The Role of the Heat Shock Cognate Protein 70 Genes in Sex Determination and Differentiation of Chinese Tongue Sole (Cynoglossus semilaevis)
Abstract
1. Introduction
2. Results
2.1. Cloning and Sequence Characteristics of hsc70 and hsc70-like
2.2. Multiple Sequence Alignment and Phylogenetic Analysis
2.3. Expression Pattern of hsc70 and hsc70-like in C. semilaevis
2.4. Expression Pattern of hsc70 and hsc70-like during Gonadal Development
2.5. Expression Patterns of hsc70 and hsc70-like in Gonads after Heat Treatment in C. semilaevis
2.6. hsc70 and hsc70-like Genes Can Respond to High Temperature Rapidly In Vitro
2.7. hsc70 and hsc70-like Genes Can Affect the Expression of Sex-Related Genes under High Temperature
3. Discussion
4. Materials and Methods
4.1. Ethics Statement
4.2. Heat Shock Treatment Experiment and Fish Collection
4.3. Extraction of Total RNA/Genomic DNA, and Identification of Genetic Sex
4.4. Obtaining the Full-Length cDNA of hsc70 and hsc70-like though RACE
4.5. Bioinformatics Analysis
4.6. Real-Time Quantitative PCR
4.7. Promoter Cloning and Plasmid Construction
4.8. HEK293T Cell Culture, Transfection, Heat Shock, and Luciferase Assay
4.9. Culture, Transfection, and Heat Shock of C. semilaevis Testis Cell Line
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Morrish, B.C.; Sinclair, A.H. Vertebrate sex determination: Many means to an end. Reproduction 2002, 124, 447–457. [Google Scholar] [CrossRef]
- Doris, B.; Judith, E.M.; Catherine, L.P.; Mark, K.; Sarah, P.O.; Tia-Lynn, A.; Matthew, W.H.; Jun, K.; Itay, M.; Ray, M.; et al. Sex determination: Why so many ways of doing it? PLoS Biol. 2014, 12, e1001899. [Google Scholar]
- Bull, J.J. Evolution of environmental sex determination from genotypic sex determination. Heredity 1981, 47, 173–184. [Google Scholar] [CrossRef]
- Marshall Graves, J.A. Weird animal genomes and the evolution of vertebrate sex and sex chromosomes. Annu. Rev. Genet. 2008, 42, 565–586. [Google Scholar] [CrossRef]
- Desprez, D.; Mélard, C. Effect of ambient water temperature on sex determinism in the blue tilapia Oreochromis aureus. Aquaculture 1998, 162, 79–84. [Google Scholar] [CrossRef]
- Patiño, R.; Davis, K.B.; Schoore, J.E.; Uguz, C.; Strüssmann, C.A.; Parker, N.C.; Simco, B.A.; Goudie, C.A. Sex differentiation of channel catfish gonads: Normal development and effects of temperature. J. Exp. Zool. 1996, 276, 209–218. [Google Scholar] [CrossRef]
- Kitano, T.; Takamune, K.; Kobayashi, T.; Nagahama, Y.; Abe, S.-I. Suppression of P450 aromatase gene expression in sex-reversed males produced by rearing genetically female larvae at a high water temperature during a period of sex differentiation in the Japanese flounder (Paralichthys olivaceus). J. Mol. Endocrinol. 1999, 23, 167–176. [Google Scholar] [CrossRef]
- Abozaid, H.; Wessels, S.; Hörstgen-Schwark, G. Effect of rearing temperatures during embryonic development on the phenotypic sex in zebrafish (Danio rerio). Sex Dev. 2011, 5, 259–265. [Google Scholar] [CrossRef] [PubMed]
