, D.; Volff, J.; et al. Whole-genome sequence of a flatfish provides insights into ZW sex chromosome evolution and adaptation to a benthic lifestyle. Nat. Genet. 2014, 46, 253–260. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Wang, H.; Gao, Z.; Rapp, D.; O’Bryant, P.; Yao, H.; Cao, X. Effects of temperature and genotype on sex determination and sexual size dimorphism of bluegill sunfish Lepomis macrochirus. Aquaculture 2014, 420–421, S64–S71. [Google Scholar] [CrossRef]
  14. Caroline, J.; Morimoto, I.R. Role of the heat shock response and molecular chaperones in oncogenesis and cell death. J. Natl. Cancer Inst. 2000, 92, 1564–1572. [Google Scholar]
  15. Feder, M.E.; Hofmann, G.E. Heat-shock proteins, molecular chaperones, and the stress response: Evolutionary and ecological physiology. Annu. Rev. Physiol. 1999, 61, 243–282. [Google Scholar] [CrossRef] [PubMed]
  16. Zhuravleva, A.; Gierasch, L.M. Substrate-binding domain conformational dynamics mediate Hsp70 allostery. Proc. Natl. Acad. Sci. USA 2015, 112, S2825–S2873. [Google Scholar] [CrossRef] [PubMed]
  17. Zhang, A.; Zhou, X.; Wang, X.; Zhou, H. Characterization of two heat shock proteins (Hsp70/Hsc70) from grass carp (Ctenopharyngodon idella): Evidence for their differential gene expression, protein synthesis and secretion in LPS-challenged peripheral blood lymphocytes. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2011, 159, 109–114. [Google Scholar] [CrossRef] [PubMed]
  18. Beg, M.U.; Al-Subiai, S.; Beg, K.R.; Butt, S.A.; Al-Jandal, N.; Al-Hasan, E.; Al-Hussaini, M. Seasonal. Effect on heat shock proteins in fish from kuwait bay. Bull Environ. Contam. Toxicol. 2010, 84, 91–95. [Google Scholar] [CrossRef]
  19. Park, H.; Ahn, I.Y.; Lee, H.E. Expression of heat shock protein 70 in the thermally stressed antarctic clam Laternula elliptica. Cell Stress Chaperones 2007, 12, 275–282. [Google Scholar] [CrossRef] [PubMed]
  20. Goldfarb, S.B.; Kashlan, O.B.; Watkins, J.N.; Suaud, L.; Yan, W.; Kleyman, T.R.; Rubenstein, R.C. Differential effects of Hsc70 and Hsp70 on the intracellular trafficking and functional expression of epithelial sodium channels. Proc. Natl. Acad. Sci. USA 2006, 103, 5817–5822. [Google Scholar] [CrossRef]
  21. Uchimura, T.; Hara, S.; Yazawa, T.; Kamei, Y.; Kitano, T. Involvement of heat shock proteins on the transcriptional regulation of corticotropin-releasing hormone in medaka. Front Endocrinol. 2019, 10, 529. [Google Scholar] [CrossRef] [PubMed]
  22. Wang, C.; Chen, X.; Dai, Y.; Zhang, Y.; Sun, Y.; Cui, X. Comparative transcriptome analysis of heat-induced domesticated zebrafish during gonadal differentiation. BMC Genom. 2022, 23, 39. [Google Scholar] [CrossRef]
  23. Wang, Q.; Hao, X.; Liu, K.; Feng, B.; Li, S.; Zhang, Z.; Tang, L.; Mahboob, S.; Shao, C. Early response to heat stress in Chinese tongue sole (Cynoglossus semilaevis): Performance of different sexes, candidate genes and networks. BMC Genom. 2020, 21, 1–10. [Google Scholar] [CrossRef]
  24. Wang, Q.; Liu, K.; Feng, B.; Zhang, Z.; Wang, R.; Tang, L.; Li, W.; Li, Q.; Piferrer, F.; Shao, C. Transcriptome of gonads from high temperature induced sex reversal during sex determination and differentiation in Chinese tongue sole, Cynoglossus semilaevis. Front Genet. 2019, 10, 1128. [Google Scholar] [CrossRef]
  25. Chen, S.; Tian, Y.; Yang, J.; Shao, C.; Ji, X.; Zhai, J.; Liao, X.; Zhuang, Z.; Su, P.; Xu, J.; et al. Artificial gynogenesis and sex determination in half-smooth tongue sole (Cynoglossus semilaevis). Mar. Biotechnol. 2009, 11, 243–251. [Google Scholar] [CrossRef] [PubMed]
