Biomarkers in the Rat Hippocampus and Peripheral Blood for an Early Stage of Mental Disorders Induced by Water Immersion Stress
Abstract
1. Introduction
2. Results
2.1. Effects of Water Immersion Stress on Body Weight and Serum Corticosterone Levels
2.2. Behavioral Changes after Water Immersion Stress
2.3. Protein Expression Profiles in the Hippocampus
2.4. Gene Expression Profiles in the Hippocampus and Peripheral Blood
3. Discussion
4. Materials and Methods
4.1. Animals and Stress Protocol
4.2. Sample Collection
4.3. Open Field Test
4.4. Light/Dark Box Test
4.5. Total RNA Extraction
4.6. Reverse-Transcription Polymerase Chain Reaction (RT-PCR)
4.7. Enzyme-Linked Immunosorbent Assay (ELISA)
4.8. Extraction of Total Soluble Protein
4.9. Western Blot Analysis
4.10. Statistical Analyses
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| APP | Acute Phase Protein |
| BDNF | Brain-Derived Neurotrophic Factor |
| CEBPD | CCAAT/Enhancer-Binding Protein (C/EBP) Delta |
| CMS | Chronic Mild Stress |
| GAPDH | Glyceraldehyde 3-Phosphate Dehydrogenase |
| KLF4 | Krüpppel-like factor 4 |
| KSR1 | Kinase Suppressor of Ras 1 |
| LEF1 | Lymphoid Enhancer-Binding Factor 1 |
| MKP-1 | Mitogen-Activated Protein Kinase (MAPK) Phosphatase 1 |
| MMP-8 | Matrix Metalloproteinase-8 |
| NGFR | Nerve Growth Factor Receptor |
| PRX | Peroxiredoxin |
| SENP5 | Small Ubiquitin-Like Modifier Proteins (SUMO)1/Sentrin-Specific Peptidase 5 |
| Stress Marker | Stress-Responsive Biomarker |
| TCF | T Cell Factor |
References
- Hemmerle, A.M.; Herman, J.P.; Seroogy, K.B. Stress, depression and Parkinson’s disease. Exp. Neurol. 2012, 233, 79–86. [Google Scholar] [CrossRef] [Scilit]
- van Praag, H.M. Can stress cause depression? Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2004, 28, 891–907. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dogra, S.; Conn, P.J. Targeting metabotropic glutamate receptors for the treatment of depression and other stress-related disorders. Neuropharmacology 2021, 196, 108687. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duric, V.; Banasr, M.; Licznerski, P.; Schmidt, H.D.; Stockmeier, C.A.; Simen, A.A.; Newton, S.S.; Duman, R.S. A negative regulator of MAP kinase causes depressive behavior. Nat. Med. 2010, 16, 1328–1332. [Google Scholar] [CrossRef] [Scilit]
- Fink, G. Stress Controversies: Post-Traumatic Stress Disorder, Hippocampal Volume, Gastroduodenal Ulceration*. J. Neuroendocrinol. 2011, 23, 107–117. [Google Scholar] [CrossRef] [Scilit]
- Masi, G.; Brovedani, P. The Hippocampus, Neurotrophic Factors and Depression: Possible Implications for the Pharma-cotherapy of Depression. CNS Drugs 2011, 25, 913–931. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kronmüller, K.-T.; Schröder, J.; Köhler, S.; Götz, B.; Victor, D.; Unger, J.; Giesel, F.; Magnotta, V.; Mundt, C.; Essig, M.; et al. Hippocampal volume in first episode and recurrent depression. Psychiatry Res. Neuroimaging 2009, 174, 62–66. [Google Scholar] [CrossRef] [Scilit]
- Fairhall, S.L.; Sharma, S.; Magnusson, J.; Murphy, B. Memory related dysregulation of hippocampal function in major depressive disorder. Biol. Psychol. 2010, 85, 499–503. [Google Scholar] [CrossRef] [Scilit]
- Xi, G.; Hui, J.; Zhang, Z.; Liu, S.; Zhang, X.; Teng, G.; Chan, K.C.W.; Wu, E.X.; Nie, B.; Shan, B.; et al. Learning and Memory Alterations Are Associated with Hippocampal N-acetylaspartate in a Rat Model of Depression as Measured by 1H-MRS. PLoS ONE 2011, 6, e28686. [Google Scholar] [CrossRef] [Scilit]