- Daisuke, U.; Michiaki, Y.; Takeshi, K.; Taisen, I. Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish. J. Exp. Biol. 2002, 205, 711–718. [Google Scholar]
- Uchida, D.; Yamashita, M.; Kitano, T.; Iguchi, T. An aromatase inhibitor or high water temperature induce oocyte apoptosis and depletion of P450 aromatase activity in the gonads of genetic female zebrafish during sex-reversal. Comp. Biochem. Physiol. Part A 2004, 137, 11–20. [Google Scholar] [CrossRef]
- Baroiller, J.F.; Chourrout, D.; Fostier, A.; Jalabert, B. Temperature and sex chromosomes govern sex ratios of the mouthbrooding Cichlid fish Oreochromis niloticus. J. Exp. Zool. 1995, 273, 216–223. [Google Scholar] [CrossRef]
- Chen, S.; Zhang, G.; Shao, C.; Huang, Q.; Liu, G.; Zhang, P.; Song, W.; An, N.; Chalopin, D.; Volff, J.; et al. Whole-genome sequence of a flatfish provides insights into ZW sex chromosome evolution and adaptation to a benthic lifestyle. Nat. Genet. 2014, 46, 253–260. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Gao, Z.; Rapp, D.; O’Bryant, P.; Yao, H.; Cao, X. Effects of temperature and genotype on sex determination and sexual size dimorphism of bluegill sunfish Lepomis macrochirus. Aquaculture 2014, 420–421, S64–S71. [Google Scholar] [CrossRef]
- Caroline, J.; Morimoto, I.R. Role of the heat shock response and molecular chaperones in oncogenesis and cell death. J. Natl. Cancer Inst. 2000, 92, 1564–1572. [Google Scholar]
- Feder, M.E.; Hofmann, G.E. Heat-shock proteins, molecular chaperones, and the stress response: Evolutionary and ecological physiology. Annu. Rev. Physiol. 1999, 61, 243–282. [Google Scholar] [CrossRef] [PubMed]
- Zhuravleva, A.; Gierasch, L.M. Substrate-binding domain conformational dynamics mediate Hsp70 allostery. Proc. Natl. Acad. Sci. USA 2015, 112, S2825–S2873. [Google Scholar] [CrossRef] [PubMed]
- Zhang, A.; Zhou, X.; Wang, X.; Zhou, H. Characterization of two heat shock proteins (Hsp70/Hsc70) from grass carp (Ctenopharyngodon idella): Evidence for their differential gene expression, protein synthesis and secretion in LPS-challenged peripheral blood lymphocytes. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2011, 159, 109–114. [Google Scholar] [CrossRef] [PubMed]
- Beg, M.U.; Al-Subiai, S.; Beg, K.R.; Butt, S.A.; Al-Jandal, N.; Al-Hasan, E.; Al-Hussaini, M. Seasonal. Effect on heat shock proteins in fish from kuwait bay. Bull Environ. Contam. Toxicol. 2010, 84, 91–95. [Google Scholar] [CrossRef]
- Park, H.; Ahn, I.Y.; Lee, H.E. Expression of heat shock protein 70 in the thermally stressed antarctic clam Laternula elliptica. Cell Stress Chaperones 2007, 12, 275–282. [Google Scholar] [CrossRef] [PubMed]
- Goldfarb, S.B.; Kashlan, O.B.; Watkins, J.N.; Suaud, L.; Yan, W.; Kleyman, T.R.; Rubenstein, R.C. Differential effects of Hsc70 and Hsp70 on the intracellular trafficking and functional expression of epithelial sodium channels. Proc. Natl. Acad. Sci. USA 2006, 103, 5817–5822. [Google Scholar] [CrossRef]