  26. Liao, X.; Ma, H.; Xu, G.; Shao, C.; Tian, Y.; Ji, X.; Yang, J.; Chen, S. Construction of a genetic linkage map and mapping of a female-specific DNA marker in half-smooth tongue sole (Cynoglossus semilaevis). Mar. Biotechnol. 2009, 11, 699–709. [Google Scholar] [CrossRef]
  27. Shao, C.; Li, Q.; Chen, S.; Zhang, P.; Lian, J.; Hu, Q.; Sun, B.; Jin, L.; Liu, S.; Wang, Z.; et al. Epigenetic modification and inheritance in sexual reversal of fish. Genome Res. 2014, 24, 604–615. [Google Scholar] [CrossRef]
  28. Freeman, C.B.; Myers, P.M.; Robert, S.; Morimoto, I.R. Identification of a regulatory motif in Hsp70 that affects ATPase activity, substrate binding and interaction with HDJ-1. EMBO J. 1995, 14, 2281–2292. [Google Scholar] [CrossRef] [PubMed]
  29. Liu, T.; Daniels, C.K.; Cao, S. Comprehensive review on the HSC70 functions, interactions with related molecules and involvement in clinical diseases and therapeutic potential. Pharmacol. Therapeut. 2012, 136, 354–374. [Google Scholar] [CrossRef] [PubMed]
  30. Zafarullah, M.; Wisniewski, J.; Shworak, N.W.; Schieman, S.; Misra, S.; Gedamu, L. Molecular cloning and characterization of a constitutively expressed heat-shock-cognate hsc71 gene from rainbow trout. Eur. J. Biochem. 1992, 204, 893–900. [Google Scholar] [CrossRef]
  31. Ali, K.S.; Dorgai, L.; Ábrahám, M.; Hermesz, E. Tissue- and stressor-specific differential expression of two hsc70 genes in carp. Biochem. Biophys. Res. Commun. 2003, 307, 503–509. [Google Scholar] [CrossRef]
  32. Wang, P.; Xu, P.; Zeng, S.; Zhou, L.; Zeng, L.; Li, G. Comparative analysis of sequence feature and expression of two heat shock cognate 70 genes in mandarin fish Siniperca chuatsi. Gene 2015, 560, 226–236. [Google Scholar] [CrossRef]
  33. Poompoung, P.; Panprommin, D.; Srisapoome, P.; Poompuang, S. Cloning and expression of two hsc70 genes in walking catfish Clarias macrocephalus (Günther, 1864) challenged with Aeromonas hydrophila. Aquac. Res. 2014, 45, 1319–1331. [Google Scholar] [CrossRef]
  34. Lu, Y.; Liu, Q.; Liu, K.; Wang, H.; Li, C.; Wang, Q.; Shao, C. Identification of global alternative splicing and sex-specific splicing via comparative transcriptome analysis of gonads of Chinese tongue sole (Cynoglossus semilaevis). Zool. Res. 2022, 43, 319–330. [Google Scholar] [CrossRef]
  35. Zhao, X.; Feng, B.; Wang, Q.; Tang, L.; Liu, Q.; Ma, W.; Li, C.; Shao, C. Cloning of the maternal effector gene org and its regulation by lncRNA ORG-AS in Chinese tongue sole (Cynoglossus semilaevis). Int. J. Mol. Sci. 2022, 23, 8605. [Google Scholar] [CrossRef]
  36. Ahn, S.; Kim, S.; Yoon, J.; Vacratsis, P. Heat-shock cognate 70 is required for the activation of heat-shock factor 1 in mammalian cells. Biochem. J. 2005, 392, 145–152. [Google Scholar] [CrossRef] [PubMed]
  37. Chuang, K.; Ho, S.; Song, Y. Cloning and expression analysis of heat shock cognate 70 gene promoter in tiger shrimp (Penaeus monodon). Gene 2007, 405, 10–18. [Google Scholar] [CrossRef] [PubMed]
  38. Dong, X.; Chen, S.; Ji, X.; Shao, C. Molecular cloning, characterization and expression analysis of sox9a and foxl2 genes in half-smooth tongue sole (Cynoglossus semilaevis). ACTA Oceanol. Sin. 2011, 30, 68–77. [Google Scholar] [CrossRef]
  39. Shao, C.; Liu, G.; Liu, S.; Liu, C.; Chen, S. Characterization of the cyp19a1a gene from a BAC sequence in half-smooth tongue sole (Cynoglossus semilaevis) and analysis of its conservation among teleosts. ACTA Oceanol. Sin. 2013, 32, 35–43. [Google Scholar] [CrossRef]