- Blase, K.; Vermetten, E.; Lehrer, P.; Gevirtz, R. Neurophysiological Approach by Self-Control of Your Stress-Related Autonomic Nervous System with Depression, Stress and Anxiety Patients. Int. J. Environ. Res. Public Health 2021, 18, 3329. [Google Scholar] [CrossRef] [Scilit]
- Thayer, J.F.; Åhs, F.; Fredrikson, M.; Sollers, J.J., III; Wager, T.D. A meta-analysis of heart rate variability and neuroimaging studies: Implications for heart rate variability as a marker of stress and health. Neurosci. Biobehav. Rev. 2012, 36, 747–756. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dhama, K.; Latheef, S.K.; Dadar, M.; Samad, H.A.; Munjal, A.; Khandia, R.; Karthik, K.; Tiwari, R.; Yatoo, M.I.; Bhatt, P.; et al. Biomarkers in Stress Related Diseases/Disorders: Diagnostic, Prognostic, and Therapeutic Values. Front. Mol. Biosci. 2019, 6, 91. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giacomello, G.; Scholten, A.; Parr, M.K. Current methods for stress marker detection in saliva. J. Pharm. Biomed. Anal. 2020, 191, 113604. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shalyapina, V.G.; Mokrushin, A.A.; Khama-Murad, A.K.; Semenova, O.G. Effects of Corticoliberin on Synaptic Transmission in Rat Olfactory Cortex Slices in a Water Immersion Model of Depression. Neurosci. Behav. Physiol. 2009, 39, 701–707. [Google Scholar] [CrossRef] [Scilit]
- Takemoto, H.; Take, C.; Kojima, K.; Kuga, Y.; Hamada, T.; Yasugi, T.; Kato, N.; Koike, K.; Masuo, Y. Effects of Sesame Oil Aroma on Mice after Exposure to Water Immersion Stress: Analysis of Behavior and Gene Expression in the Brain. Molecules 2020, 25, 5915. [Google Scholar] [CrossRef] [Scilit]
- Homberg, J.R.; Molteni, R.; Calabrese, F.; Riva, M.A. The serotonin–BDNF duo: Developmental implications for the vulnerability to psychopathology. Neurosci. Biobehav. Rev. 2014, 43, 35–47. [Google Scholar] [CrossRef] [Scilit]
- Engel, D.; Zomkowski, A.D.; Lieberknecht, V.; Rodrigues, A.L.; Gabilan, N.H. Chronic administration of duloxetine and mirtazapine downregulates proapoptotic proteins and upregulates neurotrophin gene expression in the hippocampus and cerebral cortex of mice. J. Psychiatr. Res. 2013, 47, 802–808. [Google Scholar] [CrossRef] [Scilit]
- Abelaira, H.M.; Réus, G.Z.; Ribeiro, K.F.; Steckert, A.V.; Mina, F.; Rosa, D.V.; Santana, C.V.; Romano-Silva, M.A.; Dal-Pizzol, F.; Quevedo, J. Effects of lamotrigine on behavior, oxidative parameters and signaling cascades in rats exposed to the chronic mild stress model. Neurosci. Res. 2013, 75, 324–330. [Google Scholar] [CrossRef] [Scilit]
- Anisman, H.; Merali, Z.; Hayley, S. Neurotransmitter, peptide and cytokine processes in relation to depressive disorder: Comorbidity between depression and neurodegenerative disorders. Prog. Neurobiol. 2008, 85, 1–74. [Google Scholar] [CrossRef] [Scilit]
- Silberstein, S.; Liberman, A.C.; Dos Santos Claro, P.A.; Ugo, M.B.; Deussing, J.M.; Arzt, E. Stress-Related Brain Neuroinflammation Impact in Depression: Role of the Corticotropin-Releasing Hormone System and P2X7 Receptor. Neuroimmunomodulation 2021, 28, 52–60. [Google Scholar] [CrossRef] [Scilit]
- Hayakawa, M.; Satou, T.; Koike, K.; Masuo, Y. Anti-fatigue activity of essential oil from thyme (linalool chemotype) in the polyriboinosinic:polyribocytidylic acid-induced brain fatigue mouse. Flavour Fragr. J. 2016, 31, 395–399. [Google Scholar] [CrossRef] [Scilit]
- You, Z.; Luo, C.; Zhang, W.; Chen, Y.; He, J.; Zhao, Q.; Zuo, R.; Wu, Y. Pro- and anti-inflammatory cytokines expression in rat’s brain and spleen exposed to chronic mild stress: Involvement in depression. Behav. Brain Res. 2011, 225, 135–141. [Google Scholar] [CrossRef] [Scilit]