- Uchimura, T.; Hara, S.; Yazawa, T.; Kamei, Y.; Kitano, T. Involvement of heat shock proteins on the transcriptional regulation of corticotropin-releasing hormone in medaka. Front Endocrinol. 2019, 10, 529. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Chen, X.; Dai, Y.; Zhang, Y.; Sun, Y.; Cui, X. Comparative transcriptome analysis of heat-induced domesticated zebrafish during gonadal differentiation. BMC Genom. 2022, 23, 39. [Google Scholar] [CrossRef]
- Wang, Q.; Hao, X.; Liu, K.; Feng, B.; Li, S.; Zhang, Z.; Tang, L.; Mahboob, S.; Shao, C. Early response to heat stress in Chinese tongue sole (Cynoglossus semilaevis): Performance of different sexes, candidate genes and networks. BMC Genom. 2020, 21, 1–10. [Google Scholar] [CrossRef]
- Wang, Q.; Liu, K.; Feng, B.; Zhang, Z.; Wang, R.; Tang, L.; Li, W.; Li, Q.; Piferrer, F.; Shao, C. Transcriptome of gonads from high temperature induced sex reversal during sex determination and differentiation in Chinese tongue sole, Cynoglossus semilaevis. Front Genet. 2019, 10, 1128. [Google Scholar] [CrossRef]
- Chen, S.; Tian, Y.; Yang, J.; Shao, C.; Ji, X.; Zhai, J.; Liao, X.; Zhuang, Z.; Su, P.; Xu, J.; et al. Artificial gynogenesis and sex determination in half-smooth tongue sole (Cynoglossus semilaevis). Mar. Biotechnol. 2009, 11, 243–251. [Google Scholar] [CrossRef] [PubMed]
- Liao, X.; Ma, H.; Xu, G.; Shao, C.; Tian, Y.; Ji, X.; Yang, J.; Chen, S. Construction of a genetic linkage map and mapping of a female-specific DNA marker in half-smooth tongue sole (Cynoglossus semilaevis). Mar. Biotechnol. 2009, 11, 699–709. [Google Scholar] [CrossRef]
- Shao, C.; Li, Q.; Chen, S.; Zhang, P.; Lian, J.; Hu, Q.; Sun, B.; Jin, L.; Liu, S.; Wang, Z.; et al. Epigenetic modification and inheritance in sexual reversal of fish. Genome Res. 2014, 24, 604–615. [Google Scholar] [CrossRef]
- Freeman, C.B.; Myers, P.M.; Robert, S.; Morimoto, I.R. Identification of a regulatory motif in Hsp70 that affects ATPase activity, substrate binding and interaction with HDJ-1. EMBO J. 1995, 14, 2281–2292. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.; Daniels, C.K.; Cao, S. Comprehensive review on the HSC70 functions, interactions with related molecules and involvement in clinical diseases and therapeutic potential. Pharmacol. Therapeut. 2012, 136, 354–374. [Google Scholar] [CrossRef] [PubMed]
- Zafarullah, M.; Wisniewski, J.; Shworak, N.W.; Schieman, S.; Misra, S.; Gedamu, L. Molecular cloning and characterization of a constitutively expressed heat-shock-cognate hsc71 gene from rainbow trout. Eur. J. Biochem. 1992, 204, 893–900. [Google Scholar] [CrossRef]
- Ali, K.S.; Dorgai, L.; Ábrahám, M.; Hermesz, E. Tissue- and stressor-specific differential expression of two hsc70 genes in carp. Biochem. Biophys. Res. Commun. 2003, 307, 503–509. [Google Scholar] [CrossRef]
- Wang, P.; Xu, P.; Zeng, S.; Zhou, L.; Zeng, L.; Li, G. Comparative analysis of sequence feature and expression of two heat shock cognate 70 genes in mandarin fish Siniperca chuatsi. Gene 2015, 560, 226–236. [Google Scholar] [CrossRef]