  40. Deng, S.; Chen, S.; Xu, J.; Liu, B. Molecular cloning, characterization and expression analysis of gonadal P450 aromatase in the half-smooth tongue-sole, Cynoglossus semilaevis. Aquaculture 2009, 287, 211–218. [Google Scholar] [CrossRef]
  41. Wang, Y.Y.; Sun, L.X.; Zhu, J.J.; Zhao, Y.; Wang, H.; Liu, H.J.; Ji, X.S. Epigenetic control of cyp19a1a expression is critical for high temperature induced Nile tilapia masculinization. J. Therm. Biol. 2017, 69, 76–84. [Google Scholar] [CrossRef] [PubMed]
  42. Liu, J.; Liu, X.; Jin, C.; Du, X.; He, Y.; Zhang, Q. Transcriptome profiling insights the feature of sex reversal induced by high temperature in tongue sole Cynoglossus semilaevis. Front Genet. 2019, 10, 522. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Figure 1. Full-length cDNA and predicted protein sequences of C. semilaevis hsc70 and hsc70-like genes. (a) The mRNA and predicted protein sequence of hsc70; (b) The mRNA and predicted protein sequence of hsc70-like. The yellow shadows represented the conserved sequences of the HSP70 family, the green shaded EEVD is the cytoplasmic motif in the C-terminal region, the grey shadows represented the initiation codon and termination codon, and the asterisk (*) represented the termination codon. The poly (A) tail was underlined.
Figure 1. Full-length cDNA and predicted protein sequences of C. semilaevis hsc70 and hsc70-like genes. (a) The mRNA and predicted protein sequence of hsc70; (b) The mRNA and predicted protein sequence of hsc70-like. The yellow shadows represented the conserved sequences of the HSP70 family, the green shaded EEVD is the cytoplasmic motif in the C-terminal region, the grey shadows represented the initiation codon and termination codon, and the asterisk (*) represented the termination codon. The poly (A) tail was underlined.
Ijms 24 03761 g001
Figure 2. Multiple sequence alignment of HSC and HSC70-LIKE protein sequences from C. semilaevis and other vertebrates. GenBank accession numbers for protein sequences were as follows: XP_043872802.1 (Solea senegalensis), XP_020363711.1 (Oncorhynchus kisutch), XP_042153383.1 (Oncorhynchus tshawytscha), XP_019941072.1 (Paralichthys olivaceus), XP_043897279.1 (Solea senegalensis), XP_027129165.1 (Larimichthys crocea), XP_003448938.1 (Oreochromis niloticus), XP_024298732.1 (Oncorhynchus tshawytscha), XP_020358882.1 (Oncorhynchus kisutch), XP_002937574.2 (Xenopus tropicalis), NP_990334.2 (Gallus gallus), NP_112442.2 (Mus musculus), and XP_011541100.1 (Homo sapiens). The pink boxes indicated high similarity, while the blue boxes indicated completely identical residues.
Figure 2. Multiple sequence alignment of HSC and HSC70-LIKE protein sequences from C. semilaevis and other vertebrates. GenBank accession numbers for protein sequences were as follows: XP_043872802.1 (Solea senegalensis), XP_020363711.1 (Oncorhynchus kisutch), XP_042153383.1 (Oncorhynchus tshawytscha), XP_019941072.1 (Paralichthys olivaceus), XP_043897279.1 (Solea senegalensis), XP_027129165.1 (Larimichthys crocea), XP_003448938.1 (Oreochromis niloticus), XP_024298732.1 (Oncorhynchus tshawytscha), XP_020358882.1 (Oncorhynchus kisutch), XP_002937574.2 (Xenopus tropicalis), NP_990334.2 (Gallus gallus), NP_112442.2 (Mus musculus), and XP_011541100.1 (Homo sapiens). The pink boxes indicated high similarity, while the blue boxes indicated completely identical residues.