- Boda, E. Myelin and oligodendrocyte lineage cell dysfunctions: New players in the etiology and treatment of depression and stress-related disorders. Eur. J. Neurosci. 2021, 53, 281–297. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Masuo, Y.; Satou, T.; Takemoto, H.; Koike, K. Smell and Stress Response in the Brain: Review of the Connection between Chemistry and Neuropharmacology. Molecules 2021, 26, 2571. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Speers, A.B.; Cabey, K.A.; Soumyanath, A.; Wright, K.M. Effects of Withania somnifera (Ashwagandha) on Stress and the Stress-Related Neuropsychiatric Disorders Anxiety, Depression, and Insomnia. Curr. Neuropharmacol. 2021, 19, 1468–1495. [Google Scholar] [CrossRef] [Scilit]
- Seo, H.-S.; Hirano, M.; Shibato, J.; Rakwal, R.; Hwang, I.K.; Masuo, Y. Effects of Coffee Bean Aroma on the Rat Brain Stressed by Sleep Deprivation: A Selected Transcript- and 2D Gel-Based Proteome Analysis. J. Agric. Food Chem. 2008, 56, 4665–4673. [Google Scholar] [CrossRef] [Scilit]
- Takemoto, H.; Saito, Y.; Misumi, K.; Nagasaki, M.; Masuo, Y. Stress-Relieving Effects of Sesame Oil Aroma and Identification of the Active Components. Molecules 2022, 27, 2661. [Google Scholar] [CrossRef] [Scilit]
- Hughes, M.M.; Connor, T.J.; Harkin, A. Stress-Related Immune Markers in Depression: Implications for Treatment. Int. J. Neuropsychopharmacol. 2016, 19, pyw001. [Google Scholar] [CrossRef] [Scilit]
- Chung, S.; Son, G.H.; Kim, K. Circadian rhythm of adrenal glucocorticoid: Its regulation and clinical implications. Biochim. et Biophys. Acta BBA Mol. Basis Dis. 2011, 1812, 581–591. [Google Scholar] [CrossRef] [Scilit]
- Pérez-Nievas, B.G.; García-Bueno, B.; Caso, J.R.; Menchén, L.; Leza, J.C. Corticosterone as a marker of susceptibility to oxidative/nitrosative cerebral damage after stress exposure in rats. Psychoneuroendocrinology 2007, 32, 703–711. [Google Scholar] [CrossRef] [Scilit]
- Ge, F.; Yang, H.; Lu, W.; Shi, H.; Chen, Q.; Luo, Y.; Liu, L.; Yan, J. Ovariectomy Induces Microglial Cell Activation and Inflammatory Response in Rat Prefrontal Cortices to Accelerate the Chronic Unpredictable Stress-Mediated Anxiety and Depression. BioMed Res. Int. 2020, 2020, 3609758. [Google Scholar] [CrossRef] [Scilit]
- Hou, Y.; Chen, M.; Wang, C.; Liu, L.; Mao, H.; Qu, X.; Shen, X.; Yu, B.; Liu, S. Electroacupuncture Attenuates Anxiety-Like Behaviors in a Rat Model of Post-traumatic Stress Disorder: The Role of the Ventromedial Prefrontal Cortex. Front. Neurosci. 2021, 15, 690159. [Google Scholar] [CrossRef] [Scilit]
- Dwivedi, Y.; Rizavi, H.S.; Conley, R.R.; Roberts, R.C.; Tamminga, C.A.; Pandey, G.N. Altered Gene Expression of Brain-Derived Neurotrophic Factor and Receptor Tyrosine Kinase B in Postmortem Brain of Suicide Subjects. Arch. Gen. Psychiatry 2003, 60, 804–815. [Google Scholar] [CrossRef] [Scilit]
- First, M.; Gil-Ad, I.; Taler, M.; Tarasenko, I.; Novak, N.; Weizman, A. The Effects of Reboxetine Treatment on Depression-like Behavior, Brain Neurotrophins, and ERK Expression in Rats Exposed to Chronic Mild Stress. J. Mol. Neurosci. 2013, 50, 88–97. [Google Scholar] [CrossRef] [Scilit]
- Saito, Y.; Nishio, K.; Ogawa, Y.; Kinumi, T.; Yoshida, Y.; Masuo, Y.; Niki, E. Molecular mechanisms of 6-hydroxydopamine-induced cytotoxicity in PC12 cells: Involvement of hydrogen peroxide-dependent and -independent action. Free Radic. Biol. Med. 2007, 42, 675–685. [Google Scholar] [CrossRef] [Scilit]