- Poompoung, P.; Panprommin, D.; Srisapoome, P.; Poompuang, S. Cloning and expression of two hsc70 genes in walking catfish Clarias macrocephalus (Günther, 1864) challenged with Aeromonas hydrophila. Aquac. Res. 2014, 45, 1319–1331. [Google Scholar] [CrossRef]
- Lu, Y.; Liu, Q.; Liu, K.; Wang, H.; Li, C.; Wang, Q.; Shao, C. Identification of global alternative splicing and sex-specific splicing via comparative transcriptome analysis of gonads of Chinese tongue sole (Cynoglossus semilaevis). Zool. Res. 2022, 43, 319–330. [Google Scholar] [CrossRef]
- Zhao, X.; Feng, B.; Wang, Q.; Tang, L.; Liu, Q.; Ma, W.; Li, C.; Shao, C. Cloning of the maternal effector gene org and its regulation by lncRNA ORG-AS in Chinese tongue sole (Cynoglossus semilaevis). Int. J. Mol. Sci. 2022, 23, 8605. [Google Scholar] [CrossRef]
- Ahn, S.; Kim, S.; Yoon, J.; Vacratsis, P. Heat-shock cognate 70 is required for the activation of heat-shock factor 1 in mammalian cells. Biochem. J. 2005, 392, 145–152. [Google Scholar] [CrossRef] [PubMed]
- Chuang, K.; Ho, S.; Song, Y. Cloning and expression analysis of heat shock cognate 70 gene promoter in tiger shrimp (Penaeus monodon). Gene 2007, 405, 10–18. [Google Scholar] [CrossRef] [PubMed]
- Dong, X.; Chen, S.; Ji, X.; Shao, C. Molecular cloning, characterization and expression analysis of sox9a and foxl2 genes in half-smooth tongue sole (Cynoglossus semilaevis). ACTA Oceanol. Sin. 2011, 30, 68–77. [Google Scholar] [CrossRef]
- Shao, C.; Liu, G.; Liu, S.; Liu, C.; Chen, S. Characterization of the cyp19a1a gene from a BAC sequence in half-smooth tongue sole (Cynoglossus semilaevis) and analysis of its conservation among teleosts. ACTA Oceanol. Sin. 2013, 32, 35–43. [Google Scholar] [CrossRef]
- Deng, S.; Chen, S.; Xu, J.; Liu, B. Molecular cloning, characterization and expression analysis of gonadal P450 aromatase in the half-smooth tongue-sole, Cynoglossus semilaevis. Aquaculture 2009, 287, 211–218. [Google Scholar] [CrossRef]
- Wang, Y.Y.; Sun, L.X.; Zhu, J.J.; Zhao, Y.; Wang, H.; Liu, H.J.; Ji, X.S. Epigenetic control of cyp19a1a expression is critical for high temperature induced Nile tilapia masculinization. J. Therm. Biol. 2017, 69, 76–84. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Liu, X.; Jin, C.; Du, X.; He, Y.; Zhang, Q. Transcriptome profiling insights the feature of sex reversal induced by high temperature in tongue sole Cynoglossus semilaevis. Front Genet. 2019, 10, 522. [Google Scholar] [CrossRef] [PubMed]








| Primer Name | Sequence (5’-3’) | Purpose |
|---|---|---|
| hsc70-F | CGAAGCATGTAACTTCCTTTTC | Partial fragment |
| hsc70-R | GTGATGAACCGAGTGATACCAA | amplification |
| hsc70-like-F | TCATCCTCTCAACCAACTAACC | |
| hsc70-like-R | TCACATCCTCACAGATCAAAAA | |
| hsc70-pro-F | GAAAGATACAGTTAAAGCCCCAGG | |
| hsc70-pro-R | CATGATTCCTAGTTAGAAAAAGAAAAGTG | |
| hsc70-like-pro-F | TCCATTAGAAGCCCCTCACGAT | |
| hsc70-like-pro-R | GTCTTTGAACCTGAGGAGGCAAC | |
| hsc70-5’gsp | TGTTGTCCTGTTGCCCTGGTCGTTGGC | RACE |