Ijms 24 03761 g002
Figure 3. Phylogenetic tree of target genes. The tree was constructed using nucleic acid sequences of hsc70 and hsc70-like from different species using the neighbor joining method with 1000 bootstrap replicates. Numbers at nodes indicated bootstrap support. C. semilaevis hsc70 and hsc70-like genes were red and labelled with asterisk (*).
Figure 3. Phylogenetic tree of target genes. The tree was constructed using nucleic acid sequences of hsc70 and hsc70-like from different species using the neighbor joining method with 1000 bootstrap replicates. Numbers at nodes indicated bootstrap support. C. semilaevis hsc70 and hsc70-like genes were red and labelled with asterisk (*).
Ijms 24 03761 g003
Figure 4. Expression of hsc70 and hsc70-like genes in adult C. semilaevis tissues. (a,b) Detection of hsc70 (a) and hsc70-like (b) expression in C. semilaevis tissues by RT—qPCR. Means ± SEM from three independent individuals (n = 3) were shown. β-actin was used as the reference gene. Asterisks indicated statistically significant differences (* p <0.05; ** p < 0.01; *** p < 0.001).
Figure 4. Expression of hsc70 and hsc70-like genes in adult C. semilaevis tissues. (a,b) Detection of hsc70 (a) and hsc70-like (b) expression in C. semilaevis tissues by RT—qPCR. Means ± SEM from three independent individuals (n = 3) were shown. β-actin was used as the reference gene. Asterisks indicated statistically significant differences (* p <0.05; ** p < 0.01; *** p < 0.001).
Ijms 24 03761 g004
Figure 5. Expression of hsc70 and hsc70-like genes in the gonads of male and female C. semilaevis at different stages. (a) Expression of hsc70 during male and female gonadal development; (b) Relative gene expression of hsc70-like during male and female gonadal development. Relative mRNA levels were shown as the means ± SEM (n = 3), and values were normalized using β-actin as the internal control. * p <0.05; ** p < 0.01; *** p < 0.001. mpf, months post fertilization.
Figure 5. Expression of hsc70 and hsc70-like genes in the gonads of male and female C. semilaevis at different stages. (a) Expression of hsc70 during male and female gonadal development; (b) Relative gene expression of hsc70-like during male and female gonadal development. Relative mRNA levels were shown as the means ± SEM (n = 3), and values were normalized using β-actin as the internal control. * p <0.05; ** p < 0.01; *** p < 0.001. mpf, months post fertilization.
Ijms 24 03761 g005
Figure 6. Gonadal expression of hsc70 and hsc70-like genes in C. semilaevis under different high-temperature treatments. (a,b) Expression pattern of hsc70 in the gonads of 3 mpf C. semilaevis under short-term (a) and long-term (b) high-temperature treatment; (c,d) Expression pattern of hsc70-like in the gonads of 3 mpf C. semilaevis under short-term (c) and long-term (d) high-temperature treatment. The expression of target genes were shown as means ± SEM (n = 3). β-actin as the internal control. CT, control treatment; ST, short-term heat stress treatment; LT, long-term heat treatment. Different letters indicated statistically significant differences (p < 0.05).
Figure 6. Gonadal expression of hsc70 and hsc70-like genes in C. semilaevis under different high-temperature treatments. (a,b) Expression pattern of hsc70 in the gonads of 3 mpf C. semilaevis under short-term (a) and long-term (b) high-temperature treatment; (c,d) Expression pattern of hsc70-like in the gonads of 3 mpf C. semilaevis under short-term (c) and long-term (d) high-temperature treatment. The expression of target genes were shown as means ± SEM (n = 3). β-actin as the internal control. CT, control treatment; ST, short-term heat stress treatment; LT, long-term heat treatment. Different letters indicated statistically significant differences (p < 0.05).