- Lucca, G.; Comim, C.M.; Valvassori, S.S.; Réus, G.Z.; Vuolo, F.; Petronilho, F.; Dal-Pizzol, F.; Gavioli, E.C.; Quevedo, J. Effects of chronic mild stress on the oxidative parameters in the rat brain. Neurochem. Int. 2009, 54, 358–362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Forlenza, M.J.; Miller, G.E. Increased Serum Levels of 8-Hydroxy-2′-Deoxyguanosine in Clinical Depression. Psychosom. Med. 2006, 68, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Nautiyal, M.; Katakam, P.V.G.; Busija, D.W.; Gallagher, P.E.; Tallant, E.A.; Chappell, M.C.; Diz, D.I. Differences in oxidative stress status and expression of MKP-1 in dorsal medulla of transgenic rats with altered brain renin-angiotensin system. Am. J. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2012, 303, R799–R806. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poli, V. The Role of C/EBP Isoforms in the Control of Inflammatory and Native Immunity Functions. J. Biol. Chem. 1998, 273, 29279–29282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taubenfeld, S.M.; Wiig, K.A.; Monti, B.; Dolan, B.; Pollonini, G.; Alberini, C.M. Fornix-Dependent Induction of Hippocampal CCAAT Enhancer-Binding Protein β and δ Co-Localizes with Phosphorylated cAMP Response Element-Binding Protein and Accompanies Long-Term Memory Consolidation. J. Neurosci. 2001, 21, 84–91. [Google Scholar] [CrossRef] [Scilit]
- Sun, Y.; Jia, L.; Williams, M.T.; Zamzow, M.; Ran, H.; Quinn, B.; Aronow, B.J.; Vorhees, C.V.; Witte, D.P.; Grabowski, G.A. Temporal gene expression profiling reveals CEBPD as a candidate regulator of brain disease in prosaposin deficient mice. BMC Neurosci. 2008, 9, 76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, R.; Strohmeyer, R.; Liang, Z.; Lue, L.-F.; Rogers, J. CCAAT/enhancer binding protein δ (C/EBPδ) expression and elevation in Alzheimer’s disease. Neurobiol. Aging 2004, 25, 991–999. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hay, R.T. SUMO: A History of Modification. Mol. Cell 2005, 18, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alexander, J.S.; Harris, M.K.; Wells, S.R.; Mills, G.; Chalamidas, K.; Ganta, V.C.; McGee, J.; Jennings, M.H.; Gonzalez-Toledo, E.; Minagar, A. Alterations in serum MMP-8, MMP-9, IL-12p40 and IL-23 in multiple sclerosis patients treated with interferon-β1b. Mult. Scler. J. 2010, 16, 801–809. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cox, J.H.; Starr, A.E.; Kappelhoff, R.; Yan, R.; Roberts, C.R.; Overall, C.M. Matrix metalloproteinase 8 deficiency in mice exacerbates inflammatory arthritis through delayed neutrophil apoptosis and reduced caspase 11 expression. Arthritis Rheum. 2010, 62, 3645–3655. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shalin, S.C.; Hernandez, C.M.; Dougherty, M.K.; Morrison, D.K.; Sweatt, J.D. Kinase Suppressor of Ras1 Compartmentalizes Hippocampal Signal Transduction and Subserves Synaptic Plasticity and Memory Formation. Neuron 2006, 50, 765–779. [Google Scholar] [CrossRef] [Scilit]
- Rowland, B.D.; Bernards, R.; Peeper, D.S. The KLF4 tumour suppressor is a transcriptional repressor of p53 that acts as a context-dependent oncogene. Nat. Cell Biol. 2005, 7, 1074–1082. [Google Scholar] [CrossRef] [Scilit]
- Moore, D.L.; Blackmore, M.G.; Hu, Y.; Kaestner, K.H.; Bixby, J.L.; Lemmon, V.P.; Goldberg, J.L. KLF Family Members Regulate Intrinsic Axon Regeneration Ability. Science 2009, 326, 298–301. [Google Scholar] [CrossRef] [Scilit]