| hsc70-3’gsp | GGTATGCCTGGTGGCTTCTCCGGTGCA | |
| hsc70-5’ngsp | CGGTGTTAGAAGGAAAAGGAAG | |
| hsc70-3’ngsp | TCTGGACCAACCATTGAGGAGGTCGAC | |
| hsc70-like-5’gsp | CATGCTGGAACACGGCCACACAGGA | |
| hsc70-like-3’gsp | CTGATTTCCCTGGGCCTAGAGGCGA | |
| hsc70-like-5’ngsp | TTCGACATGTCTTTGAACCTGAGGGGTT | |
| hsc70-like-3’ngsp | ACAGCAGTTGTACCAGTTCACAGACGTT | |
| hsc70-qF | ACAAGAACCAGACTGCCGAGAAG | RT—qPCR |
| hsc70-qR | CCTCAGGCATGTTACCAGACATTC | |
| hsc70-like-qF | AGTGTGTCAAACGCCGTGGTAA | |
| hsc70-like-qR | CCACCTTTTTGTCCAGACCGTAG | |
| β-actin-qF | GCTGTGCTGTCCCTGTA | |
| β-actin-qR | GAGTAGCCACGCTCTGTC | |
| gfp-qF | ACAACAGCCACAACGTCTAT | |
| gfp -qR | ATGTTGTGGCGGATCTTGAA | |
| 293Tβ-actin-qF | GATGATATCGCCGCGCTCGT | |
| 293Tβ-actin-qR | GTAGATGGGCACAGTGTGGGTG | |
| sox9a-qF | CAGGCAGGTAATGTTGGGGT | |
| sox9a-qR | AAGGAGCCGTAGGTGATGTG | |
| cyp19a1a-qF | CTCTGTTCCTCAGGTTTCTCTC | |
| cyp19a1a-qR | GATGTGACCCAGTGTGTGTTG | |
| hsc70-proluc-F | cgagctcGAAAGATACAGTTAAAGCC | Plasmid construction |
| hsc70-proluc-R | ccgctcgagGATTCCTAGTTAGAAAAAG | |
| hsc70-progfp-F | ggaattccatatgGAAAGATACAGTTAAAGCCCCAG | |
| hsc70-prgfp-R | ccgctcgagGATTCCTAGTTAGAAAAAGAAAAGTGAT | |
| hsc70-like-proluc-F | ggggtaccTCCATTAGAAGCCCCTCAC | |
| hsc70-like-proluc-R | ccgctcgagGTCTTTGAACCTGAGGA | |
| hsc70-like-progfp-F | ggaattccatatgTCCATTAGAAGCCCCTCAC | |
| hsc70-like-progfp-R | ccgctcgagGTCTTTGAACCTGAG | |
| hsc70-CDS-F | ggggtaccATGTCAAAGGGACCAG | |
| hsc70-CDS-R | gctctagaGTCGACCTCCTCAATGGTTG | |
| hsc70-like-CDS-F | ggggtaccATGTCGAAGGAAACAGC | |
| hsc70-like-CDS-R | gctctagaGTCAACCTCCTCCACTGTG | |
| sex-F | CCTAAATGATGGATGTAGATTCTGTC | Sex identification |
| sex-R | GATCCAGAGAAAATAAACCCAGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Q.; Wang, Y.; Tan, L.; Ma, W.; Zhao, X.; Shao, C.; Wang, Q. The Role of the Heat Shock Cognate Protein 70 Genes in Sex Determination and Differentiation of Chinese Tongue Sole (Cynoglossus semilaevis). Int. J. Mol. Sci. 2023, 24, 3761. https://doi.org/10.3390/ijms24043761
Liu Q, Wang Y, Tan L, Ma W, Zhao X, Shao C, Wang Q. The Role of the Heat Shock Cognate Protein 70 Genes in Sex Determination and Differentiation of Chinese Tongue Sole (Cynoglossus semilaevis). International Journal of Molecular Sciences. 2023; 24(4):3761. https://doi.org/10.3390/ijms24043761
Chicago/Turabian StyleLiu, Qian, Yue Wang, Leilei Tan, Wenxiu Ma, Xiaona Zhao, Changwei Shao, and Qian Wang. 2023. "The Role of the Heat Shock Cognate Protein 70 Genes in Sex Determination and Differentiation of Chinese Tongue Sole (Cynoglossus semilaevis)" International Journal of Molecular Sciences 24, no. 4: 3761. https://doi.org/10.3390/ijms24043761
APA StyleLiu, Q., Wang, Y., Tan, L., Ma, W., Zhao, X., Shao, C., & Wang, Q. (2023). The Role of the Heat Shock Cognate Protein 70 Genes in Sex Determination and Differentiation of Chinese Tongue Sole (Cynoglossus semilaevis). International Journal of Molecular Sciences, 24(4), 3761. https://doi.org/10.3390/ijms24043761