Ijms 24 03761 g006
Figure 7. High temperature activates promoter activity of hsc70 and hsc70-like genes in vitro. (a,b). Luciferase activity analysis of hsc70-promoter (a) /hsc70-like-promoter (b) under 42 °C heat shock in HEK293T cell and the pGL3-basic plasmid was used as a negative control; (c,d). gfp fluorescence analysis of hsc70-promoter (c) /hsc70-like-promoter (d) under 42 °C heat shock in HEK293T cell and the pEGFP-N3 plasmid was used as a negative control. The 42 °C heat shock treatment was conducted at 48 h post transfection. Luciferase activities and gfp relative expression were shown as means ± SEM (n = 3) and HEK293T β-actin was used as the internal reference (ad). * p < 0.05.
Figure 7. High temperature activates promoter activity of hsc70 and hsc70-like genes in vitro. (a,b). Luciferase activity analysis of hsc70-promoter (a) /hsc70-like-promoter (b) under 42 °C heat shock in HEK293T cell and the pGL3-basic plasmid was used as a negative control; (c,d). gfp fluorescence analysis of hsc70-promoter (c) /hsc70-like-promoter (d) under 42 °C heat shock in HEK293T cell and the pEGFP-N3 plasmid was used as a negative control. The 42 °C heat shock treatment was conducted at 48 h post transfection. Luciferase activities and gfp relative expression were shown as means ± SEM (n = 3) and HEK293T β-actin was used as the internal reference (ad). * p < 0.05.
Ijms 24 03761 g007
Figure 8. Analysis of sex-related genes after the overexpression of target genes under heat shock treatment. (a,b) Relative expression of sox9a in C. semilaevis testis cell line overexpression with hsc70 (a) /hsc70-like (b); (c,d) Relative expression of cyp19a1a in C. semilaevis testis cell line overexpression with hsc70 (c) /hsc70-like (d). After transfection with pcDNA3.1-hsc70/pcDNA3.1-hsc70-like for 24 h, 28 °C heat shock treatment was conducted and lasted for 2 h. pcDNA 3.1 plasmid was set as negative control (NC). Relative expression results were shown as the means ± SEM (n = 3), and β-actin was normalized as an internal standard. Different lowercase letters indicated statistically significant differences (p < 0.05).
Figure 8. Analysis of sex-related genes after the overexpression of target genes under heat shock treatment. (a,b) Relative expression of sox9a in C. semilaevis testis cell line overexpression with hsc70 (a) /hsc70-like (b); (c,d) Relative expression of cyp19a1a in C. semilaevis testis cell line overexpression with hsc70 (c) /hsc70-like (d). After transfection with pcDNA3.1-hsc70/pcDNA3.1-hsc70-like for 24 h, 28 °C heat shock treatment was conducted and lasted for 2 h. pcDNA 3.1 plasmid was set as negative control (NC). Relative expression results were shown as the means ± SEM (n = 3), and β-actin was normalized as an internal standard. Different lowercase letters indicated statistically significant differences (p < 0.05).
Ijms 24 03761 g008
Table 1. Primers used in this report.
Table 1. Primers used in this report.