- Wodarz, A.; Nusse, R.; Montcouquiol, M.; Iii, E.B.C.; Kelley, M.W.; Logan, C.Y.; Yang, Y.; Mlodzik, M.; Simons, M.; Klein, T.J.; et al. MECHANISMS OF WNT SIGNALING IN DEVELOPMENT. Annu. Rev. Cell Dev. Biol. 1998, 14, 59–88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lie, D.-C.; Colamarino, S.A.; Song, H.-J.; Désiré, L.; Mira, H.; Consiglio, A.; Lein, E.S.; Jessberger, S.; Lansford, H.; Dearie, A.R.; et al. Wnt signalling regulates adult hippocampal neurogenesis. Nature 2005, 437, 1370–1375. [Google Scholar] [CrossRef] [Scilit]
- Martinowich, K.; Schloesser, R.J.; Lu, Y.; Jimenez, D.V.; Paredes, D.; Greene, J.S.; Greig, N.H.; Manji, H.K.; Lu, B. Roles of p75NTR, Long-Term Depression, and Cholinergic Transmission in Anxiety and Acute Stress Coping. Biol. Psychiatry 2012, 71, 75–83. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galceran, J.; Miyashita-Lin, E.M.; Devaney, E.; Rubenstein, J.L.; Grosschedl, R. Hippocampus development and generation of dentate gyrus granule cells is regulated by LEF1. Development 2000, 127, 469–482. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rowland, T.; Perry, B.I.; Upthegrove, R.; Barnes, N.; Chatterjee, J.; Gallacher, D.; Marwaha, S. Neurotrophins, cytokines, oxidative stress mediators and mood state in bipolar disorder: Systematic review and meta-analyses. Br. J. Psychiatry 2018, 213, 514–525. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Forward Primer | Reverse Primer | |||||
|---|---|---|---|---|---|---|
| Accession | Primer | Nucleotide Sequence (5′–3′) | Primer | Nucleotide Sequence (5′-3′) | Product | Description |
| (Gene) | Name | Name | Size (bp) | |||
| X02231 X00972 | RB001 | TCCCTCAAGATTGTCAGCAA | RB002 | AGATCCACAACGGATACATT | 308 | GAPDH |
| NM_053769 | KS001 | GACAACCACAAGGCAGACATTA | KS002 | GGGAAGTTGAAGACCGTTGTAG | 347 | MKP-1 |
| NM_013154 | KS003 | ACCAGGAGATGCAGCAGAAG | KS004 | GCCCAAGAAACTGTAGCAATTC | 256 | CEBPD |
| NM_053713 | KS005 | TCCAAGGGACAAAAGAAAAGAA | KS006 | TGGCTTTTTAGAAGGCAAAGAG | 312 | KLF4 |
| NM_130429 | KS007 | CAGAGAAAGGAACAGGAGCCTA | KS008 | TTCTGGGACCTGTACCTGAAGT | 319 | LEF1 |
| XM_002724729 | KS009 | GGCAGACTGCTGTTACAAAGTG | KS010 | ACAATAAGTGGCCCAATACCAC | 305 | SENP5 |
| NM_022221 | KS011 | CATATCTCTGTTCTGGCCCTTC | KS012 | GCTATGCTAGTGGGGTAACCTG | 291 | MMP-8 |
| NM_001108284 | KS013 | CAGAAGGAAGAGGAAAAGCAAA | KS014 | CGGTCTAGAAGCCACAGAGATT | 251 | KSR1 |
| XM_001080891 | ||||||
| XM_340852 | ||||||
| X05137 | KS015 | CTGGGTTACCAGCCTGAACATA | KS016 | GCTGGCTAGAACATCAGTCGTC | 249 | NGFR |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Suzuki, K.; Shibato, J.; Rakwal, R.; Takaura, M.; Hotta, R.; Masuo, Y. Biomarkers in the Rat Hippocampus and Peripheral Blood for an Early Stage of Mental Disorders Induced by Water Immersion Stress. Int. J. Mol. Sci. 2023, 24, 3153. https://doi.org/10.3390/ijms24043153
Suzuki K, Shibato J, Rakwal R, Takaura M, Hotta R, Masuo Y. Biomarkers in the Rat Hippocampus and Peripheral Blood for an Early Stage of Mental Disorders Induced by Water Immersion Stress. International Journal of Molecular Sciences. 2023; 24(4):3153. https://doi.org/10.3390/ijms24043153
Chicago/Turabian StyleSuzuki, Keisuke, Junko Shibato, Randeep Rakwal, Masahiko Takaura, Ryotaro Hotta, and Yoshinori Masuo. 2023. "Biomarkers in the Rat Hippocampus and Peripheral Blood for an Early Stage of Mental Disorders Induced by Water Immersion Stress" International Journal of Molecular Sciences 24, no. 4: 3153. https://doi.org/10.3390/ijms24043153
APA StyleSuzuki, K., Shibato, J., Rakwal, R., Takaura, M., Hotta, R., & Masuo, Y. (2023). Biomarkers in the Rat Hippocampus and Peripheral Blood for an Early Stage of Mental Disorders Induced by Water Immersion Stress. International Journal of Molecular Sciences, 24(4), 3153. https://doi.org/10.3390/ijms24043153