Primer NameSequence (5’-3’)Purpose
hsc70-FCGAAGCATGTAACTTCCTTTTCPartial fragment
hsc70-RGTGATGAACCGAGTGATACCAAamplification
hsc70-like-FTCATCCTCTCAACCAACTAACC
hsc70-like-RTCACATCCTCACAGATCAAAAA
hsc70-pro-FGAAAGATACAGTTAAAGCCCCAGG
hsc70-pro-RCATGATTCCTAGTTAGAAAAAGAAAAGTG
hsc70-like-pro-FTCCATTAGAAGCCCCTCACGAT
hsc70-like-pro-RGTCTTTGAACCTGAGGAGGCAAC
hsc70-5’gspTGTTGTCCTGTTGCCCTGGTCGTTGGCRACE
hsc70-3’gspGGTATGCCTGGTGGCTTCTCCGGTGCA
hsc70-5’ngspCGGTGTTAGAAGGAAAAGGAAG
hsc70-3’ngspTCTGGACCAACCATTGAGGAGGTCGAC
hsc70-like-5’gspCATGCTGGAACACGGCCACACAGGA
hsc70-like-3’gspCTGATTTCCCTGGGCCTAGAGGCGA
hsc70-like-5’ngspTTCGACATGTCTTTGAACCTGAGGGGTT
hsc70-like-3’ngspACAGCAGTTGTACCAGTTCACAGACGTT
hsc70-qFACAAGAACCAGACTGCCGAGAAGRT—qPCR
hsc70-qRCCTCAGGCATGTTACCAGACATTC
hsc70-like-qFAGTGTGTCAAACGCCGTGGTAA
hsc70-like-qRCCACCTTTTTGTCCAGACCGTAG
β-actin-qFGCTGTGCTGTCCCTGTA
β-actin-qRGAGTAGCCACGCTCTGTC
gfp-qFACAACAGCCACAACGTCTAT
gfp -qRATGTTGTGGCGGATCTTGAA
293Tβ-actin-qFGATGATATCGCCGCGCTCGT
293Tβ-actin-qRGTAGATGGGCACAGTGTGGGTG
sox9a-qFCAGGCAGGTAATGTTGGGGT
sox9a-qRAAGGAGCCGTAGGTGATGTG
cyp19a1a-qFCTCTGTTCCTCAGGTTTCTCTC
cyp19a1a-qRGATGTGACCCAGTGTGTGTTG
hsc70-proluc-FcgagctcGAAAGATACAGTTAAAGCCPlasmid construction
hsc70-proluc-RccgctcgagGATTCCTAGTTAGAAAAAG
hsc70-progfp-FggaattccatatgGAAAGATACAGTTAAAGCCCCAG
hsc70-prgfp-RccgctcgagGATTCCTAGTTAGAAAAAGAAAAGTGAT
hsc70-like-proluc-FggggtaccTCCATTAGAAGCCCCTCAC
hsc70-like-proluc-RccgctcgagGTCTTTGAACCTGAGGA
hsc70-like-progfp-FggaattccatatgTCCATTAGAAGCCCCTCAC
hsc70-like-progfp-RccgctcgagGTCTTTGAACCTGAG
hsc70-CDS-FggggtaccATGTCAAAGGGACCAG
hsc70-CDS-RgctctagaGTCGACCTCCTCAATGGTTG
hsc70-like-CDS-FggggtaccATGTCGAAGGAAACAGC
hsc70-like-CDS-RgctctagaGTCAACCTCCTCCACTGTG
sex-FCCTAAATGATGGATGTAGATTCTGTCSex identification
sex-RGATCCAGAGAAAATAAACCCAGG
The primer sequence is indicated by uppercase letters, while restriction enzyme sites with protective nucleotides are indicated by lowercase letters.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, Q.; Wang, Y.; Tan, L.; Ma, W.; Zhao, X.; Shao, C.; Wang, Q. The Role of the Heat Shock Cognate Protein 70 Genes in Sex Determination and Differentiation of Chinese Tongue Sole (Cynoglossus semilaevis). Int. J. Mol. Sci. 2023, 24, 3761. https://doi.org/10.3390/ijms24043761

AMA Style

Liu Q, Wang Y, Tan L, Ma W, Zhao X, Shao C, Wang Q. The Role of the Heat Shock Cognate Protein 70 Genes in Sex Determination and Differentiation of Chinese Tongue Sole (Cynoglossus semilaevis). International Journal of Molecular Sciences. 2023; 24(4):3761. https://doi.org/10.3390/ijms24043761

Chicago/Turabian Style

Liu, Qian, Yue Wang, Leilei Tan, Wenxiu Ma, Xiaona Zhao, Changwei Shao, and Qian Wang. 2023. "The Role of the Heat Shock Cognate Protein 70 Genes in Sex Determination and Differentiation of Chinese Tongue Sole (Cynoglossus semilaevis)" International Journal of Molecular Sciences 24, no. 4: 3761. https://doi.org/10.3390/ijms24043761

APA Style

Liu, Q., Wang, Y., Tan, L., Ma, W., Zhao, X., Shao, C., & Wang, Q. (2023). The Role of the Heat Shock Cognate Protein 70 Genes in Sex Determination and Differentiation of Chinese Tongue Sole (Cynoglossus semilaevis). International Journal of Molecular Sciences, 24(4), 3761. https://doi.org/10.3390/ijms24043761

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop